ID: 1139823792

View in Genome Browser
Species Human (GRCh38)
Location 16:69741086-69741108
Sequence ACAGATGGGGCTGGGCGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139823785_1139823792 17 Left 1139823785 16:69741046-69741068 CCGTCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1139823792 16:69741086-69741108 ACAGATGGGGCTGGGCGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139823792 Original CRISPR ACAGATGGGGCTGGGCGTGG TGG Intergenic
No off target data available for this crispr