ID: 1139820493

View in Genome Browser
Species Human (GRCh38)
Location 16:69717319-69717341
Sequence CTGCAGGAACACATTCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 240}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139820488_1139820493 2 Left 1139820488 16:69717294-69717316 CCCGAAGAAGAAAGGCCGTGGTT 0: 1
1: 0
2: 0
3: 3
4: 108
Right 1139820493 16:69717319-69717341 CTGCAGGAACACATTCAGCAGGG 0: 1
1: 0
2: 1
3: 20
4: 240
1139820489_1139820493 1 Left 1139820489 16:69717295-69717317 CCGAAGAAGAAAGGCCGTGGTTT 0: 1
1: 0
2: 0
3: 16
4: 112
Right 1139820493 16:69717319-69717341 CTGCAGGAACACATTCAGCAGGG 0: 1
1: 0
2: 1
3: 20
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139820493 Original CRISPR CTGCAGGAACACATTCAGCA GGG Intronic
900193561 1:1362062-1362084 CAGCAGGAAAACAGTCAGCCAGG - Intergenic
900502890 1:3015295-3015317 CTGGAGGAACACAGGCAGGAGGG - Intergenic
902124298 1:14195760-14195782 CAGCAGGAACTCAATCAGTAGGG - Intergenic
904929993 1:34079343-34079365 CTGAACTAACAAATTCAGCAAGG + Intronic
906052554 1:42887331-42887353 CACCAGGAACCCATACAGCACGG + Intergenic
906123968 1:43415113-43415135 CTGCAGGAACACCTCCCGCTGGG - Exonic
906241588 1:44245456-44245478 CTGCATGAACACTTTCCCCAGGG + Intronic
907860175 1:58345459-58345481 CCTCAGTAACAAATTCAGCAGGG + Intronic
909303743 1:74046218-74046240 CTACAGTAACACAAACAGCATGG + Intronic
911360759 1:96873377-96873399 CAGCAGGGACACTTTCAGCAGGG + Intergenic
912150943 1:106857975-106857997 CTGCAGTAACAAAAACAGCATGG + Intergenic
912203685 1:107486555-107486577 CTGCAGGAAAACATTCTCCAAGG + Intergenic
915203416 1:154251113-154251135 CTGAAGGAACACCTCCATCATGG - Exonic
916172820 1:162013647-162013669 ATGCAGGCACACATGCACCAGGG + Intronic
917432856 1:174988664-174988686 CTGCAGTGACATTTTCAGCAAGG + Intronic
917647323 1:177041931-177041953 CTGCAGGAAGACCTTATGCAGGG + Intronic
917797982 1:178545572-178545594 AGGCAGCACCACATTCAGCAGGG - Intronic
918037754 1:180892431-180892453 CAGCAGGCACACATCCAGCCCGG - Intergenic
918592479 1:186255528-186255550 CTGCATGAACACTTGCAGTAAGG + Intergenic
919264851 1:195250181-195250203 CTACAGGCAGACATTCAGGAAGG + Intergenic
919321134 1:196039885-196039907 ATGAAGGAATACATTCAGCAAGG - Intergenic
919657306 1:200209928-200209950 CTGCAGTAAAACTTTCTGCATGG - Intergenic
920732128 1:208497139-208497161 CTGCAGGGACACATGCAGACAGG + Intergenic
921454698 1:215355780-215355802 CTTCGGAAAAACATTCAGCAAGG + Intergenic
921481081 1:215665244-215665266 CTGCAGGAGCCCATGCAGAATGG - Intronic
923248265 1:232154858-232154880 CTGCAGAATCAGGTTCAGCAAGG + Intergenic
1063518824 10:6722543-6722565 AGGAAGGAACACATTCAGTAGGG + Intergenic
1063666603 10:8064555-8064577 CTTCAGGAACCCATTCTGGATGG - Intronic
