ID: 1139824313

View in Genome Browser
Species Human (GRCh38)
Location 16:69745157-69745179
Sequence CCCTTTGCTGACAGCTTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 205}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139824313_1139824321 16 Left 1139824313 16:69745157-69745179 CCACTGAAGCTGTCAGCAAAGGG 0: 1
1: 0
2: 4
3: 27
4: 205
Right 1139824321 16:69745196-69745218 AGGGACAGATAAACCACAGGAGG 0: 1
1: 0
2: 3
3: 40
4: 238
1139824313_1139824325 27 Left 1139824313 16:69745157-69745179 CCACTGAAGCTGTCAGCAAAGGG 0: 1
1: 0
2: 4
3: 27
4: 205
Right 1139824325 16:69745207-69745229 AACCACAGGAGGGGCAGGTAAGG 0: 1
1: 0
2: 0
3: 24
4: 287
1139824313_1139824322 17 Left 1139824313 16:69745157-69745179 CCACTGAAGCTGTCAGCAAAGGG 0: 1
1: 0
2: 4
3: 27
4: 205
Right 1139824322 16:69745197-69745219 GGGACAGATAAACCACAGGAGGG 0: 1
1: 0
2: 0
3: 33
4: 263
1139824313_1139824324 22 Left 1139824313 16:69745157-69745179 CCACTGAAGCTGTCAGCAAAGGG 0: 1
1: 0
2: 4
3: 27
4: 205
Right 1139824324 16:69745202-69745224 AGATAAACCACAGGAGGGGCAGG 0: 1
1: 1
2: 0
3: 24
4: 247
1139824313_1139824320 13 Left 1139824313 16:69745157-69745179 CCACTGAAGCTGTCAGCAAAGGG 0: 1
1: 0
2: 4
3: 27
4: 205
Right 1139824320 16:69745193-69745215 CTGAGGGACAGATAAACCACAGG 0: 1
1: 0
2: 1
3: 17
4: 160
1139824313_1139824315 -4 Left 1139824313 16:69745157-69745179 CCACTGAAGCTGTCAGCAAAGGG 0: 1
1: 0
2: 4
3: 27
4: 205
Right 1139824315 16:69745176-69745198 AGGGCTGCCGCATCCCTCTGAGG 0: 1
1: 0
2: 1
3: 15
4: 144
1139824313_1139824316 -3 Left 1139824313 16:69745157-69745179 CCACTGAAGCTGTCAGCAAAGGG 0: 1
1: 0
2: 4
3: 27
4: 205
Right 1139824316 16:69745177-69745199 GGGCTGCCGCATCCCTCTGAGGG 0: 1
1: 0
2: 0
3: 12
4: 134
1139824313_1139824323 18 Left 1139824313 16:69745157-69745179 CCACTGAAGCTGTCAGCAAAGGG 0: 1
1: 0
2: 4
3: 27
4: 205
Right 1139824323 16:69745198-69745220 GGACAGATAAACCACAGGAGGGG 0: 1
1: 0
2: 0
3: 20
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139824313 Original CRISPR CCCTTTGCTGACAGCTTCAG TGG (reversed) Intronic
900214182 1:1472280-1472302 CCCGCTCCTGACAGCTGCAGAGG - Intronic
900221731 1:1512664-1512686 CCCGCTCCTGACAGCTGCAGAGG - Intronic
900398701 1:2464015-2464037 CCCCTTGCTGGCAGCCCCAGAGG + Intronic
900645887 1:3708625-3708647 CCCTGCCCAGACAGCTTCAGGGG + Intronic
900658022 1:3769769-3769791 CCCTTTGCTCACAGCTCGAGAGG + Exonic
902570407 1:17343395-17343417 CCCTCTTCTGATAGCTTCAGGGG + Intronic
902635035 1:17729406-17729428 GCGTTTGCTCACAGCTGCAGAGG + Intergenic
902686186 1:18079227-18079249 CCCTTTGCTGGCAGATTCTGGGG - Intergenic
903417551 1:23194191-23194213 CCTTCTGCTGACTGGTTCAGTGG + Exonic
