ID: 1139811733

View in Genome Browser
Species Human (GRCh38)
Location 16:69624605-69624627
Sequence GTGGATAGGGATAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 501
Summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 452}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139811733_1139811740 14 Left 1139811733 16:69624605-69624627 CCTTCCTCCTTATCCCTATCCAC 0: 1
1: 0
2: 4
3: 44
4: 452
Right 1139811740 16:69624642-69624664 ATATACTTTAGTGATTAACTAGG 0: 1
1: 0
2: 0
3: 15
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139811733 Original CRISPR GTGGATAGGGATAAGGAGGA AGG (reversed) Intronic
900526846 1:3133560-3133582 GTGGATCTTGGTAAGGAGGAGGG - Intronic
901740387 1:11338186-11338208 GGGGAGAGGGAGGAGGAGGAGGG - Intergenic
902186798 1:14731494-14731516 GTGGGAAGGGAAAGGGAGGATGG - Intronic
902554497 1:17238973-17238995 GTGAACAGGGATAAGGAAGAGGG - Intronic
904455481 1:30645471-30645493 GTGGAAAGGGAGAGAGAGGAAGG - Intergenic
904994321 1:34619123-34619145 GAGGAGAGGGAAAGGGAGGATGG + Intergenic
906493370 1:46285577-46285599 GTGGCTGGCGAGAAGGAGGATGG - Exonic
906868484 1:49449492-49449514 GTGGATAGGGCAGAGGAGGCAGG + Intronic
907448521 1:54526560-54526582 GTGGATGTAGCTAAGGAGGAAGG + Intergenic
908188484 1:61675864-61675886 TTGTATAGTGATTAGGAGGACGG + Intergenic
908589087 1:65609653-65609675 GTGGACAGGGATTAGTAGGAGGG + Intronic
910240926 1:85085412-85085434 CTGAACAGGGATATGGAGGAAGG + Intronic
910846795 1:91611918-91611940 GTGGATGGGGGCAAGGAGGGAGG + Intergenic
911433528 1:97824824-97824846 GTGCATTGGGATAAGAAAGAAGG - Intronic
912529251 1:110308180-110308202 GTGGATGGTCATAATGAGGAAGG - Intergenic
912819193 1:112853662-112853684 GGGGCTAGGGATAGGGAGAAAGG + Intergenic
913412021 1:118562601-118562623 TTGGATATGAATAAGGGGGAGGG + Intergenic
913460810 1:119084257-119084279 GTTGCTAGGGATGGGGAGGAGGG + Intronic
913488364 1:119355028-119355050 GTTGAAAGGGATGGGGAGGAGGG + Intergenic
915318446 1:155042887-155042909 GTAGATAGGGAGTGGGAGGAGGG + Intronic
916585926 1:166150073-166150095 CTGCATAGGGACAATGAGGATGG + Intronic
917691715 1:177476727-177476749 GTAAATGGGGAAAAGGAGGAGGG + Intergenic
919486117 1:198149339-198149361 GTGGAGAGGGAGGAGTAGGAAGG + Intergenic
919846662 1:201647270-201647292 GGGGACAGGGATGAGGTGGAGGG - Intronic
920008827 1:202853090-202853112 GTGGACAGGGGCATGGAGGAAGG - Intergenic
920282756 1:204856671-204856693 GGGGATAGGGAGAGGGAGAATGG - Intronic
921079223 1:211725407-211725429 GTGGAGAGAGAGGAGGAGGAGGG - Intergenic
921132171 1:212229332-212229354 GAAGAAAGGGAAAAGGAGGAAGG - Intergenic
922621472 1:226991938-226991960 GGGGAAAGGGAAGAGGAGGATGG + Exonic
922849145 1:228717521-228717543 CTGGAGAGGGATAGGTAGGATGG + Intergenic
923254058 1:232204555-232204577 TGGGATAGGGATATGGATGATGG + Intergenic
923307227 1:232699267-232699289 ATGGGCAGGGAAAAGGAGGAAGG + Intergenic
923927983 1:238657902-238657924 GTGGATAGGAGGAAAGAGGAGGG + Intergenic
924401919 1:243692391-243692413 GTGGATAGTCATAAGGACTAAGG - Intronic
924466823 1:244305707-244305729 GAGGACAGGGCTAAGGAGAAAGG + Intergenic
924585830 1:245360312-245360334 TGGGATGAGGATAAGGAGGATGG - Intronic
1062928762 10:1338727-1338749 GTGGATAGAGAGGTGGAGGAAGG + Intronic
1063606795 10:7529647-7529669 GAGGAGAGGGAAAGGGAGGAGGG + Intergenic
1063811279 10:9711252-9711274 ATGGACAGGGAAAAGGGGGATGG + Intergenic
1064038421 10:11935904-11935926 ATGGAGAGGGATATGGAGAAGGG + Intronic
1065512836 10:26496324-26496346 GTGGATTAGGGTCAGGAGGAGGG - Exonic
1065667708 10:28080441-28080463 GTGGAATGGGATAAGGGGAATGG - Intronic
1065908175 10:30278122-30278144 GTGGGTAGGGAGAAAGGGGAGGG + Intergenic
1067807867 10:49405758-49405780 GAGGAGAGAGAAAAGGAGGAAGG - Intergenic
1067842025 10:49688640-49688662 GAGGATAGGCAGAAGCAGGAGGG - Intronic
1068122116 10:52791764-52791786 GAGGAGGGGGAGAAGGAGGAAGG + Intergenic
1068873458 10:61970931-61970953 GTAGATTGAGAAAAGGAGGAGGG + Intronic
1069693371 10:70369268-70369290 GGGGGTGGGGATGAGGAGGAGGG - Intronic
1070473879 10:76813126-76813148 GTAGATAGGGATAAGGAGGTTGG - Intergenic
1070702465 10:78613557-78613579 GAGGAAAGGGGGAAGGAGGAAGG + Intergenic
1070877086 10:79825376-79825398 GTGCAGAGGGATAAGGGTGAGGG + Intergenic
1071643581 10:87341420-87341442 GTGCAGAGGGATAAGGGTGAGGG + Intergenic
1072251777 10:93587371-93587393 CTGGATCAGGATGAGGAGGATGG - Exonic
1072719611 10:97772270-97772292 GCGGAGAGAGATAAGGAGGAAGG - Intergenic
1072834279 10:98694746-98694768 GTGGATAGGGAGAAGGAGATAGG - Intronic