1063691598 10:8292845-8292867 CTGGAGGAAGAAATGCAGCACGG - Intergenic
1063842650 10:10089488-10089510 CTGCAGGAACAGAGCCAGGATGG - Intergenic
1064271782 10:13871963-13871985 CTGGAGGATCACACTCAGCTAGG - Intronic
1064336551 10:14448434-14448456 CTGCAGGAGCACCTGCAACATGG - Intronic
1064614689 10:17140549-17140571 CTGGAGGAAAAAAGTCAGCAGGG + Intergenic
1065320676 10:24506184-24506206 CTGCAGGAACAGATCCAGGTGGG + Intronic
1067509322 10:46882336-46882358 TTGGAGCAACAGATTCAGCATGG + Intergenic
1067652931 10:48169519-48169541 TTGGAGCAACAGATTCAGCATGG - Intronic
1067683663 10:48455086-48455108 CCGCAGGTACAGCTTCAGCAGGG + Exonic
1071355910 10:84794878-84794900 ATTAAGAAACACATTCAGCAAGG - Intergenic
1072380842 10:94868346-94868368 CTGCAGTAACAAAAACAGCATGG - Intergenic
1073050228 10:100662354-100662376 GTGCAGGAACACACGTAGCATGG - Intergenic
1073655169 10:105406702-105406724 CTGCAGTAACCAATACAGCATGG + Intergenic
1074046986 10:109848303-109848325 TTGAAGGGACACATTCACCACGG + Intergenic
1074229390 10:111518420-111518442 TTTCAGGTATACATTCAGCAAGG - Intergenic
1075977057 10:126705223-126705245 CTGCAGGAATAAAGTGAGCAAGG - Intergenic
1076176889 10:128375044-128375066 CTCCCAGAACACACTCAGCAGGG + Intergenic
1078181049 11:9010769-9010791 CTGCAGTAACAAAAACAGCATGG - Intergenic
1078278061 11:9870465-9870487 CTACAGGAACCCAAACAGCATGG + Intronic
1078674353 11:13395919-13395941 CTGCAGTAACAAAAACAGCATGG - Intronic
1081192061 11:40116115-40116137 CTGCAGCAACCAGTTCAGCAAGG - Exonic
1082967094 11:58977310-58977332 CTGCAGGAAGTGATACAGCATGG + Intronic
1084149895 11:67283168-67283190 CTGCAGCAACCCCTCCAGCAGGG - Exonic
1086158897 11:83698981-83699003 CTGCAGGTAGACGTCCAGCAGGG + Intronic
1087362539 11:97178727-97178749 TTGCAGAAAAACATTCACCATGG + Intergenic
1088428387 11:109730010-109730032 CTGCAGGCTCACACTCCGCAGGG + Intergenic
1090348509 11:126090737-126090759 CTTCAATAACACATCCAGCATGG - Intergenic
1092116244 12:6010324-6010346 CTGTAACAACACACTCAGCAAGG + Intronic
1092138064 12:6163464-6163486 CACCAGGAACAGATTCACCAGGG - Intergenic
1092580179 12:9832982-9833004 CTGCAGAAAAACATTAAGAAAGG + Intronic
1093209134 12:16286473-16286495 CTGCAGTAACAAAAACAGCATGG - Intergenic
1095909746 12:47414216-47414238 CTTCAGGAACAATTTCAGGAAGG + Intergenic
1096090329 12:48895358-48895380 CTGCAGAAACACATTCAGATAGG + Intergenic
1098147129 12:67509241-67509263 CTGAAAGAACACATGAAGCAGGG + Intergenic
1098703634 12:73660089-73660111 CTGCTGAAACACAGTCAGCTTGG - Intergenic
1098855627 12:75650273-75650295 AGGCAGGAACACATTGGGCAAGG - Intergenic
1099354062 12:81611515-81611537 ATACAGCAACACATTCAGCAGGG + Intronic
1101322923 12:103689132-103689154 CTGCAGGAACAGTTTCAGCATGG - Intronic
1102317506 12:111901328-111901350 CTGCAGTAACACAGTCAGGGGGG - Intergenic