903657743 1:24959404-24959426 CCCTTTGATGGCGGCTTCTGAGG - Intronic
905644048 1:39612142-39612164 CCCTTTGGGGAGAGATTCAGTGG + Intergenic
905971375 1:42144912-42144934 CCCTTTGCTGACATCTGCCTGGG - Intergenic
914459710 1:147872150-147872172 CCCTTTGCTGGCAGCATCAGGGG - Intergenic
915515595 1:156410664-156410686 CAGTTAGCTGACAGCCTCAGAGG - Intronic
915557746 1:156669764-156669786 CCCTGGGATGACAGCTTGAGGGG - Exonic
918981442 1:191565216-191565238 CCCTCTCCTGAGAGCCTCAGAGG + Intergenic
920180094 1:204127205-204127227 CCCCTTCCTGCCAGCGTCAGAGG + Exonic
922160027 1:223072763-223072785 CCCTTTGCTCAGAGTCTCAGAGG - Intergenic
923143293 1:231179786-231179808 CACTTTTCTGCTAGCTTCAGAGG - Intronic
923895671 1:238267253-238267275 CCCTGTGCTGGAAGCTTGAGCGG - Intergenic
924606597 1:245540843-245540865 CTCTTTGCAACCAGCTTCAGTGG + Exonic
1064624828 10:17251562-17251584 TCCATTGCTGACATATTCAGAGG - Intergenic
1066012255 10:31205528-31205550 CCCTTTGCTCACAGCTGAAGAGG + Intergenic
1068073226 10:52222161-52222183 CCCTTTGATGACACCAGCAGGGG + Intronic
1072295095 10:94001099-94001121 CCCTGTACTCACTGCTTCAGAGG - Intronic
1072470184 10:95706593-95706615 CCATCTGCTGACAGTTTGAGAGG - Intergenic
1073546396 10:104353284-104353306 CCCTTTGAAGACAGCGTCTGTGG + Intergenic
1074143366 10:110696412-110696434 CCCTTTGCTGATTGCTGGAGGGG + Intronic
1074426841 10:113358755-113358777 CCCTTTGCAGAAAGCTTCGTTGG - Intergenic
1075376818 10:121984815-121984837 CCCTTTGCAGACTGCCTCAGCGG - Intergenic
1075657808 10:124173647-124173669 CCCTTGGCCGACACCTTCACCGG + Intergenic
1075886377 10:125903036-125903058 CCTGTGGCTGACAGCATCAGAGG - Intronic
1076727088 10:132419040-132419062 CCCGTTGCTGTCACCTGCAGTGG - Intergenic
1076835936 10:133020936-133020958 CCCTCTCCTGACTCCTTCAGGGG - Intergenic
1077060126 11:614249-614271 CCATCTGCTGACAGCGTCATGGG - Exonic
1077266090 11:1651080-1651102 CCCTTGGCTGTGACCTTCAGAGG + Intergenic
1077393951 11:2312143-2312165 CACCTTGCTCACAGCCTCAGAGG + Intronic
1077598780 11:3557792-3557814 CCCTTTGATGCCCCCTTCAGTGG + Intergenic
1079167973 11:18064953-18064975 CCCTTTCATAAAAGCTTCAGAGG - Intergenic
1079657809 11:23003789-23003811 CCCTCTTCTCACAGCTCCAGCGG + Intergenic
1080270648 11:30447737-30447759 TCCTTTGCTGATAGCTAGAGGGG + Intronic
1084593797 11:70105412-70105434 CCTTTTGATGACATCCTCAGTGG - Intronic
1084945305 11:72634976-72634998 CCCTTCCCTGACAGCCTGAGGGG - Intronic
1085740004 11:79070260-79070282 GCCTTTGCTGTCAGCTTCCTCGG - Intronic
1086119828 11:83294335-83294357 CCCTTTGCTGAGTCCTTCAGCGG + Intergenic
1086699460 11:89883945-89883967 CACTGTGCAGGCAGCTTCAGAGG - Intergenic
1086706711 11:89960569-89960591 CACTGTGCAGGCAGCTTCAGAGG + Intergenic