1073131222 10:101190296-101190318 GTGGGTAGGGAGGAGGAGGTTGG + Intergenic
1073340915 10:102743990-102744012 GAGGAGAGGGAGGAGGAGGAGGG + Exonic
1073823445 10:107291782-107291804 GTGGAGAGGGAAAAGTGGGAAGG - Intergenic
1074547288 10:114410862-114410884 GGGGCTAGGGAGAAGGAGAATGG - Intergenic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1076077354 10:127545062-127545084 GAGGAGAGGGAAAAGGAGGGAGG - Intergenic
1076350484 10:129811716-129811738 GTGGATAGGGATGGGGAGAAGGG - Intergenic
1076394450 10:130128852-130128874 GTGGCTTGGGCTAAGGAGAAGGG + Intergenic
1076980931 11:204328-204350 GAGGCTGGGGACAAGGAGGATGG + Exonic
1077532877 11:3105523-3105545 GTGGAGAGGGTTAAGGAGGACGG - Intronic
1080246951 11:30189980-30190002 GAGGGTAGAGATCAGGAGGAGGG - Intergenic
1080785908 11:35474852-35474874 ATGAATAGGGAAAAGGAAGAAGG + Intronic
1080807552 11:35668357-35668379 GTGGATAGGGGGTGGGAGGAAGG - Intronic
1082803611 11:57432418-57432440 GTGGGTAGGGATTAGCTGGAGGG + Intergenic
1084956462 11:72694132-72694154 GTGGATTGGGAGAGGGAGGAGGG - Intronic
1085147916 11:74219745-74219767 GTGGATGGGGAGAGGGAGGTGGG + Intronic
1085235098 11:75008483-75008505 GTGGATAGGAATAGGGAGGATGG + Exonic
1085752889 11:79177606-79177628 GTAGAGTGGGATAAGGAGGAAGG + Intronic
1085763790 11:79264594-79264616 GTGGGTTGGGATTAGGAGGCTGG + Intronic
1086038127 11:82441604-82441626 TTGGATAGGGTAGAGGAGGAGGG + Intergenic
1086069655 11:82786793-82786815 GTGGAGAGGGTAGAGGAGGAGGG - Intergenic
1086807706 11:91266482-91266504 GTGGTGAGAGATAAGGGGGAGGG + Intergenic
1086920041 11:92575804-92575826 GTTAATAGGCAGAAGGAGGAAGG + Intronic
1087260204 11:96002598-96002620 GATGATGGGGATGAGGAGGATGG + Intronic
1088007511 11:104960807-104960829 GTGGATAGAGATAAGTAGGCTGG - Intronic
1088297910 11:108321024-108321046 GTTGAGTAGGATAAGGAGGAAGG + Intronic
1088744468 11:112794065-112794087 GGGGAAAGGGATAGTGAGGAAGG + Intergenic
1089833721 11:121351389-121351411 GTGGATAGGTAATAGAAGGAGGG + Intergenic
1090983834 11:131748556-131748578 GTGGATGGGCACAGGGAGGAGGG - Intronic
1091129863 11:133136636-133136658 GAGAATAGGGAAAAGGAGAAAGG + Intronic
1091321159 11:134652961-134652983 GTGGGAAGGGAGATGGAGGAGGG - Intergenic
1091375519 12:22523-22545 GGGGAAAGGGGAAAGGAGGAAGG + Intergenic
1091425475 12:384434-384456 ATGGATGGGGGTATGGAGGATGG - Intronic
1091770234 12:3146665-3146687 GTGGAGAAAGATAAGGAGGCAGG - Intronic
1094003287 12:25719221-25719243 GTGGACAGGCATAAGTGGGAAGG - Intergenic
1094561638 12:31560027-31560049 GTGGATAGAGAAGAGGAAGAGGG - Intronic
1094583981 12:31759976-31759998 GTGGATAGGTATATGGAGTGGGG + Intergenic
1096732472 12:53625827-53625849 GTGGAATGGGAGAAAGAGGAGGG - Intronic
1096972098 12:55675096-55675118 GGGGATACTGATAATGAGGAAGG + Intergenic
1097952262 12:65444932-65444954 CTGGATAAGGATATGTAGGAGGG - Intronic
1098353005 12:69583398-69583420 TTGGATGGGGAGAAGGAGGCAGG - Intergenic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098464959 12:70776109-70776131 GTGGATAGGAAGAAGGAGAAAGG - Intronic
1098625218 12:72657756-72657778 GGGGAGAGGGTTAAGGATGAAGG + Intronic
1099002854 12:77201321-77201343 GTGGCTAGGGAGAAGGAGGCAGG + Intergenic
1099853987 12:88141599-88141621 GTGGGTAGGGGTGTGGAGGAAGG - Intronic
1100670147 12:96802819-96802841 GTGGGTAGGGAGCAGGGGGAGGG - Intronic
1100729345 12:97446922-97446944 GTGGATGGGGGCATGGAGGAAGG - Intergenic
1100811320 12:98341303-98341325 ATTTAAAGGGATAAGGAGGAAGG + Intergenic
1101195781 12:102380702-102380724 GTGGATGTGGAGAAAGAGGATGG + Intergenic
1101315524 12:103625501-103625523 GTGGGTGGGGGGAAGGAGGAGGG - Intronic
1101323629 12:103695935-103695957 GTGGCTATGGACAAGGATGAAGG - Intronic
1101583603 12:106065905-106065927 GTGGACAGGGAGAAAGATGATGG - Exonic
1102510278 12:113410445-113410467 GTGGAAAGGGTTGAGCAGGAAGG + Intronic
1102672442 12:114631516-114631538 GTGCATGGGGCTAAGGGGGAAGG + Intergenic
1103344782 12:120241964-120241986 GTGGATATGGAGAAGGAGTGAGG + Intronic
1104534138 12:129602715-129602737 GGGGATGGTGATAAGGAGGAGGG - Intronic
1105596298 13:21842546-21842568 GTGGTTAGGGGGAAGGGGGATGG + Intergenic
1105826202 13:24125718-24125740 GAGGTGAGGAATAAGGAGGAGGG + Intronic
1106135034 13:26967551-26967573 TGGGATAGGGGGAAGGAGGAGGG + Intergenic
1106917711 13:34532856-34532878 GTGGAAAGGGGGTAGGAGGAAGG - Intergenic
1107197631 13:37672519-37672541 GTGGATAGGAATCATAAGGAGGG - Intronic
1107645484 13:42490580-42490602 GTGGGGAGGGAGAAGCAGGAAGG + Intergenic