1102575260 12:113852233-113852255 CTCCAGGGACACAATTAGCAGGG + Intronic
1102813889 12:115846798-115846820 CTGCAGGATCACATGCTCCAGGG + Intergenic
1103046881 12:117743358-117743380 CTCCAGGAGCACATTAAGCAAGG - Intronic
1103294645 12:119876073-119876095 CTGGAAGAACAGATTCAGCCTGG + Exonic
1103963831 12:124625706-124625728 CTGCAGGAGCCCCTTCACCATGG - Intergenic
1105835992 13:24212424-24212446 CTTCAGGACCACATGAAGCAAGG - Intronic
1106776996 13:33017592-33017614 CTGCAGGAAGAGAATGAGCAGGG + Intronic
1108969346 13:56352721-56352743 CTGCAGTAACACATACACAAAGG - Intergenic
1109615836 13:64832779-64832801 CTGCAGTAACAAAATCAACATGG + Intergenic
1109910374 13:68903505-68903527 CTGCAGAAACAAAAACAGCATGG - Intergenic
1110641899 13:77834578-77834600 CTGCAGCCACACCATCAGCATGG + Intergenic
1111600707 13:90470554-90470576 CTGCAGTAACAAAAACAGCATGG - Intergenic
1112142017 13:96654589-96654611 CTGCAGTAACAAAAACAGCACGG - Intronic
1112254360 13:97816013-97816035 CATCAGGAACACATTTAGAATGG - Intergenic
1112660885 13:101506454-101506476 CTGAAAGACCACATGCAGCAAGG + Intronic
1113397209 13:109959363-109959385 CTGCAGTAACCCAAACAGCATGG - Intergenic
1115364003 14:32535710-32535732 CTGCGGGAGCGCATTCTGCAAGG + Exonic
1116800668 14:49440163-49440185 GTGCAGTTACACATTCAACAAGG + Intergenic
1119352712 14:73979420-73979442 TTACTGGAATACATTCAGCAGGG - Intronic
1119829273 14:77686540-77686562 CTGTATGAGCACATTCACCAGGG - Intronic
1121111105 14:91313743-91313765 CTGCAGGGACACGTTCTGCAAGG + Exonic
1121467370 14:94124626-94124648 CTGCAGGGACCCAGTCCGCAGGG + Intergenic
1122168477 14:99850480-99850502 CTGCAGAAACCCAGTCTGCATGG - Intronic
1124805172 15:32874486-32874508 CTTCAGGATCACAGTCAGGAAGG + Intronic
1125227620 15:37412902-37412924 CTGCAGTAACAAAAACAGCATGG + Intergenic
1125976976 15:43962666-43962688 CTACAGTAACAAAATCAGCATGG + Intronic
1127543499 15:59966875-59966897 CTTCAGGAACAACTTCAGAAAGG + Intergenic
1129586201 15:76868875-76868897 CTACAGTAACAAAATCAGCATGG + Intronic
1130697036 15:86141116-86141138 CTGAAGTAATACATACAGCAAGG - Intergenic
1131059532 15:89396002-89396024 CTGCAGGAAATCATTCAGGCGGG + Intergenic
1132096862 15:98992707-98992729 CTGCAGTAACAAAAACAGCATGG + Intronic
1132398439 15:101490195-101490217 CTGAAGGGACACATTGAGCGGGG + Intronic
1133657029 16:7875439-7875461 CTGCAGGAAGACATGGAGAAGGG + Intergenic
1137835576 16:51589331-51589353 CTGCAGGAACCCATTTAGCTTGG + Intergenic
1139820493 16:69717319-69717341 CTGCAGGAACACATTCAGCAGGG + Intronic
1140124479 16:72108291-72108313 CTGCAGGTAAACATTCAGGTAGG - Exonic
1141094650 16:81154366-81154388 ATGCAGGAACCCACTGAGCAAGG - Intergenic
1145124789 17:20291305-20291327 CTGCAGGGCCTCTTTCAGCAGGG + Intronic