1089259563 11:117214615-117214637 CCCTTTCCTGACCGGTTCAGGGG - Intronic
1089579810 11:119474640-119474662 CCCTTTCCTGACAGCTGCCTGGG - Intergenic
1090124872 11:124075369-124075391 CTCTCTGCTGAGAGCTGCAGAGG - Intergenic
1091585765 12:1815710-1815732 CCCTTCCCTCCCAGCTTCAGGGG + Intronic
1093693092 12:22129268-22129290 CCCTGTTCTGACAGATTCACTGG + Intronic
1098690243 12:73478957-73478979 CCTTTTGCTGAGACCTTAAGTGG - Intergenic
1098818266 12:75195911-75195933 CCCTTTGCTCAATGCTCCAGTGG + Intronic
1100825532 12:98471344-98471366 CCCTGTGTTGTCAGCTACAGTGG + Intergenic
1101018809 12:100530874-100530896 CCCATGTCTGTCAGCTTCAGGGG - Intronic
1103117941 12:118353535-118353557 CCCTTTTCAGAGAGCTTCAGTGG - Intronic
1103527178 12:121576839-121576861 CCCTGGGCTAGCAGCTTCAGTGG - Intronic
1104322896 12:127768678-127768700 AAATTTGCTGACAACTTCAGAGG + Intergenic
1104422127 12:128645024-128645046 CTCTGTGCTGAGAGCTGCAGTGG + Intronic
1106795555 13:33201188-33201210 CCCTGTACCGAGAGCTTCAGCGG + Intronic
1107405640 13:40110226-40110248 CCCTTGGCTGTCAAATTCAGAGG + Intergenic
1113345552 13:109474466-109474488 CCCTTTGCTCATGGCTTCACAGG + Intergenic
1113371013 13:109725581-109725603 CCCTTTGGTGAGAGGTGCAGGGG - Intergenic
1114709820 14:24766957-24766979 CCCTTGTCTGCCATCTTCAGTGG + Intergenic
1122341111 14:101029091-101029113 CACTTTGCTTACAGCTTCCTCGG + Intergenic
1123397944 15:19955701-19955723 TCCTTTGCTGACAGCTTTGCAGG - Intergenic
1124023748 15:25946056-25946078 CCCTTTGCTGACAGTCTCTTTGG + Intergenic
1124136809 15:27042472-27042494 CCCTCTGCTGCCAGCTTCAGAGG + Intronic
1124414762 15:29466078-29466100 CCATATGCTTCCAGCTTCAGGGG - Intronic
1125277942 15:38013103-38013125 GCCTCTGCTGACAGCTTCCTCGG - Intergenic
1127386856 15:58474115-58474137 TCCTTTGCTGAAATCTCCAGGGG + Intronic
1127642497 15:60929146-60929168 CTCTTTGTTGACACCTTCATTGG - Intronic
1128219354 15:65957383-65957405 CCCTTTGAGAACAGCTTCAGGGG + Intronic
1128783056 15:70375556-70375578 ACTTTTGCTGACAATTTCAGGGG - Intergenic
1133373322 16:5262893-5262915 CCCTTTGATGCCCCCTTCAGTGG - Intergenic
1135733911 16:24915827-24915849 CCCTTAGCTGGCAGCTCAAGTGG + Intergenic
1138716326 16:59027380-59027402 GCCATTTCTAACAGCTTCAGAGG - Intergenic
1139013541 16:62662674-62662696 CCCTTTGCTGACTCCTTTTGCGG - Intergenic
1139697648 16:68686443-68686465 TCCTTTGGTTACAGTTTCAGCGG - Intronic
1139824313 16:69745157-69745179 CCCTTTGCTGACAGCTTCAGTGG - Intronic
1140419536 16:74807272-74807294 CTCTTTGCTGAGAGCTTCAGAGG - Intergenic
1142702089 17:1669018-1669040 CTCTTTCCTGTCAGGTTCAGAGG + Intronic
1142790404 17:2259802-2259824 CCCTTTCCTGAGAGATTCAGGGG - Intronic
