ID: 1139823784

View in Genome Browser
Species Human (GRCh38)
Location 16:69741025-69741047
Sequence GGAGTCTTGCTCTGTCGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 445780
Summary {0: 9543, 1: 56297, 2: 100900, 3: 135875, 4: 143165}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139823784_1139823789 29 Left 1139823784 16:69741025-69741047 CCTGGGCGACAGAGCAAGACTCC 0: 9543
1: 56297
2: 100900
3: 135875
4: 143165
Right 1139823789 16:69741077-69741099 AAAAAAAGCACAGATGGGGCTGG No data
1139823784_1139823790 30 Left 1139823784 16:69741025-69741047 CCTGGGCGACAGAGCAAGACTCC 0: 9543
1: 56297
2: 100900
3: 135875
4: 143165
Right 1139823790 16:69741078-69741100 AAAAAAGCACAGATGGGGCTGGG No data
1139823784_1139823788 25 Left 1139823784 16:69741025-69741047 CCTGGGCGACAGAGCAAGACTCC 0: 9543
1: 56297
2: 100900
3: 135875
4: 143165
Right 1139823788 16:69741073-69741095 AAAAAAAAAAAGCACAGATGGGG No data
1139823784_1139823787 24 Left 1139823784 16:69741025-69741047 CCTGGGCGACAGAGCAAGACTCC 0: 9543
1: 56297
2: 100900
3: 135875
4: 143165
Right 1139823787 16:69741072-69741094 AAAAAAAAAAAAGCACAGATGGG No data
1139823784_1139823786 23 Left 1139823784 16:69741025-69741047 CCTGGGCGACAGAGCAAGACTCC 0: 9543
1: 56297
2: 100900
3: 135875
4: 143165
Right 1139823786 16:69741071-69741093 AAAAAAAAAAAAAGCACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139823784 Original CRISPR GGAGTCTTGCTCTGTCGCCC AGG (reversed) Intergenic
Too many off-targets to display for this crispr