1146594323 17:34156167-34156189 CTGCAGGTTGACATCCAGCAGGG + Intronic
1147267628 17:39244434-39244456 CTGCAGGCAAACACACAGCAAGG - Intergenic
1148455585 17:47809333-47809355 CTGCAAGATCACCTTCTGCAAGG - Exonic
1148579360 17:48733158-48733180 CTCCAGGAGCCCATTCAGCTCGG + Intergenic
1150413821 17:64970566-64970588 CTACAGTAATACTTTCAGCAAGG + Intergenic
1151360326 17:73584785-73584807 CTGCAGGGACACAGGCAGAAGGG - Intronic
1152617674 17:81345450-81345472 CTGCAGGAACACTTTGGGCCGGG + Intergenic
1155102039 18:22620977-22620999 CTGCAGTAACCAAATCAGCATGG + Intergenic
1156826837 18:41440008-41440030 CTGCAGTAACCCAAACAGCATGG - Intergenic
1157812575 18:50708108-50708130 TTGCAGGAAAGCATGCAGCAGGG - Intronic
1158075406 18:53522529-53522551 CTACAGGAACCAAATCAGCATGG + Intronic
1160307692 18:77755491-77755513 CTGCACCACCACATTCAGCAGGG + Intergenic
1163137508 19:15323336-15323358 CTGCTGGGGCACACTCAGCAGGG - Intronic
1163750635 19:19075385-19075407 CTGCATGAACAGAAGCAGCATGG + Intronic
1164640529 19:29822033-29822055 CTGCATGTATACATTCAGCCAGG - Exonic
1164863999 19:31588764-31588786 CTGAACGAACACATCCAGCATGG - Intergenic
1166154252 19:40899041-40899063 CTGTATGAACACAAGCAGCAGGG + Intergenic
1166173856 19:41051541-41051563 CTGTATGAACACAAGCAGCAGGG - Intergenic
1166577868 19:43861075-43861097 CTGCAGTAACCCAAACAGCATGG + Intergenic
1166993375 19:46706440-46706462 CTGCAAGAAGAGCTTCAGCAGGG + Intronic
1168098067 19:54126676-54126698 CTGCAGGGAGACCCTCAGCAGGG + Intronic
925014340 2:510426-510448 CTGCAGGAGCACATGAACCATGG - Intergenic
926054226 2:9764849-9764871 CTTCAGGAACAAATGAAGCAGGG - Intergenic
928397090 2:30950984-30951006 CTGCAGGGACAAAATCAGCCTGG + Intronic
931477279 2:62601903-62601925 GTGAAGGAACACATTTATCAAGG + Intergenic
933400376 2:81788858-81788880 CTACATGAAGACATTCAGCAAGG - Intergenic
934111931 2:88752060-88752082 CTTTAGGCACACATACAGCAAGG + Intergenic
935129384 2:100249915-100249937 ATGCAGGAAGAAATTCAGGAAGG - Intergenic
935437477 2:103050857-103050879 CTGTAGGAACAAAAACAGCATGG - Intergenic
935625438 2:105168782-105168804 CTGCAGGACCACATTCAAGAAGG + Intergenic
935871894 2:107459764-107459786 ATGCAGAAATACATTCAGTAGGG + Intergenic
936542947 2:113366883-113366905 CTGCAGAACCACATCCAACATGG + Intergenic
937561251 2:123226782-123226804 CTGCAGTAACCAAATCAGCATGG - Intergenic
938344354 2:130556714-130556736 CTGCAGGAACACTGTCTTCAGGG + Intergenic
938345479 2:130564008-130564030 CTGCAGGAACACTGTCTTCAGGG - Intergenic
941185071 2:162312261-162312283 CTGCACAAGCACATACAGCATGG + Intronic
947425641 2:229980741-229980763 CAGCAGGAACACAGCCAGCAGGG - Intronic
948124423 2:235554486-235554508 CAGCAGGCCCACATGCAGCAGGG - Intronic
948349137 2:237323767-237323789 CAGCAGGAACACCTTCCGCTCGG + Intergenic
