ID: 1139826064

View in Genome Browser
Species Human (GRCh38)
Location 16:69758184-69758206
Sequence TACTTGGGTGGCCGAGGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139826064_1139826071 -9 Left 1139826064 16:69758184-69758206 CCCCTGCCTCGGCCACCCAAGTA No data
Right 1139826071 16:69758198-69758220 ACCCAAGTAGCTGGGACTACAGG 0: 356
1: 44018
2: 158932
3: 225592
4: 229619

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139826064 Original CRISPR TACTTGGGTGGCCGAGGCAG GGG (reversed) Intergenic
No off target data available for this crispr