1107763009 13:43701997-43702019 GGGGATAGGGATAGGATGGAGGG - Intronic
1108192750 13:47959409-47959431 AGGGAGAGGGAGAAGGAGGAGGG + Intronic
1109074191 13:57812325-57812347 GGTGAAAGGGAAAAGGAGGATGG + Intergenic
1109443150 13:62400449-62400471 GACTAGAGGGATAAGGAGGAGGG - Intergenic
1110126331 13:71947519-71947541 CTGGAAAGGGATAAGTAAGATGG + Intergenic
1112467760 13:99658624-99658646 GTGGACAGGAACAAGGAGGTGGG + Intronic
1113585255 13:111460199-111460221 GGGGAAAGGGGCAAGGAGGAGGG + Intergenic
1114151846 14:20049379-20049401 GTAGAAAGTGATGAGGAGGAGGG - Intergenic
1114531262 14:23397879-23397901 GTGGAAAGATATAAGAAGGAAGG - Intronic
1115270126 14:31542133-31542155 GGGGATGGGGAAAAGGAAGAGGG - Intronic
1116294905 14:43094582-43094604 GTGGGTAGGGGTTGGGAGGAGGG + Intergenic
1118203323 14:63697987-63698009 GTCAATAGGGATAGCGAGGAGGG + Intronic
1119008493 14:70957601-70957623 TTGTCTAGGGCTAAGGAGGATGG + Intronic
1120894070 14:89514155-89514177 GTGGTGAGGGAGAAGGAGGATGG + Intronic
1121102785 14:91261515-91261537 TTGGATAAGGACAGGGAGGAGGG + Intergenic
1121939822 14:98059436-98059458 GGGGAGAGGGAGAAGTAGGAGGG + Intergenic
1122540565 14:102495725-102495747 GTGGATCAGGACATGGAGGATGG - Intronic
1122743135 14:103883189-103883211 GTGGACAGGGATAAGAATCAGGG + Intergenic
1122958447 14:105083551-105083573 GTGGATAGAGAGATGGTGGATGG - Intergenic
1123808835 15:23903069-23903091 GTGGAGGGGGATAAGGGGGGTGG - Intergenic
1125003891 15:34796813-34796835 GAGGAGAGGGAGAAGGAAGAGGG + Intergenic
1125200611 15:37098259-37098281 GTGGAAAGGGAAAAAGAGCAGGG + Intronic
1126703365 15:51386467-51386489 CAGGAAAGGGATAGGGAGGAGGG + Intronic
1126950718 15:53877591-53877613 GAGAATAGGGAGGAGGAGGAGGG + Intergenic
1127566549 15:60194826-60194848 GTGGAAAGGGAAAAGGAGGGGGG - Intergenic
1127814191 15:62592091-62592113 GGGGATGTGTATAAGGAGGAGGG + Intronic
1128523014 15:68387884-68387906 GTCCATAGGTATGAGGAGGAAGG - Intronic
1128904110 15:71452119-71452141 GTGGTTAGGCATGAGGTGGATGG - Intronic
1128982336 15:72197092-72197114 GGAGAAAGGGATAAGGAGGCAGG - Intronic
1129272545 15:74427041-74427063 GTGCACAGAGAAAAGGAGGAAGG - Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129698466 15:77754129-77754151 GGGAAAAGGGAAAAGGAGGAAGG + Intronic
1131291714 15:91112147-91112169 GGGGATAGGGAGAAGGGGGATGG + Intronic
1131772757 15:95758047-95758069 GTGGGTAGGGAGAAAGGGGAGGG + Intergenic
1131837824 15:96408600-96408622 GTGGGTAGGAATAAGGAGGCAGG - Intergenic
1131880881 15:96860671-96860693 GTGGGTAGGGATTGGAAGGAAGG - Intergenic
1132028069 15:98419644-98419666 GAGGAGAGGGAGGAGGAGGAGGG + Intergenic
1132612726 16:825293-825315 TCGGAGAGGGACAAGGAGGAAGG - Intergenic
1133043965 16:3075948-3075970 GTGGACAGGGAGATGGGGGAGGG + Intronic
1133122355 16:3617634-3617656 GTGCATAAGGATAAGGATGGAGG + Intronic
1133184859 16:4088674-4088696 GCGGAGAGGGATGAGGTGGACGG - Intronic
1133535053 16:6693725-6693747 GTGGATGAGGATGAGGATGATGG - Intronic
1134224681 16:12381226-12381248 GTGGATAGGTAGATGGATGAGGG - Intronic
1135066575 16:19315004-19315026 GTGGAGGGGGAGGAGGAGGAGGG + Intronic
1135660433 16:24291924-24291946 AAGGAAAGGGTTAAGGAGGATGG + Intronic
1135694706 16:24575793-24575815 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135694758 16:24575915-24575937 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135759440 16:25125499-25125521 TTGGAGAGGGATAGGGAAGAGGG - Intronic
1135892935 16:26373855-26373877 GTGGATAGGTATATGGGTGATGG + Intergenic
1136633926 16:31507483-31507505 GAGAATAGGGATAAAGGGGAGGG + Intronic
1137454142 16:48605375-48605397 GTGGAAAGGGATGAGGTTGAGGG - Intronic
1137579717 16:49626590-49626612 GTGGATGGGTAGATGGAGGATGG - Intronic
1137579891 16:49627374-49627396 ATGGATAGGTAGATGGAGGATGG - Intronic
1137580028 16:49627985-49628007 ATGGATAGGTAGATGGAGGATGG - Intronic
1137949758 16:52772467-52772489 TTGGGTAGGGAAAAGCAGGAAGG + Intergenic
1138223029 16:55269239-55269261 GTGGATAGGTAGGTGGAGGATGG - Intergenic
1138227700 16:55311975-55311997 GTGGGTAGGGAAAAGGGGGAAGG - Intergenic
1138332603 16:56227063-56227085 GCGGGTAGGGAAAAAGAGGAAGG + Intronic
1139447395 16:67006366-67006388 GTGAATAGGGAAACTGAGGAGGG - Intronic
1139811733 16:69624605-69624627 GTGGATAGGGATAAGGAGGAAGG - Intronic
1141514578 16:84535154-84535176 GAGGAGTGGGAGAAGGAGGAGGG - Intronic
1141749030 16:85946014-85946036 GTGCATAAGGATGGGGAGGATGG + Intergenic
1141773030 16:86102358-86102380 GGGGAGAGAGAAAAGGAGGATGG - Intergenic
1142261796 16:89046121-89046143 GAGGATGGGGATAATGATGATGG - Intergenic
