ID: 1139827109

View in Genome Browser
Species Human (GRCh38)
Location 16:69766116-69766138
Sequence CTGTCTGAGGGGCAGGTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 327}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139827109 Original CRISPR CTGTCTGAGGGGCAGGTGTA GGG (reversed) Intronic
900768411 1:4520789-4520811 CTGTCTGTGGTGGAGGTGGAGGG - Intergenic
900768442 1:4520933-4520955 CTGTCTGTGGTGGAGGTGGAGGG - Intergenic
900840438 1:5045046-5045068 CTGTCTGGCGGGCAGGAGTAGGG - Intergenic
901195598 1:7438262-7438284 CTGTCCGAGCGGCAGGTTTGCGG + Intronic
902406657 1:16187811-16187833 GTGTCTGTGGGGCAGGGGTAGGG - Intergenic
902669212 1:17960964-17960986 CTGGCTGAGGGACATCTGTAAGG - Intergenic
903007601 1:20308936-20308958 CTGTCTGCGGGGTAGGTGCCAGG - Intronic
904657700 1:32061759-32061781 CTGACTGAGGAGCTGGTGTTAGG + Intergenic
906192832 1:43909212-43909234 CTGACTGAGAGGCAGGAGTTTGG - Intronic
907053073 1:51342833-51342855 CAGGCTGAGGAGAAGGTGTAGGG - Intronic
907216583 1:52869917-52869939 CTGTCTGGGAGGGAGGTGTGGGG - Intronic
907309200 1:53529726-53529748 CTGAATGAGTGGCAGGTGTGTGG + Intronic
907774173 1:57496987-57497009 ATGTTTGAGGGGCAGCTGAAAGG - Intronic
911018196 1:93357805-93357827 TTGACTGAAGGGCAGGAGTAGGG - Intronic
912133694 1:106633320-106633342 CTCTCTGAGTGGCTGGTGTATGG - Intergenic
912544208 1:110439281-110439303 CTGACAGAGGGTCAGCTGTAAGG + Intergenic
916051885 1:161042174-161042196 GTGTCTGAGGGGCAGCTGGATGG - Exonic
916457207 1:164983160-164983182 CAGTCTGTGGGGCTGGTGTGTGG - Intergenic
916465854 1:165074247-165074269 CTATCTGTGGGGCAGGACTAGGG - Intergenic
918041474 1:180916542-180916564 CTGCCTGATGGGCAGCTGGACGG + Exonic
918465432 1:184817017-184817039 CAGGGTGAGGGGCAGGTGGAGGG - Intronic
919832662 1:201552887-201552909 CTGTCTGAGGGTCAGATGGACGG + Intergenic
920825874 1:209423856-209423878 CTGGGTGAGGGGGAGGTGTGGGG + Intergenic
920827039 1:209431935-209431957 CTGTCTGTGCAGCAGGTGCAAGG + Intergenic
921734868 1:218615477-218615499 CTGTCTGTGGGGGAGTTTTATGG + Intergenic
923026453 1:230208398-230208420 CTGTGAGTGGAGCAGGTGTAGGG + Intronic
923480343 1:234377724-234377746 TTGGCTGAGGGGCAGGTCTCTGG + Intronic
923663311 1:235977622-235977644 CTGTCTGAGGGTTGGGGGTAGGG + Exonic
924766768 1:247039761-247039783 CTGTCTCATTGGCAGGTGCAGGG + Intronic
1063134158 10:3201853-3201875 CTTTCTGAGGGGCTGGGGGAGGG + Intergenic
1064100304 10:12457894-12457916 CTGTCTGAGGCACAGGGGAAGGG + Intronic
1064498667 10:15943997-15944019 GTTTCTGTGGGGCAGGTGTTTGG + Intergenic
1064535224 10:16351235-16351257 CTGTCTCGGTGGCAGGTGGAGGG - Intergenic
1066732895 10:38450250-38450272 GTGTCGGAGGGGCCGGTGTGAGG - Intergenic
1067060485 10:43075770-43075792 CTTGCTGAGGGGCAGGTGGCCGG - Intergenic
1067061213 10:43078816-43078838 CTGTCTGTGGGCCAGGGGTCTGG - Intronic
1067090173 10:43262420-43262442 CAGTCTGGGGGGCTGGTGTCTGG - Intronic
1067160201 10:43819220-43819242 CTGTCTGGGGGTCAGGTAGATGG + Intergenic
