ID: 1139823719

View in Genome Browser
Species Human (GRCh38)
Location 16:69740672-69740694
Sequence GAGCAGGAGTTTCACAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139823714_1139823719 -7 Left 1139823714 16:69740656-69740678 CCATCAATCCTCCCAAGAGCAGG No data
Right 1139823719 16:69740672-69740694 GAGCAGGAGTTTCACAAAGATGG No data
1139823711_1139823719 18 Left 1139823711 16:69740631-69740653 CCCTGTGCTCCAGGTGGTTGTCA No data
Right 1139823719 16:69740672-69740694 GAGCAGGAGTTTCACAAAGATGG No data
1139823708_1139823719 27 Left 1139823708 16:69740622-69740644 CCTCTGGTACCCTGTGCTCCAGG No data
Right 1139823719 16:69740672-69740694 GAGCAGGAGTTTCACAAAGATGG No data
1139823712_1139823719 17 Left 1139823712 16:69740632-69740654 CCTGTGCTCCAGGTGGTTGTCAA No data
Right 1139823719 16:69740672-69740694 GAGCAGGAGTTTCACAAAGATGG No data
1139823713_1139823719 9 Left 1139823713 16:69740640-69740662 CCAGGTGGTTGTCAATCCATCAA No data
Right 1139823719 16:69740672-69740694 GAGCAGGAGTTTCACAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139823719 Original CRISPR GAGCAGGAGTTTCACAAAGA TGG Intergenic
No off target data available for this crispr