1142337874 16:89502016-89502038 GTGGACATGGAGCAGGAGGAGGG - Intronic
1142709962 17:1717656-1717678 GTGGATAAGGGGATGGAGGAGGG - Intronic
1142853477 17:2716782-2716804 CTGCATAAAGATAAGGAGGAGGG + Intergenic
1142961133 17:3553200-3553222 GTGGTCACGGATAAAGAGGAGGG - Intronic
1143054937 17:4155774-4155796 GTGGGGAGGGAAAAGGAGGCAGG - Intronic
1143512988 17:7405979-7406001 AGGGATAGGGAGAAGGAGGAGGG + Intronic
1143725996 17:8846924-8846946 GTGGAAAGGGAAGAGGAGTATGG - Intronic
1144027303 17:11289458-11289480 GTGGTAAGGGAGATGGAGGATGG - Intronic
1144647830 17:16987464-16987486 GTGGAGAGGGAGGAGGAGGAAGG + Intergenic
1144782911 17:17816830-17816852 GTGGCTAGGCACAGGGAGGACGG + Intronic
1145856158 17:28160150-28160172 GTGGATAGGGAAGAGGAGTGAGG + Intronic
1146519335 17:33514358-33514380 GAGGATGGGGAGATGGAGGAAGG - Intronic
1146603597 17:34239033-34239055 GTGGCTGGGGCTCAGGAGGAAGG - Intergenic
1146908635 17:36633644-36633666 GAGGAAGGGGAGAAGGAGGAGGG + Intergenic
1148249594 17:46064625-46064647 TTGGAGAGGGAGGAGGAGGAGGG - Intronic
1148382029 17:47206898-47206920 GTGGAGGTGGAGAAGGAGGAGGG + Intronic
1148462197 17:47845285-47845307 GTGGAGAGGGGGAAAGAGGAAGG - Exonic
1148532456 17:48407304-48407326 GTCTATGGGGAAAAGGAGGAAGG + Intronic
1149107083 17:52982591-52982613 GAGGAGGGGGAGAAGGAGGAAGG - Intergenic
1149628008 17:58093680-58093702 GTAGAGAGGAGTAAGGAGGAGGG - Exonic
1149785795 17:59433889-59433911 GAGGAGAGGGGAAAGGAGGAGGG - Intergenic
1149863885 17:60139739-60139761 GGGGTCAGGGATGAGGAGGAGGG - Intergenic
1150414381 17:64975438-64975460 GTGGAGAGGGATGAGGATGTAGG - Intergenic
1150789657 17:68193118-68193140 AAGGGTAGGGAAAAGGAGGATGG - Intergenic
1151719640 17:75847808-75847830 GTGGATAGGGGTAGCCAGGAGGG + Exonic
1153987778 18:10368551-10368573 GAGGAGAGGGAGAGGGAGGAAGG + Intergenic
1154006688 18:10536219-10536241 GTGGATAGGGAAACAGATGAAGG + Intronic
1154031235 18:10756019-10756041 AGGGATGGGGATAAGGAGGAGGG + Intronic
1155543846 18:26893956-26893978 ATGGACAGGGTTAAGGAGAAGGG + Intergenic
1155759054 18:29541369-29541391 GAGGAGAGGGAGAAAGAGGAAGG - Intergenic
1155923565 18:31630013-31630035 GTGGAGAAGGAGAAGCAGGAAGG + Intronic
1156194742 18:34761465-34761487 ATGGGTAGGGAAAAGGTGGAAGG + Intronic
1156491987 18:37501714-37501736 GTAGGTAGGAAGAAGGAGGAGGG + Intronic
1157313805 18:46572136-46572158 TTGGACAAGGATAAGGATGATGG - Intronic
1157405495 18:47419277-47419299 GGAGATAGGGGGAAGGAGGAGGG + Intergenic
1158346850 18:56524598-56524620 GTGGATAGGAATGAGCAGGTGGG - Intergenic
1158387157 18:57008105-57008127 GCGGATAGGGATCAGTGGGAAGG - Intronic
1158610511 18:58935494-58935516 GGGGAGAGGGAGGAGGAGGAAGG - Intronic
1159107959 18:64025600-64025622 TTGGGAAGGGATAAGGAAGAGGG + Intergenic
1159318662 18:66816020-66816042 GTGGAAATAGATAAGCAGGAAGG + Intergenic
1159849370 18:73508808-73508830 GTGGAAAGGGAGAAAGAGGGTGG - Intergenic
1160237694 18:77099017-77099039 GTCGATAAAGATGAGGAGGAGGG - Intronic
1160367083 18:78335530-78335552 GGAGAGAGGGAGAAGGAGGAGGG + Intergenic
1161241522 19:3225899-3225921 GTGGACAGGGAGGAGGAGGGAGG + Intronic
1161370622 19:3908902-3908924 GAGGATGGGGAGGAGGAGGATGG - Intronic
1161485000 19:4530608-4530630 ATGGATAGGGACAGAGAGGAGGG + Intronic
1162053096 19:8046815-8046837 GAGGAGGGGGAGAAGGAGGAGGG - Intronic
1162513185 19:11132087-11132109 GTGGGTAGGGGTCGGGAGGATGG - Exonic
1163171641 19:15535586-15535608 GTGGATAGGTGGAAGGTGGATGG - Intronic
1163776992 19:19224674-19224696 GGGGATAGGGACAGGGAGGCAGG - Intronic
1164592125 19:29512857-29512879 GGAGAGAGGGATGAGGAGGAAGG + Intergenic
1164592221 19:29513223-29513245 AGAGATAGGGATGAGGAGGAAGG + Intergenic
1164696584 19:30249358-30249380 GGGGAGGGGGACAAGGAGGAGGG + Intronic
1164945295 19:32288254-32288276 GTGGATCAGGAGAAGGAAGAAGG - Intergenic
1165389589 19:35530632-35530654 GTGGAGAGGGATAGAGAAGATGG - Intergenic
1165462366 19:35951628-35951650 GTGGAGGGTGATAAGGTGGAGGG + Intergenic
1165470812 19:36003466-36003488 GAGGAAGAGGATAAGGAGGAAGG + Exonic
1165773197 19:38389965-38389987 GGTGATAGGGATAAGCAGGAGGG + Intronic
1166546660 19:43638459-43638481 GTGGCTAGGCAGAAGCAGGAGGG - Intronic
1168290102 19:55353399-55353421 ATGGAGAGGGAGAAGGGGGACGG + Intronic
1168458737 19:56537010-56537032 GTGAATAGGGAGAAGGGGGGTGG + Intergenic
925171111 2:1750752-1750774 GTGGATGGGGATGGGGAGAAGGG - Intergenic
925402563 2:3586022-3586044 GAGGAGAGGAAAAAGGAGGAGGG + Intergenic