1070279470 10:75038106-75038128 CACACTGAGGGGCAGGTGTTGGG + Intronic
1070554412 10:77516800-77516822 CTGTGTGAGCGGCTGGTGTGGGG + Intronic
1070634872 10:78117219-78117241 CTGTCTGGGGGGCTGTTGCAGGG - Intergenic
1071508163 10:86245334-86245356 CTGTCTGAGGGGTAGGTGCTGGG - Intronic
1072564976 10:96609939-96609961 CTGTGAGAGAGGCAGGTGGAGGG - Intronic
1072635732 10:97176650-97176672 CTGTCTGAGGAGGAGGTCCAAGG - Intronic
1072664998 10:97386096-97386118 CTGTGTGGGGGGCATGTGTGAGG - Intronic
1073439931 10:103546503-103546525 GTGGCAGAGGGGCAGGTGTTGGG + Intronic
1076093692 10:127712990-127713012 CTGTCGCAGTGGCAGGTGCATGG - Intergenic
1076457203 10:130608695-130608717 CTGTCTGCGGGGCAAATGCAGGG - Intergenic
1076707618 10:132310227-132310249 CTGACTGAGAGGCAGGTGCCTGG - Intronic
1077215422 11:1393443-1393465 CTGTCTGGGGGGCGGGAGAAAGG + Intronic
1078667602 11:13339563-13339585 CAGTCAGAGGGCCAGGTGTGGGG - Intronic
1078857936 11:15221574-15221596 CTGGGTGACGGGCAGGTGTGGGG - Exonic
1079475328 11:20823835-20823857 CTTTCTTCGGGGCAGGTGCAGGG - Intronic
1081029002 11:38054139-38054161 CTGACTGAAGGGTAGGTGAAAGG - Intergenic
1081033508 11:38114425-38114447 TTGTCTGAGGGCCAGGACTAAGG - Intergenic
1081607602 11:44537095-44537117 CTGTCTGAGGGTCAGAGGTGGGG + Intergenic
1081993724 11:47350886-47350908 CAGTCTGAGGGGCTGCTCTAAGG - Intronic
1083300948 11:61739397-61739419 CTGGCTGGGGGGCAGGGGCAGGG - Intronic
1084192403 11:67505017-67505039 CAGTCTGGGGCGCAGGTGGACGG - Intronic
1084383996 11:68830649-68830671 CTGGCGGAGGGGCAGGTGACAGG - Intronic
1084459025 11:69286031-69286053 CAGGCTGAGGGGCAGCTGCAGGG - Intergenic
1084904870 11:72337902-72337924 CTGTCTGGGGGCCAGGGGAATGG + Intronic
1086380529 11:86247678-86247700 CTGACTTAGGGGCAGTAGTAAGG + Intronic
1086729462 11:90229385-90229407 CAGCCTGAGAGGCAGCTGTAAGG + Intergenic
1088107494 11:106223410-106223432 CTGCCTGAGGGGAAGGTCTGGGG - Intergenic
1089733135 11:120532024-120532046 CTGGATGTGGGGCAGGTGGAAGG + Intronic
1089847290 11:121468286-121468308 CTGTCTGAGGCACACGTGGAAGG - Intronic
1090178563 11:124673600-124673622 CAGGCTGAGGGGCAGGGGTCCGG + Intronic
1090946242 11:131431876-131431898 GTGTCTGATGGGGAGGGGTAGGG - Intronic
1092034700 12:5322854-5322876 CTGTCGGAGGGGGACTTGTAGGG - Intergenic
1092203715 12:6603176-6603198 CTTGCTGGGGGGCGGGTGTAGGG - Intronic
1092839739 12:12528310-12528332 CTGGGAGAGGGGCCGGTGTATGG + Intronic
1095249297 12:39959971-39959993 CTGTCTGGGGGCCAGGTGAAGGG - Intronic
1097185127 12:57192659-57192681 CTGTGGGAGGGCCAGGTGCATGG - Intronic
1099414666 12:82371528-82371550 CTGTCTGAGGGCCATGACTAAGG + Intronic
1099970215 12:89492661-89492683 CAGGATGAGGTGCAGGTGTATGG - Intronic
1099978358 12:89570199-89570221 CTGTCAGCGGGGCAGGGGGAGGG - Intergenic
1101655411 12:106715979-106716001 ATGTCTGAGAAGCAGGTGGATGG + Intronic
1102402837 12:112645566-112645588 CTTTTAGAGAGGCAGGTGTAGGG + Intronic
1102763287 12:115408290-115408312 GTTTCTGAGGGGAAGGTGGAAGG + Intergenic
1103627050 12:122227243-122227265 CTGTCTGATGAGCTGGTGTGGGG - Intronic