948546842 2:238738629-238738651 CTGCAGGATCGCCTTCAGCCAGG - Intergenic
948718669 2:239882525-239882547 CTGCAGGCACCCATCCAGGAAGG + Intergenic
948839235 2:240641045-240641067 CTGCCTGAGCACCTTCAGCAAGG - Intergenic
1170130385 20:13012743-13012765 CTGAAGAATCACAATCAGCATGG + Intronic
1171182615 20:23101975-23101997 GTGCAGGAAGCCATCCAGCAGGG + Intergenic
1171519735 20:25766571-25766593 CTGCAGGAGCCCAGTCAGAAGGG - Intronic
1171557185 20:26089922-26089944 CTGCAGGAGCCCAGTCAGAAGGG + Intergenic
1172635742 20:36408483-36408505 CTGCAGGAACAAGCTCAGCTTGG - Intronic
1174792051 20:53488127-53488149 TTGCAGGAACACATTTAAAATGG - Exonic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1185157408 22:49202447-49202469 CTACAGCAAGACATTCCGCAGGG - Intergenic
949921273 3:9004020-9004042 CTGCATGAATAAGTTCAGCAAGG + Intronic
950561546 3:13731775-13731797 CTACAGGAACAAAAACAGCATGG - Intergenic
951127186 3:18997542-18997564 CGGAAGGAACAGAATCAGCAAGG - Intergenic
952695710 3:36263386-36263408 CTGCAGGAACCAAAACAGCATGG - Intergenic
953261544 3:41344088-41344110 CTGCAGTAACAAAAACAGCATGG + Intronic
953663188 3:44905845-44905867 CTGCAGGAAGATTCTCAGCAGGG + Intronic
954665166 3:52247737-52247759 CTGCAGGGACACAGCCACCAGGG - Exonic
956317311 3:67952552-67952574 CTGCAGCAACCAAATCAGCATGG + Intergenic
956575785 3:70751541-70751563 CTGCAGGAAGACAGTAAGAAGGG + Intergenic
957089804 3:75718309-75718331 CTGGAGGAAGACATTCGGCTGGG + Intronic
959495551 3:107046979-107047001 CTGTGGGACCACATTGAGCAAGG + Intergenic
960276010 3:115730057-115730079 GTGCAGCAACACACTCACCATGG - Intergenic
960534198 3:118798760-118798782 AAGCAGGAAGACATTCAGGAAGG + Intergenic
961128775 3:124446161-124446183 CTGCAGGAGCTCACTCAGGATGG - Exonic
962586509 3:136847643-136847665 CTGCAGGCAGTCATTCAGGAAGG + Intronic
963041643 3:141074731-141074753 GTGCAGGCAGACATTCAGCAGGG + Intronic
964696555 3:159514465-159514487 CTTCATGAACACAGTCAACATGG + Intronic
965519893 3:169661722-169661744 CTGCAGGGACGCAGTGAGCAAGG + Intronic
965603808 3:170480431-170480453 CTGCAGGATCACAAACACCAGGG + Exonic
965929365 3:174023641-174023663 CTGCAGCAACACAGTCATCCTGG - Intronic
966904446 3:184511669-184511691 CTCCATGAACACAGTAAGCACGG - Intronic
968236835 3:197036864-197036886 CTGCAGGAACTCAGGCACCAAGG + Intergenic
968990485 4:3908154-3908176 CAGGAGGATCACATTCAGCCAGG - Intergenic
969824842 4:9749188-9749210 CAGGAGGATCACATTCAGCCAGG + Intergenic
970016767 4:11520671-11520693 CAGCAGCAGCACATTCAGCCTGG - Intergenic
970677450 4:18467396-18467418 TTGATGGAACACATACAGCAAGG + Intergenic
970993900 4:22243620-22243642 CTGCAGTAACAAAAACAGCATGG - Intergenic
972390985 4:38613183-38613205 TTGCTGGAACACATTATGCAGGG - Intergenic
972749692 4:41976067-41976089 CTCAAGGAACATATTCTGCAAGG - Intergenic