925410034 2:3634739-3634761 GTGGAGAGGGATTCAGAGGAGGG + Intronic
925482647 2:4293224-4293246 GTGGAGAAGGATAAGGATGAGGG - Intergenic
925820449 2:7794595-7794617 GGGGAGAGGGAGAAAGAGGAAGG + Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
927710810 2:25324740-25324762 CTGGGGATGGATAAGGAGGAGGG + Intronic
927946669 2:27138856-27138878 GAGGAGAGGAATAAGGAGGAAGG + Intronic
928756043 2:34526816-34526838 GTGAAGAGGGGTAGGGAGGAAGG + Intergenic
929588134 2:43128679-43128701 GTGGAGAGGAATGAGGAAGAGGG + Intergenic
930185800 2:48411034-48411056 GAGGATAGGGATGGGGGGGATGG - Intergenic
930679820 2:54245031-54245053 GAGGATAGGGAGATGGGGGAAGG - Intronic
931744734 2:65282104-65282126 GTGGAGAGGGAGAGGGAGGGAGG - Intergenic
931781129 2:65580134-65580156 ATGGAGGGGGAGAAGGAGGATGG - Intergenic
931847340 2:66218298-66218320 GTGAATAGGGATATAGAGGAGGG + Intergenic
931854634 2:66289010-66289032 ATGGATAGAGAGTAGGAGGATGG - Intergenic
931859724 2:66342164-66342186 GTGGATAGACCAAAGGAGGAAGG - Intergenic
932566744 2:72915784-72915806 GAGGGTGGGGAAAAGGAGGAGGG + Intergenic
932774879 2:74522318-74522340 GAGGATAGGGTTGAGGAAGAGGG + Intronic
933275881 2:80283881-80283903 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
934119306 2:88824927-88824949 ATGGGAAGAGATAAGGAGGATGG + Intergenic
935745640 2:106188235-106188257 GTGGACAGGGAGAAGGGGAAGGG + Intronic
936162772 2:110097450-110097472 ATGGGAAGAGATAAGGAGGATGG + Intronic
937247717 2:120504250-120504272 GTGGATAGGGATAAAGTAGGGGG - Intergenic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
938250631 2:129813045-129813067 GTGAATGGGGATAAGGAGTCTGG - Intergenic
938655700 2:133430862-133430884 GTGGAGAGGGAGAAGGAAGGAGG + Intronic
940088964 2:149895129-149895151 CCGGAAAGGCATAAGGAGGAAGG - Intergenic
941524808 2:166593831-166593853 GTGAATGGGTATAAGGATGAAGG + Intergenic
941847105 2:170143942-170143964 GGGGAGAGAGACAAGGAGGAAGG - Intergenic
942545914 2:177063497-177063519 ATGGATGGGGAAATGGAGGAGGG - Intergenic
943522867 2:188975820-188975842 GTGGAGAGAGATAAGGAGGAGGG - Intronic
944013315 2:195001010-195001032 ATGGCTAGGGTTCAGGAGGAGGG - Intergenic
944329147 2:198445111-198445133 GTGGAAAGGGAAAAGGGGAAAGG - Intronic
944474776 2:200092484-200092506 GTGGGTGGGGATAGGGAGGATGG + Intergenic
946162005 2:217841164-217841186 CTGGAAAGGGAGAAGGGGGAAGG + Intronic
946172994 2:217906306-217906328 GTGGATGGGGAGAAGAAGGATGG - Intronic
946266647 2:218549058-218549080 CTGGATAGGGATCAGAGGGAAGG + Intronic
946539249 2:220665804-220665826 GAGGAGAGGGATAAAGAGGTTGG - Intergenic
947497172 2:230646301-230646323 GTAGATAGGGAACTGGAGGATGG - Intergenic
948080978 2:235204932-235204954 GTGAATTGGGATGAGGAAGAAGG - Intergenic
1169696747 20:8397506-8397528 GTGGGTAGGAATAGGGTGGAAGG - Intronic
1170396037 20:15926553-15926575 GTTGATCAGGATAAGAAGGATGG + Intronic
1171105957 20:22432551-22432573 GTGGAGAGTGCTAGGGAGGAAGG + Intergenic
1171116812 20:22531831-22531853 GAGGAGAGAGAAAAGGAGGAAGG + Intergenic
1171284491 20:23925944-23925966 GTGGGGAGGGAGAAGGAGGGAGG - Intergenic
1172486069 20:35298485-35298507 GAGGAGAGGGCTAAGGGGGAAGG - Intergenic
1172546160 20:35763288-35763310 GGAGATAGGGAAGAGGAGGAGGG - Intergenic
1172917212 20:38452083-38452105 TTGGGTAGGAATAAGGAGGGGGG - Intergenic
1173152209 20:40577193-40577215 GTGGATGGGGGTGAGGAGAAGGG + Intergenic
1173484847 20:43433442-43433464 GGGGAAGGGAATAAGGAGGAAGG + Intergenic
1173870496 20:46338978-46339000 GTGGAGATGGATGGGGAGGAGGG + Intergenic
1175144595 20:56886094-56886116 GTGGAGGGTGATAAGGGGGAAGG + Intergenic
1175240581 20:57545248-57545270 GAGGAGGGGGGTAAGGAGGAAGG + Intergenic
1175417590 20:58811950-58811972 GTGGACAGGGATGGGGAGGCTGG - Intergenic
1175907695 20:62389418-62389440 GTGGCTGTGGAAAAGGAGGAGGG + Exonic
1176956310 21:15108346-15108368 GGGGATAGGGACAAGAATGAGGG - Intergenic
1177861706 21:26462250-26462272 GTGGCAAGGGATGAGGAGGGTGG + Intergenic
1179215916 21:39366937-39366959 GGGGAAAGGGGGAAGGAGGAGGG - Intergenic
1182894866 22:33850735-33850757 GTGGAGGGGGATAGGGCGGAGGG + Intronic
1183008780 22:34927552-34927574 GGAGATAGGGAGTAGGAGGAGGG + Intergenic
1184343440 22:43898725-43898747 GTGGGGAGTGATAAGGAGGAGGG + Intergenic
949676911 3:6465875-6465897 GTAGATGGGGATAAGGAGAATGG - Intergenic
950490824 3:13303935-13303957 GAGGATAGGGATGATCAGGATGG - Intergenic
950729987 3:14948243-14948265 GAGGAGGAGGATAAGGAGGAAGG - Intronic
952281236 3:31925342-31925364 GTGGGAAGGGATGTGGAGGATGG - Intronic