1104516936 12:129436069-129436091 CTGTCTGAAGTGCAGCTGTGAGG + Intronic
1106012215 13:25835820-25835842 CTGGCTGAGGGTGCGGTGTAAGG - Intronic
1106162782 13:27215649-27215671 CTGTCTGAGGGCCATGACTAAGG - Intergenic
1106501633 13:30334877-30334899 CTGTCAGAGGATCAGGGGTAGGG + Intergenic
1109118863 13:58427789-58427811 CTGTCTGGGGGGTGGGTCTAGGG + Intergenic
1113551420 13:111195848-111195870 CTGTCTGAGGGCCATGACTAAGG + Intronic
1115847556 14:37555472-37555494 CTGTCTGGGAGGGAGGTGTGGGG - Intergenic
1116247247 14:42431717-42431739 CTGTTGGAGGGGCAGCGGTAGGG - Intergenic
1116778857 14:49213235-49213257 CTGCCTGAGGGGCGGGGGTGGGG - Intergenic
1117472992 14:56065360-56065382 CTGTCAGCGGGGCAGGGGGAAGG + Intergenic
1119683987 14:76615665-76615687 CTGTCTTAGGGGCTGCTGTGAGG + Intergenic
1121576528 14:94993298-94993320 CTGACTGAGAGGCAGGTGTTTGG - Intergenic
1121587703 14:95074415-95074437 CTGTCTGTGGGGCATGAGTCTGG - Intergenic
1121667555 14:95684792-95684814 CTCCCTGATGGGCAGGTGTGTGG - Intergenic
1122352386 14:101103601-101103623 CTGTGTGTGGGGCATGTGGAAGG + Intergenic
1123147471 14:106146889-106146911 CTGTCTCAGGAGCAGGGGTGAGG + Intergenic
1125757075 15:42071354-42071376 GTGTCTGAGGGGAAGAAGTAAGG - Intronic
1125977828 15:43971353-43971375 CTCTCTGAGGGACAGGTTTATGG - Intronic
1126101243 15:45119503-45119525 CTGGCTGAGGGGCATGTGGCTGG + Intronic
1126198873 15:45962472-45962494 AGGTCTGAGGGGTAGGTGTGAGG + Intergenic
1126700204 15:51360224-51360246 CTGTCTGAGGGCCATGACTAAGG - Intronic
1128099723 15:64989168-64989190 CTGAGTGTGGGCCAGGTGTAAGG - Intronic
1128468079 15:67929398-67929420 CTGTGTGATGGTTAGGTGTATGG - Intergenic
1128496073 15:68199439-68199461 CAGTTTGAGGGGCAGGTGGCAGG - Intronic
1128803149 15:70509940-70509962 CTGTCTGAGAGGCATGTGACTGG - Intergenic
1129341665 15:74890338-74890360 CTGTCAGATGGGCAGCAGTAAGG - Intronic
1129890507 15:79068798-79068820 CTCTGTGAGGGTCAGGTGTGTGG + Intronic
1129952054 15:79600644-79600666 CAGTCTGAAGGGCAGGCGTGGGG - Intergenic
1130862921 15:87907495-87907517 CAGTCTTATGGGCAGGTGCATGG - Intronic
1130938374 15:88488759-88488781 CTCACTGAGGGGCTGGGGTAGGG - Intergenic
1131108606 15:89750675-89750697 CAGGCTGAGGGGCAGGGGCAGGG - Exonic
1132080544 15:98861266-98861288 TTATCTGAGAGGAAGGTGTAAGG - Intronic
1132463956 16:69073-69095 CTCTCTGAGGGGCAGGAGCTGGG + Intronic
1132563713 16:610824-610846 CTCTCAGAGGGACAGGTGTCAGG - Intronic
1135490017 16:22900951-22900973 CTGTCGCAGGAGCAGGTGAAGGG + Intronic
1135828135 16:25748452-25748474 CTCTCTGAGCTGCAGGTGTGGGG - Intronic
1135932416 16:26749669-26749691 CTGTGTGAGGGGCTGGAGAAGGG - Intergenic
1137387686 16:48056519-48056541 CTGTTTGAGGGACAGATGTCAGG + Intergenic
1137650386 16:50114842-50114864 CTGCCTAAGGGGCAGGAGTGTGG - Intergenic
1139798693 16:69503693-69503715 GTTTCTGAGGGTCAGGTGTTTGG - Intergenic
1139827109 16:69766116-69766138 CTGTCTGAGGGGCAGGTGTAGGG - Intronic
1140339979 16:74148317-74148339 CTGTGGGAGAGGCAGGTGGATGG - Intergenic