1144574989 17:16423732-16423754 TCCTTGGCGGCCAGCTTCAGAGG - Exonic
1146031295 17:29368094-29368116 CCCTTTGCTTACAGTTTCAGTGG + Intergenic
1148787881 17:50154337-50154359 CCCTTGGCTGACCTCTTCACAGG + Intergenic
1149359839 17:55883596-55883618 ACCTTAGATGACGGCTTCAGTGG - Intergenic
1151969468 17:77450395-77450417 GCCTTTGGTGACACCTTCTGAGG - Intronic
1153108412 18:1555530-1555552 TCCTTTGCTGACATTTTAAGAGG + Intergenic
1155103665 18:22639773-22639795 GCTTTTGCAGGCAGCTTCAGGGG - Intergenic
1155702332 18:28762315-28762337 CCCTTTGCTGGCAGCTTCCCTGG - Intergenic
1156160392 18:34351338-34351360 CTCTCTGCTGATAGCTGCAGAGG + Intergenic
1156458577 18:37308428-37308450 CCCTTCCCTGACTGCTCCAGCGG + Intronic
1156526826 18:37775649-37775671 CCCTCTGCTGACAGCCTCCAAGG - Intergenic
1157658634 18:49418767-49418789 CCCCTTGTTGACAGAGTCAGGGG - Intronic
1158016233 18:52787631-52787653 CTCTTTTCTGAAAGTTTCAGGGG + Intronic
1161441548 19:4294585-4294607 CCCTTTGCTGGCAGCTGCGGCGG + Exonic
1161595978 19:5151160-5151182 CCCTCTGCTGGCAGGATCAGGGG + Intronic
1162122174 19:8477748-8477770 CTCTCTGCTGACAACTGCAGTGG - Intronic
1164887742 19:31797347-31797369 CCTTTTTCTGAAAGCTGCAGAGG + Intergenic
1166400047 19:42471873-42471895 CACTTTTCTCACTGCTTCAGAGG + Intergenic
1167235097 19:48309379-48309401 CTCTCTGCTGAGAGCTTCAGAGG + Intronic
924976025 2:176222-176244 CCCCATGTTGACAGCTGCAGAGG + Intergenic
927770063 2:25852831-25852853 CCCTTTGTTGACAAATACAGGGG - Intronic
928063088 2:28134774-28134796 CCCTTTGCTAGGTGCTTCAGAGG + Intronic
929158593 2:38810263-38810285 CCCTTTGATGACCATTTCAGGGG + Intronic
929446783 2:42008447-42008469 CCGTGAGCTCACAGCTTCAGTGG + Intergenic
929610842 2:43269624-43269646 CCCATTCCTGCCAGCTGCAGTGG - Intronic
929861636 2:45683324-45683346 CACTTGGCTGACTGCTTGAGGGG - Intronic
929919970 2:46164913-46164935 CTCCTTGGTGATAGCTTCAGAGG - Intronic
929967491 2:46546226-46546248 CCCTTTGCTGACATCAGCTGTGG - Intronic
934129175 2:88930905-88930927 CCATTTGGTGACAACTGCAGAGG - Intergenic
936152480 2:110029463-110029485 CCCTTTGCAGCCATCTCCAGTGG - Intergenic
936192200 2:110341949-110341971 CCCTTTGCAGCCATCTCCAGTGG + Intergenic
936784662 2:116079797-116079819 TCCTTTAAGGACAGCTTCAGAGG - Intergenic
937061742 2:118985159-118985181 CCCTTTGCTCACAGTGTCACAGG + Intronic
937423371 2:121777185-121777207 CCTTAGGCTGACAGCTTCGGAGG + Intergenic
942090181 2:172482487-172482509 ACCTTTGCTAACTGCTTGAGGGG - Intronic
948798681 2:240420327-240420349 CCCTTTCCTGACCCCCTCAGTGG + Intergenic
1169331710 20:4721537-4721559 GTCTTTGCTGACAGCCTCTGTGG - Intergenic
1170043839 20:12065444-12065466 CTCTCTGCTGAAAGCTACAGAGG - Intergenic