953888056 3:46729374-46729396 GGGGATAGGGATGAGCAGGCTGG - Intronic
954156709 3:48689032-48689054 GTGGATAGTAGTAGGGAGGAAGG - Intronic
954201376 3:49025294-49025316 GTGGATAGGGTTAATGGGGACGG + Intronic
954847617 3:53573577-53573599 GTGGATAGGGAGAAGCACAAAGG - Intronic
955029746 3:55204774-55204796 ATGGATAGAGGGAAGGAGGAGGG - Intergenic
955909356 3:63844197-63844219 GTGGCTAGGGAGAAGGAGGTTGG + Intronic
955975083 3:64472275-64472297 GTGGAATGGGGTAAGGAGAAAGG + Intergenic
957328501 3:78728208-78728230 GAGGAGAAGGAAAAGGAGGAAGG + Intronic
958044133 3:88263055-88263077 GGGCACAGGGAAAAGGAGGAAGG + Intergenic
959539903 3:107525327-107525349 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
959987605 3:112593295-112593317 GTGGATGGGGAGAAGGAAAAGGG + Intergenic
960465243 3:117989953-117989975 GTGGTTTGTGATGAGGAGGAAGG - Intergenic
961153192 3:124657166-124657188 TTGGATTGGGAGAAGGAAGAGGG + Intronic
961722889 3:128908001-128908023 GTGCACAGGGATGAGGAGGGAGG - Intronic
962018804 3:131474400-131474422 GGGGATGGGAATGAGGAGGATGG + Intronic
962234093 3:133693154-133693176 GCGACTAGGGATAAGGAGGAAGG - Intergenic
962430650 3:135316114-135316136 GTGGCAAGGGATAAGGAGGTTGG - Intergenic
962491363 3:135897002-135897024 GAGGAAAGGGAGAGGGAGGAAGG - Intergenic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
963480973 3:145874337-145874359 GGGGATAGGGAGAAAGGGGAGGG - Intergenic
964777825 3:160298042-160298064 GTGAATAGGGAGAAGAAGGCAGG + Intronic
966653512 3:182327274-182327296 GCGGACAGGGATGAGGAGCAGGG - Intergenic
966879381 3:184341397-184341419 GAGGAGAGGGAAGAGGAGGAAGG - Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967983375 3:195078535-195078557 TTGGATGGGGATGAGGAAGAGGG - Intronic
968152546 3:196348651-196348673 GGGGATAGGGATGATGAGGGTGG - Exonic
968981394 4:3851699-3851721 GTGGAGAGGGATATGGGGGCAGG + Intergenic
969967765 4:11014521-11014543 GTGGATGGGGCCAAGGATGATGG + Intergenic
971174024 4:24263589-24263611 GTGGAGATGGACAAGGTGGAAGG - Intergenic
976892854 4:90071596-90071618 GTGGATGGAGAAAGGGAGGATGG - Intergenic
977895493 4:102360522-102360544 GAGGAAAGGGCTAAAGAGGAAGG - Intronic
978501989 4:109419608-109419630 GTAGATGGGGGTAGGGAGGAAGG + Intergenic
979737705 4:124108014-124108036 TTAGAAAGGCATAAGGAGGAAGG - Intergenic
980994867 4:139770514-139770536 GTGGATAGGGAGGAGGAGATTGG + Intronic
980999246 4:139812414-139812436 GTGGAGAGGGAAAAGTAGGATGG - Intronic
981044635 4:140253462-140253484 GGGGGTGGGGATAAGGAGGAAGG + Intergenic
981289603 4:143058925-143058947 GAGGATAGAGATTGGGAGGAGGG - Intergenic
981621398 4:146703657-146703679 GTGGCTAGGGTTTAGGATGAAGG - Intergenic
981676699 4:147350904-147350926 GGGAAGAGGGATAAGAAGGAAGG + Intergenic
984702230 4:182825777-182825799 GGGGAAAGGGAGAAGGAGGAGGG - Intergenic
984847641 4:184121181-184121203 TAGAATAGGGAAAAGGAGGAGGG - Intronic
984933800 4:184872102-184872124 GTGGAGAGGGGTAAAGAGGGTGG - Intergenic
986636068 5:9823615-9823637 GAGGAGAGGGAAAGGGAGGAAGG + Intergenic
987061320 5:14246715-14246737 GGGGCTAGGGACAAGGAAGAAGG + Intronic
988302673 5:29451117-29451139 GTTGCTAGAAATAAGGAGGATGG - Intergenic
990050795 5:51497387-51497409 GTGGAGAGGGATGGGCAGGAAGG - Intergenic
990398046 5:55404749-55404771 ATGGAGAGAGGTAAGGAGGAAGG - Intronic
990962531 5:61409745-61409767 GTGGAGAGGGATATGTGGGATGG + Intronic
991007186 5:61840923-61840945 GGGGAAAGGGATCAGGAAGAAGG + Intergenic
991670554 5:69043215-69043237 TTGGATAGGAATAAGACGGAAGG - Intergenic
991974936 5:72176341-72176363 GTGGATCAGGAAAAGGAGAAAGG + Intronic
992034968 5:72764172-72764194 GTGAGGAGGGAAAAGGAGGATGG - Intergenic
992627518 5:78648761-78648783 GGGGAGAGGGAGGAGGAGGAGGG + Exonic
994309222 5:98247897-98247919 GTGGATAGGTATAGGAGGGAGGG + Intergenic
994869685 5:105331629-105331651 GAGGAGAGGGAGGAGGAGGAGGG + Intergenic
995364598 5:111343781-111343803 TTGTATAGGGATAAGGCAGAAGG + Intronic
995405111 5:111785896-111785918 ATGGATAGGGAGAGGGAAGAGGG + Intronic
995784072 5:115809655-115809677 ATGGATAGTGATCAGGGGGAAGG - Intronic
997237413 5:132281203-132281225 GTGGAAAGAGATAAGGATGTCGG + Intronic
997446076 5:133941358-133941380 GTGCAGTGGGAAAAGGAGGAGGG + Intergenic
997509757 5:134446109-134446131 GGGGATGGGGGTAAGGAGGGTGG + Intergenic
997634483 5:135394881-135394903 GTGGATAGGGAGAAAGGAGAGGG + Intronic
998300127 5:141010008-141010030 GTAGATAGGAAAAAGGAGCAGGG - Exonic
998734474 5:145120067-145120089 TGGGAGAGGGATAGGGAGGATGG + Intergenic
998952663 5:147407341-147407363 GGAGACAGGAATAAGGAGGAGGG + Intronic