1141422193 16:83924572-83924594 CTGTCTGAGCAGCAGGAGTGAGG - Exonic
1141503488 16:84460431-84460453 CTGTCTGCGGGACAGATGGAGGG + Intronic
1141556686 16:84841176-84841198 CTGACTGAGAGGGAGGAGTAAGG + Intronic
1143366703 17:6413461-6413483 ATGTCTCTGTGGCAGGTGTAAGG - Intronic
1143993552 17:10987648-10987670 CTGACTGAGGCACAGGTGCAGGG + Intergenic
1144816980 17:18041152-18041174 CTTTCAGAGGGACAGGTGTTTGG - Intronic
1145090409 17:19981034-19981056 ATGTCTGTCGGGCAGGTATATGG + Intergenic
1146548075 17:33756296-33756318 CCATCTGAGGGGCTGGTGTTTGG - Intronic
1146619957 17:34389477-34389499 CTGGCTGAGGGGTGGGGGTAAGG + Intergenic
1146743248 17:35305094-35305116 CTGTCTGAGGGCCATGACTAAGG - Intergenic
1147262583 17:39217289-39217311 CTGTGTGAGGGGTAGGTGCTGGG - Intronic
1150656232 17:67041643-67041665 CTGGCTGCGGAGCAGGTGGAAGG - Intergenic
1152374268 17:79910876-79910898 CTGGCTGAGCGGGAGGTGTCAGG + Intergenic
1152656918 17:81524089-81524111 CTTTCTGAGGTGCTGGTGGACGG - Intergenic
1152797176 17:82314206-82314228 GTGAGTGAGGGGCAGGTGTGAGG + Intergenic
1203164888 17_GL000205v2_random:84722-84744 CTGGCTGGGGGGCAGATGTCTGG + Intergenic
1153680084 18:7492249-7492271 CTGTTTGAGGGTAAGGGGTAGGG + Intergenic
1153834347 18:8950694-8950716 GTTTCTGTGGGGCAGGTGTCTGG - Intergenic
1156550907 18:38015654-38015676 CTGTCTGGGGGTAAGGTGGAGGG - Intergenic
1157307524 18:46528108-46528130 CTGGCTGAGGGTCAGGTTTAAGG + Intronic
1157577372 18:48752604-48752626 CCACCTGAGGGGCAGTTGTAAGG - Intronic
1160507057 18:79433047-79433069 CTGACTGAGGGCCAGGAGGAGGG - Intronic
1161043276 19:2121375-2121397 CTGTCTCAGGAGCAGGTGTTGGG - Intronic
1161482880 19:4519529-4519551 CTGTCTCAGGGGCAGGTAGGAGG - Intergenic
1163456997 19:17412814-17412836 CTGTCTCAGGGTCTGGTGGAGGG + Intronic
1163551021 19:17966635-17966657 GTGTCTGGGAGCCAGGTGTAGGG - Intronic
1164177928 19:22793548-22793570 CTGTCAGAGGGGCAAGGGGAGGG - Intergenic
1164620949 19:29695750-29695772 CTGTCTGGGTGCCAGGTGTCTGG - Intergenic
1165137638 19:33679940-33679962 CTGAGTAAGGGGGAGGTGTAAGG + Intronic
1165348342 19:35262757-35262779 CTGTCCTGGGGGCAGGTGGATGG - Intronic
1165985366 19:39764056-39764078 CTGTCAGGGGGGCAGGGGAAGGG + Intergenic
1166270454 19:41710321-41710343 CTTTCTCAGGGTCAGGTTTACGG - Intronic
1166315715 19:41988374-41988396 CTGTCTGAGGAACAGGAGTTTGG + Exonic
1167676906 19:50892922-50892944 CTATCTGAGAGGCAGGAGTAGGG + Intergenic
925428728 2:3772825-3772847 CTGGCTTATGGGCAGGTGTTGGG + Intronic
927595283 2:24391277-24391299 CTTCCTGAGGGGCAGGTTTCAGG - Intergenic
927853174 2:26512622-26512644 CTGGCCCAGGGGCAGGTATAGGG - Intronic
927964726 2:27262074-27262096 CGCTCAGAGGGGCAGGTGGACGG + Intronic
928240136 2:29578881-29578903 TTGTCTGAAGGGCAGGTCCAGGG - Intronic
928388498 2:30889807-30889829 GAGTCTGAAGGGCAGGAGTATGG + Intergenic
928822578 2:35379724-35379746 ATATCTAAGGGGCAGGTTTAGGG - Intergenic
930038602 2:47103518-47103540 CTGTCTGAGGGCCATGACTAAGG - Intronic