1171239336 20:23552229-23552251 CACTTTGTTGTCAGCCTCAGTGG - Intergenic
1172183732 20:33018921-33018943 CCCTGTGGCGCCAGCTTCAGCGG - Intronic
1174951307 20:55044019-55044041 CCCGCTGATGACAACTTCAGTGG - Intergenic
1175781747 20:61687172-61687194 CCCTTTCCAGAAAGCTGCAGAGG + Intronic
1175932883 20:62501635-62501657 CCCTGTGTTGACATCTCCAGAGG + Intergenic
1176744624 21:10640423-10640445 TCCTTTGCTGACAGCTTTGCAGG - Intergenic
1176943093 21:14947551-14947573 CTCTTTGTTGAGAGCTTCAGGGG + Intergenic
1177674986 21:24285211-24285233 CCCTTGGTTGATTGCTTCAGAGG + Intergenic
1178353691 21:31892882-31892904 CCCTTTCTTGGCAGCTTCTGTGG + Intronic
1180286386 22:10748553-10748575 CCTGTGGCTGACAGCATCAGAGG - Intergenic
1180616500 22:17131730-17131752 CCCTTGGGTGGCAGCTTCTGTGG - Exonic
1183406580 22:37633253-37633275 CCCTGTGGTCACAGCCTCAGGGG + Exonic
1184999897 22:48238983-48239005 GCCTTAGCTGCCAGCTCCAGAGG - Intergenic
1185074979 22:48678182-48678204 CCCTCTGCTGAGGGCTTCTGAGG + Intronic
950079813 3:10213336-10213358 ACCTTTGCTGACGTCTACAGAGG + Exonic
950751677 3:15134061-15134083 CCCTTTGATGCCTCCTTCAGTGG - Intergenic
951599085 3:24353018-24353040 CTCTTTAATGACAACTTCAGGGG + Intronic
952852082 3:37737651-37737673 CACTTGGCTGGCAGCTCCAGTGG + Intronic
953588349 3:44226456-44226478 ACCTTTGCTGACCACTTCGGAGG - Intergenic
954896046 3:53975946-53975968 CCCTTCGCTGCAAGCTTCACAGG - Intergenic
955025821 3:55166323-55166345 CCCTTTGTAGCAAGCTTCAGAGG - Intergenic
957068930 3:75550247-75550269 CCCTTTGATGCCCCCTTCAGTGG + Intergenic
957470651 3:80653892-80653914 ACCTCTTCTCACAGCTTCAGGGG - Intergenic
958064000 3:88519499-88519521 CCCTTTGCAGCCAGCTGCGGTGG - Intergenic
958620120 3:96548021-96548043 CCTTTTCCTGCCAGGTTCAGTGG - Intergenic
963675158 3:148301626-148301648 CTCCTTTCTGAAAGCTTCAGAGG - Intergenic
964616561 3:158672675-158672697 CCCTGGGCTGACTGCTTCTGAGG + Exonic
966491522 3:180532340-180532362 CTCTCTGCTGAGAGCTGCAGAGG + Intergenic
967004764 3:185373895-185373917 CCCTTTGCTGACTCCTTTTGCGG - Intronic
968913464 4:3487048-3487070 GCCATTGCTGACAGCTGGAGGGG + Intronic
969349159 4:6588231-6588253 CCCTTCCCTCACACCTTCAGAGG - Intronic
969799927 4:9555847-9555869 CCCTTTGATGTCCCCTTCAGTGG - Intergenic
971260247 4:25050439-25050461 TCCTTTGCTGACATTATCAGTGG + Intergenic
971505502 4:27362025-27362047 CCATTTGCTGATAGAATCAGGGG + Intergenic
971938762 4:33188432-33188454 CTCTCTGCTGAGAGGTTCAGAGG - Intergenic
972294611 4:37724739-37724761 GCCTTTGCTGCCAGTTTCTGAGG + Intergenic
972769731 4:42186085-42186107 CCCTTCCCTGGCACCTTCAGAGG + Intergenic
972927214 4:44024869-44024891 CCCTTGGCTGGCAGCATCACTGG - Intergenic
974781335 4:66557268-66557290 CCATTTGCAGACAGCAACAGGGG - Intergenic