973802203 4:54489905-54489927 CTGCATGAAACCATTTAGCATGG - Intergenic
973998870 4:56489710-56489732 ATGCATGTACACATACAGCAAGG - Intronic
975741768 4:77436113-77436135 CTGCAGGAATGCACTGAGCATGG - Intergenic
976132842 4:81903458-81903480 CTGCAGGAACACAGACAACTGGG + Intronic
976384475 4:84439717-84439739 CTGCAGGATGACAATCATCATGG - Intergenic
977390031 4:96396827-96396849 CTGTAGGAACCCAAACAGCATGG - Intergenic
980452763 4:132997003-132997025 CTTCAGAAACACATAAAGCAAGG - Intergenic
982113784 4:152080033-152080055 CTGCAGCAGCACAGTCAGCATGG - Intergenic
985721805 5:1493410-1493432 CTGGGGGGACACATTCAGTATGG - Intronic
985811558 5:2093968-2093990 CTGCTGGAACACAGTGTGCATGG - Intergenic
987706690 5:21468346-21468368 CTGGAGGAAGAAATGCAGCACGG + Intergenic
990315923 5:54583343-54583365 CTGAATGAAAACATTGAGCATGG + Intergenic
991341140 5:65610701-65610723 TTTCAGGAACTCATTCATCATGG - Intronic
992037841 5:72798465-72798487 CTCCAGGAACACAGAGAGCAGGG + Intergenic
992504719 5:77375615-77375637 CTGCAGGAGGACATTAAGGAGGG - Intronic
993403115 5:87477310-87477332 CTACAGTAACAAATACAGCATGG + Intergenic
993453178 5:88097458-88097480 CTGCTGGATCACCTTCTGCAGGG + Intergenic
993593202 5:89821713-89821735 CTGCAGTAACCAAATCAGCATGG - Intergenic
995213293 5:109565567-109565589 CTGCAGTAACAAAAACAGCATGG - Intergenic
995452832 5:112321319-112321341 CTGCAGTAACACAATGACCAAGG + Intronic
1000449540 5:161368385-161368407 ATGGAATAACACATTCAGCAAGG + Intronic
1001621432 5:173088582-173088604 CAGCTGGAAAACATTGAGCAAGG + Intronic
1003418424 6:5934341-5934363 CTGCAGGAACACAGTGGGCAAGG - Intergenic
1004314731 6:14575778-14575800 ATGCAGGAAGGCATTCAGCAGGG + Intergenic
1007045011 6:38764344-38764366 CTGCATGAACAAATTCAATATGG + Intronic
1009493159 6:64316824-64316846 CTACAGTAACACAAACAGCATGG + Intronic
1009523898 6:64719144-64719166 CTCCAGGATAACAGTCAGCAAGG + Intronic
1010475942 6:76287364-76287386 CTGCAAGAGCAATTTCAGCAGGG - Intergenic
1011162564 6:84408085-84408107 CTCCAGGAACATATTCAAGATGG + Intergenic
1014922840 6:127232966-127232988 CTGCAGTAACTCAAACAGCATGG + Intergenic
1016452237 6:144195233-144195255 CTGCAGGGTCAGCTTCAGCAGGG - Intergenic
1016940453 6:149479031-149479053 GAGCAGGGAAACATTCAGCATGG - Intronic
1018483601 6:164216717-164216739 CTGCAGGAATCGGTTCAGCAAGG - Intergenic
1019141674 6:169950874-169950896 CTGCAGGAAGAAGATCAGCATGG - Intergenic
1019353801 7:568621-568643 CTGCAGGACCACAGCCACCACGG + Intronic
1020623721 7:10551190-10551212 GGGCAGGAAAACATCCAGCATGG - Intergenic
1021037481 7:15817861-15817883 GTGCAGGGAGACTTTCAGCAGGG + Intergenic
1022025927 7:26447897-26447919 CTGCGGGAAGTCATTCAGGATGG - Intergenic
1023210749 7:37802488-37802510 CAGCAGGCACAAAATCAGCAAGG - Intronic
