ID: 1139823786

View in Genome Browser
Species Human (GRCh38)
Location 16:69741071-69741093
Sequence AAAAAAAAAAAAAGCACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139823783_1139823786 27 Left 1139823783 16:69741021-69741043 CCAGCCTGGGCGACAGAGCAAGA 0: 16638
1: 93697
2: 149761
3: 182743
4: 163738
Right 1139823786 16:69741071-69741093 AAAAAAAAAAAAAGCACAGATGG No data
1139823784_1139823786 23 Left 1139823784 16:69741025-69741047 CCTGGGCGACAGAGCAAGACTCC 0: 9543
1: 56297
2: 100900
3: 135875
4: 143165
Right 1139823786 16:69741071-69741093 AAAAAAAAAAAAAGCACAGATGG No data
1139823785_1139823786 2 Left 1139823785 16:69741046-69741068 CCGTCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1139823786 16:69741071-69741093 AAAAAAAAAAAAAGCACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139823786 Original CRISPR AAAAAAAAAAAAAGCACAGA TGG Intergenic
No off target data available for this crispr