976675453 4:87697674-87697696 CTCTCTGCTGAGAGCTTCAGAGG - Intergenic
978460826 4:108950134-108950156 CCCTTTGCTTAGGGCCTCAGAGG + Intronic
986293683 5:6420195-6420217 GCCTTTTCTGGCATCTTCAGAGG - Intergenic
986734203 5:10655966-10655988 CCCATTGATGACAACTGCAGTGG + Intergenic
987403530 5:17502287-17502309 CCTTTTGCTGGCGGCTTTAGTGG + Intergenic
987411007 5:17615027-17615049 CCTTTTGCTGGCGGCTTTAGTGG + Intergenic
988484396 5:31656478-31656500 CCCTTTACTGACTGCTGCTGGGG - Intronic
989589802 5:43102808-43102830 GCCTTTTTTCACAGCTTCAGCGG + Intronic
991099382 5:62776024-62776046 GCCTTCGCTGACTGCCTCAGAGG + Intergenic
991258875 5:64645474-64645496 TCCTTTGCTGACACCCACAGGGG - Intergenic
991534723 5:67655739-67655761 CCTCTTGCTGAAAGCTTCTGAGG + Intergenic
992955879 5:81907601-81907623 CCCCGTGCGGACAGCTTCTGGGG + Intergenic
997118398 5:131150153-131150175 CCCTTTCAGGAAAGCTTCAGAGG + Intergenic
999859955 5:155634070-155634092 CCCTCTGCTGAGAGCTGCAGAGG + Intergenic
1000079076 5:157827709-157827731 CCCCTTCCTTACAACTTCAGTGG + Intronic
1003495903 6:6663003-6663025 CCCTTCCCTCGCAGCTTCAGAGG - Intergenic
1004144186 6:13049288-13049310 TCATTTGCTCACATCTTCAGAGG - Intronic
1005685618 6:28250891-28250913 CCCTGTGCACACAACTTCAGAGG - Intronic
1006347994 6:33498445-33498467 CTCTCTGCTGAGACCTTCAGAGG + Intergenic
1006414266 6:33894048-33894070 CCCTTTGCTGACAGATTGCCTGG - Intergenic
1010785294 6:79993520-79993542 CCCTTTCATCACAGGTTCAGAGG + Intergenic
1018758110 6:166867001-166867023 CCCCTTCCGGACACCTTCAGGGG + Intronic
1018996140 6:168711957-168711979 CCCTTCCCTGACAGCCACAGGGG - Intergenic
1018999313 6:168735335-168735357 GCCCCTGCTGACAGCTTCAGTGG + Intergenic
1019911935 7:4106050-4106072 ACCTTGGCTGCCACCTTCAGTGG + Intronic
1021673792 7:23060186-23060208 TCCTTTGCTGAGAAATTCAGAGG + Intergenic
1022423390 7:30245665-30245687 GCCTTTGCTGAGAGCTGCAGAGG - Intergenic
1024207312 7:47174864-47174886 TCCTTTGCTGGCATCTTAAGAGG - Intergenic
1028558792 7:92150600-92150622 CCCTTTGCTGAGACCTCCAGTGG - Exonic
1028784275 7:94774093-94774115 CCCTTTTCTCACAGCTCCACTGG - Intergenic
1029912030 7:104163344-104163366 CCCTTTAGTGGCAACTTCAGAGG + Intronic
1032107233 7:129043276-129043298 ACCTTTGGTCTCAGCTTCAGGGG + Intronic
1032504929 7:132427603-132427625 ATCTTTACTGGCAGCTTCAGGGG + Intronic
1034274127 7:149816674-149816696 GCCTCTGCTGACAGCGTCAGGGG + Intergenic
1036142816 8:6224025-6224047 CCCCTTTCTGACAGCTTGTGCGG + Intergenic
1036255006 8:7198890-7198912 CCCTTTGATGCCCCCTTCAGTGG + Intergenic
1037408729 8:18571244-18571266 GCCTTTGCTGACCTCTGCAGAGG + Intronic
1038328163 8:26588010-26588032 ACCTTTGCTCTCAGCCTCAGTGG + Intronic
