ID: 1139823785

View in Genome Browser
Species Human (GRCh38)
Location 16:69741046-69741068
Sequence TTTTTTTTTTTTTTTTGAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 496384
Summary {0: 83672, 1: 60776, 2: 74199, 3: 114646, 4: 163091}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139823785_1139823790 9 Left 1139823785 16:69741046-69741068 CCGTCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1139823790 16:69741078-69741100 AAAAAAGCACAGATGGGGCTGGG No data
1139823785_1139823792 17 Left 1139823785 16:69741046-69741068 CCGTCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1139823792 16:69741086-69741108 ACAGATGGGGCTGGGCGTGGTGG No data
1139823785_1139823791 14 Left 1139823785 16:69741046-69741068 CCGTCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1139823791 16:69741083-69741105 AGCACAGATGGGGCTGGGCGTGG No data
1139823785_1139823789 8 Left 1139823785 16:69741046-69741068 CCGTCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1139823789 16:69741077-69741099 AAAAAAAGCACAGATGGGGCTGG No data
1139823785_1139823786 2 Left 1139823785 16:69741046-69741068 CCGTCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1139823786 16:69741071-69741093 AAAAAAAAAAAAAGCACAGATGG No data
1139823785_1139823787 3 Left 1139823785 16:69741046-69741068 CCGTCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1139823787 16:69741072-69741094 AAAAAAAAAAAAGCACAGATGGG No data
1139823785_1139823788 4 Left 1139823785 16:69741046-69741068 CCGTCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1139823788 16:69741073-69741095 AAAAAAAAAAAGCACAGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139823785 Original CRISPR TTTTTTTTTTTTTTTTGAGA CGG (reversed) Intergenic
Too many off-targets to display for this crispr