999267272 5:150275076-150275098 GTGCAGAAGGATGAGGAGGAAGG + Intronic
1000111943 5:158116546-158116568 GTGGATAGGGATGAGAATGCAGG + Intergenic
1001489016 5:172142493-172142515 GTAGATAGGGATACCGAGGTTGG - Intronic
1003276341 6:4656384-4656406 GAGGCCAGGGGTAAGGAGGATGG + Intergenic
1003872779 6:10415113-10415135 GTGGAGGAGGAGAAGGAGGAGGG + Exonic
1005120096 6:22380120-22380142 GGGGATACAGAGAAGGAGGAGGG - Intergenic
1005898532 6:30198032-30198054 GTGGAGAGGGTTTAGAAGGAGGG - Intronic
1005928204 6:30462298-30462320 GTGGAAGGGGATAAGGAGTAGGG - Intergenic
1006239289 6:32663761-32663783 GTGGATAGTGATGGGGGGGAGGG + Intronic
1006811963 6:36825840-36825862 GCTGAAAGTGATAAGGAGGAGGG + Intronic
1007698185 6:43747138-43747160 GGGGACATGGAAAAGGAGGAAGG - Intergenic
1008264817 6:49412002-49412024 GTGGAAAGGTATAAGGAACATGG - Intergenic
1008331157 6:50246433-50246455 GTGGAATGGGAGAAGGAGGGAGG - Intergenic
1011410503 6:87061312-87061334 GTGGAAGGTGAGAAGGAGGAGGG + Intergenic
1011752961 6:90471837-90471859 GTGGATATGGATTTGGGGGAGGG + Intergenic
1011771285 6:90676225-90676247 TTGGGGAGGGAGAAGGAGGATGG + Intergenic
1012577602 6:100822008-100822030 GGGGGTAGGGAGAAGGAGAATGG + Intronic
1012643868 6:101655741-101655763 GTTGATAGGGAATAGGAGTAGGG + Intronic
1012772880 6:103461949-103461971 GTGGAAGAGGAAAAGGAGGAAGG - Intergenic
1013679908 6:112513651-112513673 TTGGATAGTGAAAAGGAGAATGG + Intergenic
1014215845 6:118751976-118751998 GTGGAAAGGTATAAGCAGGGAGG + Intergenic
1015027495 6:128554069-128554091 GAAGAGAGGGAGAAGGAGGATGG - Intergenic
1015094822 6:129402623-129402645 GTGGATAGGCTTAATTAGGAGGG + Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1016058916 6:139607950-139607972 GAGAATTGGGAAAAGGAGGAAGG - Intergenic
1016371735 6:143381874-143381896 GTGGTTAGGGAAAGGAAGGAAGG + Intergenic
1016707932 6:147135297-147135319 GTGGTTAGGGCCAAAGAGGAGGG - Intergenic
1016724638 6:147348360-147348382 GGGGACAGGGAGTAGGAGGAAGG - Intronic
1018266654 6:162031378-162031400 GTTGAGAGGGATGTGGAGGATGG - Intronic
1018292244 6:162303894-162303916 GAGGATAGGAATGAGGAGGGAGG + Intronic
1018928795 6:168225922-168225944 GGGGAGAAGGAGAAGGAGGAGGG - Intergenic
1019013341 6:168860923-168860945 GAGGAGAGGGAGAAAGAGGAAGG + Intergenic
1019160781 6:170066067-170066089 AGGGATAGGGATAGGGTGGATGG - Intergenic
1020581953 7:10012985-10013007 GTGGTGAGGGAAGAGGAGGAGGG - Intergenic
1020847626 7:13306924-13306946 GGGGATGGGGAGAAGGGGGAGGG + Intergenic
1021763261 7:23921862-23921884 GTGGATAGGGAGAAAGTGGAGGG + Intergenic
1022311456 7:29200369-29200391 GTGGATAGAGGGAGGGAGGAGGG - Intronic
1023271706 7:38470114-38470136 GGGGATCAGGACAAGGAGGAAGG - Intronic
1023771452 7:43560444-43560466 GGGGAAAGGGACAGGGAGGAGGG + Intronic
1023809690 7:43902162-43902184 GTGGAGAGGGAGGAGGAGGGGGG + Intronic
1024154232 7:46603821-46603843 GTGGAAAGGGTGAGGGAGGATGG - Intergenic
1024862835 7:53865604-53865626 TTGGATAGGGAAAAGGCTGAAGG - Intergenic
1025198712 7:56949441-56949463 AGGAATAGGGAGAAGGAGGAGGG - Intergenic
1025673236 7:63627490-63627512 AGGAATAGGGAGAAGGAGGAGGG + Intergenic
1026638660 7:72105827-72105849 GGGGATAGGGATGGGGATGAGGG + Intronic
1027191104 7:75995872-75995894 GTGGATAGGGAGATGGGGGAGGG + Intergenic
1027488147 7:78787313-78787335 GTGGATGGGGATGAGAAGTATGG + Intronic
1027717931 7:81697280-81697302 TTGGATAGGGATGTTGAGGATGG + Intergenic
1028247529 7:88499210-88499232 GGGGAAAGGGATGAGGAGGTAGG - Intergenic
1028534552 7:91878021-91878043 ATGGATAGGCATCAGGAGGATGG - Intronic
1028715998 7:93969495-93969517 GTGGATATGAATAATCAGGAAGG + Intronic
1029004884 7:97198871-97198893 ATGCATTGGGAGAAGGAGGAGGG - Intergenic
1029344949 7:99971660-99971682 GTGGCAAGGGATCAGCAGGATGG - Intronic
1031964180 7:128015625-128015647 TTGGAAAGGGACAAGGAGAAGGG - Intronic
1032432760 7:131875358-131875380 GAGGTTAAGCATAAGGAGGAAGG - Intergenic
1032529399 7:132607898-132607920 GGTGATAGTGATAAGGATGATGG - Intronic
1032826628 7:135576065-135576087 GTGTTTAGGGATAAGTTGGATGG + Intronic
1032955373 7:136964593-136964615 GTGCAAAGGAAAAAGGAGGAAGG - Intronic
1033938457 7:146619323-146619345 ATGGATAGTGATAATGAAGATGG - Intronic
1034180168 7:149130911-149130933 TTGGTTAGGGGTAAGGAAGAGGG + Intronic
1034422236 7:150996065-150996087 TGGGATGGGGAGAAGGAGGAGGG - Intronic
1034422264 7:150996131-150996153 TGGGATGGGGAGAAGGAGGAGGG - Intronic
1034696077 7:153055053-153055075 TTGGATATGGTGAAGGAGGAGGG + Intergenic