1026322545 7:69280159-69280181 CTGCTGGAACACTCTCAGTACGG + Intergenic
1026488580 7:70842918-70842940 CTGCAGTAACAAAAACAGCATGG + Intergenic
1027792096 7:82647178-82647200 CTACAGTAACAAATACAGCATGG + Intergenic
1031629763 7:124032674-124032696 CTGCAGGTACACCTTCTCCAGGG + Exonic
1031757866 7:125668625-125668647 CTTCAGAAACACTTTCAGCTTGG + Intergenic
1035321341 7:158031289-158031311 ATGCAGGAAAAAATTCAGGAAGG - Intronic
1036069449 8:5424507-5424529 CTGCAGGAACATATGAAGTATGG + Intergenic
1036771747 8:11583202-11583224 TTTTAGGAACACACTCAGCAGGG - Intergenic
1037670336 8:21010175-21010197 CTGCATGAAGACAGTCAGCCTGG + Intergenic
1037885939 8:22596398-22596420 CTGCAGCCACACAATCAGCCCGG + Intronic
1039934202 8:42026151-42026173 CTGTAGTAACCAATTCAGCAAGG - Intronic
1040463577 8:47673553-47673575 CTGCATGAACACATACAGAAAGG + Intronic
1040951159 8:52940077-52940099 CCGCAGCAACACGTACAGCACGG - Exonic
1041300593 8:56407541-56407563 CTGTAGGAAGACCCTCAGCATGG + Intergenic
1042202056 8:66288597-66288619 CTGCAGGAACACACTCCCAATGG - Intergenic
1042802228 8:72732025-72732047 CTGAAGGAGGAGATTCAGCAGGG - Intronic
1044957633 8:97498142-97498164 TTGCAGGAATCCATTCAACATGG - Intergenic
1049057979 8:140254177-140254199 CTGCAGGAGCAGAGTCAGGAGGG - Intronic
1049254936 8:141608736-141608758 CTGCAGGAACAGGTACTGCAGGG + Intergenic
1049302929 8:141881260-141881282 CTGCAGGTACACTCTCAGCTGGG + Intergenic
1050253824 9:3773409-3773431 CTGCAGCAACAAATTGAGCAAGG - Intergenic
1050368599 9:4897479-4897501 CTGCAGTAACAAAAACAGCATGG - Intergenic
1051508265 9:17848676-17848698 ATGCTGGAAAACATTAAGCAGGG - Intergenic
1053160533 9:35810648-35810670 CTGCAGGAGCATCTCCAGCATGG + Exonic
1053186528 9:36021233-36021255 CTACAGGAGCACTTCCAGCAAGG - Intergenic
1054519394 9:66063548-66063570 ATGCAGGAACAGGTTCAGAAGGG - Intergenic
1060786092 9:126452501-126452523 CCGGTGCAACACATTCAGCAGGG + Intronic
1061126712 9:128681608-128681630 AAGCATGAACACATTCAGCTTGG + Intergenic
1061302049 9:129711006-129711028 CTTCAGGCACACAGGCAGCAGGG - Intronic
1062333673 9:136055607-136055629 CTGCAGGATCACCACCAGCAAGG + Intronic
1203487764 Un_GL000224v1:73417-73439 CTGGAGGAAGACATTCGGCTGGG - Intergenic
1203500385 Un_KI270741v1:15312-15334 CTGGAGGAAGACATTCGGCTGGG - Intergenic
1186615277 X:11179360-11179382 CCTCAGGAACTCTTTCAGCAAGG + Exonic
1194216961 X:91142398-91142420 CTGCAGTAACAAAAACAGCATGG + Intergenic
1197183486 X:123562128-123562150 CATCATGAACACCTTCAGCATGG + Intergenic
1197252001 X:124226414-124226436 CTGCAGGTTCAAATTCAGGAAGG + Intronic
1197731207 X:129811616-129811638 TTGAAGAAACACATGCAGCATGG + Intronic
1198200547 X:134412892-134412914 CTGAATGAACAAATTCAACAAGG - Intronic
1202017242 Y:20422949-20422971 CTGCAGGAAGCTATTTAGCAAGG - Intergenic