1038952847 8:32434560-32434582 CCCTCTGGAGCCAGCTTCAGAGG + Intronic
1039567835 8:38564066-38564088 CCCTGAGCTCACAGCTGCAGTGG - Intergenic
1039914858 8:41852309-41852331 CCCCTGCCTGAGAGCTTCAGGGG + Intronic
1040815122 8:51499591-51499613 CACTTTGCTGTAAGCTTTAGAGG - Intronic
1045691436 8:104763776-104763798 CCCAATGCTGACAGTGTCAGAGG - Intronic
1047172215 8:122504684-122504706 GCTTCTGCTGAGAGCTTCAGTGG + Intergenic
1048999272 8:139814353-139814375 CCATTTCCTGACAGCTTGAGGGG - Intronic
1049013591 8:139904491-139904513 ACCTTTGCTGACACCTTCCAGGG + Intronic
1049038016 8:140091713-140091735 CCCTTTGAAGCCAACTTCAGAGG - Intronic
1052875011 9:33552640-33552662 CCATTTGCTGCCACTTTCAGTGG + Intronic
1053147097 9:35719129-35719151 CCCTTTGCTGCCTGCAACAGGGG + Exonic
1053300684 9:36947168-36947190 CCCCTTCCTGGCAGCTCCAGAGG + Intronic
1053501008 9:38591686-38591708 CCATTTGCTGCCACTTTCAGTGG - Intergenic
1056404994 9:86265197-86265219 GCCTTCGCTGACTGCCTCAGAGG + Exonic
1059739938 9:117140327-117140349 CCCTTTTCCCACAGCTTCAGTGG - Intronic
1060414204 9:123419264-123419286 CCCTTTGGGGCCAGCTTCAGAGG - Intronic
1061708978 9:132474529-132474551 CCCTTTGTTGCAAGCTTCAAAGG - Intronic
1062382374 9:136292605-136292627 GCCTGTGCTGAGAGCTTCACCGG - Intronic
1062443792 9:136584972-136584994 TCCCTGGATGACAGCTTCAGGGG - Intergenic
1185784778 X:2881452-2881474 GCTTTTGCCGACAGCTTCAAGGG - Exonic
1187984976 X:24800345-24800367 ATCTTTGCTGACAGTTTCAGGGG + Intronic
1189065040 X:37798542-37798564 CCCTTTGCTTATATCTTCATAGG + Intronic
1189380258 X:40497677-40497699 CCCTCTGCTGTCAGCCTCACAGG + Intergenic
1191696159 X:63993025-63993047 TCCTTTCCTCACTGCTTCAGGGG + Intergenic
1192157735 X:68758998-68759020 CCATCTGCTGACAGCTGTAGAGG + Intergenic
1192594604 X:72393586-72393608 CCCTTTTGTGACAGCTTCTTTGG + Intronic
1193682718 X:84541642-84541664 CGCTTTTCTCACAGCTTCACTGG - Intergenic
1193682763 X:84541887-84541909 CGCTTTTCTCACAGCTTCACTGG - Intergenic
1195016493 X:100786706-100786728 CCCTTTGCTGACATCTTTTTCGG - Intergenic
1195611546 X:106872636-106872658 CCCTCTGAGGACAGCTTCAAAGG + Intronic
1196698497 X:118640284-118640306 TCCTTTTCTGAAACCTTCAGAGG - Intronic
1199359995 X:146906983-146907005 CTCTCTGCTGAGAGCTTCAGAGG - Intergenic
1199852735 X:151737091-151737113 CGCCATGGTGACAGCTTCAGAGG + Intergenic
1200634198 Y:5629667-5629689 CCCTTAGGTTACAGCTTCATAGG - Intronic
1200878975 Y:8191931-8191953 GTCTCTGCTGACAGCTTCAGAGG + Intergenic
1201055369 Y:9984419-9984441 GTCTCTGCTGACAGTTTCAGAGG - Intergenic
1202191056 Y:22245331-22245353 ATCTCTGCTGACAGCTTCAGAGG + Intergenic
1202628205 Y:56881957-56881979 CCTGTGGCTGACAGCATCAGAGG + Intergenic