1035238066 7:157512914-157512936 GTGGGGTGGGAGAAGGAGGAGGG + Intergenic
1036621013 8:10424585-10424607 GTGGAGAGGGACAGGGAGAAGGG + Intronic
1037329570 8:17730878-17730900 CTGGAGATGGATATGGAGGATGG + Intronic
1037906398 8:22718301-22718323 CAGGAAAGGGATCAGGAGGATGG + Intronic
1038570541 8:28658330-28658352 GTGGATGGGGCTGAGCAGGAGGG - Intronic
1039436022 8:37559701-37559723 GAGGAGAAGGAAAAGGAGGAGGG + Intergenic
1040624660 8:49133323-49133345 AAGGAGGGGGATAAGGAGGAAGG + Intergenic
1041981602 8:63867858-63867880 GTGGGTAGGGATTGGGAGGAAGG - Intergenic
1042027344 8:64438226-64438248 GTAGATCGGGATGATGAGGAAGG + Intergenic
1043347961 8:79322236-79322258 GTGTTCATGGATAAGGAGGAAGG + Intergenic
1044727582 8:95205760-95205782 CTGTATAAGGATAGGGAGGATGG + Intergenic
1045217056 8:100158648-100158670 GTGGATGTGGATCAGGATGATGG + Intronic
1046447921 8:114347418-114347440 GTGCAGGGGGAGAAGGAGGAAGG - Intergenic
1046601761 8:116325365-116325387 GAGGAAAGGGAAAAGGAAGATGG + Intergenic
1048771693 8:137902303-137902325 GGGGAGAGGGCTAAGGAGAATGG + Intergenic
1049371963 8:142272265-142272287 GTGGCTAGGTGGAAGGAGGAAGG - Intronic
1049371973 8:142272301-142272323 GTGGATGGGTAGATGGAGGAAGG - Intronic
1049632364 8:143665597-143665619 AGGGACAGGGATAAGGGGGATGG + Intergenic
1051044578 9:12857718-12857740 GCTAATAGGGATAAGGAGAAAGG + Intergenic
1051621495 9:19054389-19054411 CTGGATAGGGAAAAGGCTGAAGG + Exonic
1052790876 9:32874551-32874573 GTGGGTAGGGATAGGGATGGTGG - Intergenic
1053076993 9:35141660-35141682 GGGGATCGAGAGAAGGAGGATGG + Intergenic
1053096552 9:35333545-35333567 GATGAAAGGGAGAAGGAGGAAGG - Intronic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053216198 9:36272658-36272680 ATGGATTGGGAAGAGGAGGAAGG + Intronic
1053365550 9:37520156-37520178 GTGGGTCGGGAAATGGAGGAAGG - Intronic
1053439566 9:38105157-38105179 GTGGATAGGAATCAGGAAAATGG - Intergenic
1055775988 9:79767632-79767654 TGGGAGAGGGAAAAGGAGGATGG - Intergenic
1056507529 9:87271296-87271318 GGGAAGAGGGATAAGGTGGATGG - Intergenic
1057876502 9:98759209-98759231 ATGGCTTGGGATTAGGAGGAGGG - Intronic
1058093555 9:100833033-100833055 GTGGGTGGGGGGAAGGAGGAGGG + Intergenic
1058164848 9:101607550-101607572 GTGAGCAGGGAGAAGGAGGAGGG + Intronic
1058567947 9:106307034-106307056 GTGGGCAGGGATTAGGAAGAAGG - Intergenic
1058660966 9:107268408-107268430 GTTGAGTGGGCTAAGGAGGAGGG - Intergenic
1059359490 9:113729993-113730015 GTTTCTAGGGATAAGGCGGAGGG - Intergenic
1059550621 9:115225359-115225381 GGGGATAGGGAGGATGAGGAAGG + Intronic
1059772303 9:117438842-117438864 GTAGAAAGAAATAAGGAGGAAGG - Intergenic
1059797683 9:117716543-117716565 GTTCCTAGGGAAAAGGAGGAAGG + Exonic
1060102825 9:120855882-120855904 CTGGAGAGGGAAAAGGAGGGAGG - Exonic
1061637119 9:131919102-131919124 GGGAGTAGGGAGAAGGAGGATGG + Intronic
1061656790 9:132098047-132098069 GAGGAAAGGGAGAAGGTGGATGG + Intergenic
1061943048 9:133893277-133893299 GTGGAGAGGGCTGAAGAGGAAGG + Intronic
1062144046 9:134979062-134979084 GAGGAAAGAGAGAAGGAGGAAGG + Intergenic
1062513909 9:136922684-136922706 GAGGACAGGGATGGGGAGGATGG + Intronic
1186178422 X:6949371-6949393 GAGGAAAAGGATAAGGAGGAGGG - Intergenic
1187380613 X:18798560-18798582 GTGGACAGGGAGCAGGAGGAAGG + Intronic
1187500096 X:19832534-19832556 GGAGAGAGGGGTAAGGAGGAAGG + Intronic
1188931279 X:36114308-36114330 ATGGATAGGAATAAGGATCATGG - Intronic
1189518337 X:41738750-41738772 GAAGCTAGGGATCAGGAGGAAGG + Intronic
1190332280 X:49243199-49243221 GTGGGGAGGGGTGAGGAGGAAGG + Intronic
1190472994 X:50801218-50801240 GGGGAGAGGGAGAAGGAGGGAGG + Intronic
1192162186 X:68796747-68796769 GTGGAGAGGGTGAAGGAGTAAGG - Intergenic
1193040998 X:77003558-77003580 GTAGGTAGGGGTAAGTAGGAGGG + Intergenic
1193374771 X:80746141-80746163 GTGGATAGGTGTGAGGAGGTAGG - Intronic
1196411417 X:115424157-115424179 GTGGGTAAGGAAATGGAGGAAGG - Intergenic
1196910935 X:120483580-120483602 GTGGGGAGGAATAAGTAGGAAGG + Intergenic
1197275089 X:124468525-124468547 GAGGATAGGGATAAGGAGATGGG - Intronic
1197286264 X:124598705-124598727 GTGGACAGGGAGTAGAAGGATGG + Intronic
1197807714 X:130413568-130413590 GTTGCTAGGGACAGGGAGGAGGG - Intergenic
1197841397 X:130751200-130751222 GTGGCTAGGGGAAGGGAGGAAGG - Intronic
1198234821 X:134726967-134726989 CTGGATGGGGGTAAAGAGGAGGG - Intronic
1198572194 X:137969951-137969973 GATGATAGGGAGAAGGAAGAGGG - Intergenic
1200977891 Y:9232056-9232078 GTGGCTGAGGCTAAGGAGGAAGG + Intergenic
1201501305 Y:14645822-14645844 GAGGATGGTGATGAGGAGGATGG + Intronic