930541470 2:52712215-52712237 CTGTGTGAGTGGTAGATGTATGG + Intergenic
931321553 2:61177968-61177990 CTGTGTTAGGGGCGGGGGTATGG + Exonic
931360211 2:61571554-61571576 CTTTGGGAGGGGCAGGTGTGAGG + Intergenic
931450298 2:62362634-62362656 CTGGCTGAGGGCCAGGTGATGGG + Intergenic
932018672 2:68060033-68060055 CTGTGGGAGGGGCAGGTTTGTGG - Intronic
932702414 2:74000966-74000988 CTGTATGGGGGGTAGGTGTGAGG + Intronic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933747820 2:85583773-85583795 CTGACTGAGGAGCAAGTGCATGG + Intergenic
933790015 2:85876251-85876273 CTCTTTCAGGGGCAGCTGTAGGG + Intronic
934165213 2:89288183-89288205 CTTTCTGAAGGGCAGGTGAAGGG + Intergenic
934202060 2:89894279-89894301 CTTTCTGAAGGGCAGGTGAAGGG - Intergenic
935961092 2:108426191-108426213 CTGTCAGTGGGGCAGGGGGAGGG + Intergenic
937049257 2:118875250-118875272 ATGTCTGAGGAGCAGTTGGAGGG - Intergenic
937407564 2:121644648-121644670 CCGTCTTGGGGGCCGGTGTAGGG + Intronic
937977513 2:127590651-127590673 CTGTCTGCAGGGCTGGTGAAAGG - Intronic
938277294 2:130037885-130037907 GGGGCTGAGGGGCAGGTGTTGGG - Intergenic
938438090 2:131299493-131299515 GGGGCTGAGGGGCAGGTGTTGGG + Intronic
942221310 2:173771655-173771677 CTGTCTGTAAGGCAGGTGTTTGG + Intergenic
943828589 2:192428565-192428587 ATGTCTGAGGGTGAGGTGTACGG + Intergenic
944804348 2:203266557-203266579 CTGGCTGAGGGGCACGTGCTGGG - Exonic
945520585 2:210822420-210822442 CTGTCAGAGGGGCATGGGGAGGG + Intergenic
947146997 2:227077488-227077510 CTGTCAGGGGGTCAGGGGTAAGG + Intronic
947880620 2:233507676-233507698 GTGACTGAGGGGGAGATGTAAGG + Intronic
1168823515 20:793268-793290 CTGTCTGAGGGGAAAGTTTGGGG - Intergenic
1169194503 20:3675909-3675931 GTGTGTGTGGGGCAGGGGTAGGG - Intronic
1169276200 20:4235246-4235268 GTAGCTGAGGGGCAGGTGAAGGG + Intronic
1171230110 20:23477384-23477406 GTGGCTGAGGCTCAGGTGTAAGG + Intergenic
1172527142 20:35606791-35606813 CTGTCTGAGGGTTAGGAATAGGG - Intergenic
1173326928 20:42042390-42042412 ATGTCTGAGGGACAGGTGACTGG - Intergenic
1174042981 20:47713034-47713056 CTGTCTGGGGGGCAGGGGTGGGG + Intronic
1175540763 20:59746267-59746289 CTGACTGGGGGGCAGTTGTCTGG - Intronic
1175658586 20:60793036-60793058 TTGTTTGAGAGGCAGGTGTCAGG - Intergenic
1175896777 20:62339957-62339979 CTGTCTGAGGCGTTGGTTTAAGG - Intronic
1176015273 20:62927648-62927670 CTGTATTAGGGGCAGCTTTACGG - Intronic
1176406861 21:6374365-6374387 CTGGCTGGGGGGCAGATGTCTGG - Intergenic
1180253083 21:46602599-46602621 CTGTCTAAGAGGCCGGTGGAAGG - Intronic
1180844225 22:18972692-18972714 CTGGCAGAGGGGCACGTGCAGGG + Intergenic
1180990507 22:19932957-19932979 CTGTCTGTGGGGCATCTGCAGGG - Intronic
1181057247 22:20266019-20266041 CTGGCAGAGGGGCACGTGCAGGG - Intronic
1181324926 22:22037328-22037350 CTCTCTAAAGGGGAGGTGTAGGG + Intergenic
1183453326 22:37907978-37908000 TTGTTTGAGGGGCAGGAGTGAGG + Intronic
1183749866 22:39713706-39713728 CTGTCTGAGGGGAAGAGGTGGGG + Intergenic
1184581089 22:45418272-45418294 CAGTCTGCGGGGAAGGTGAATGG + Intronic
1184777084 22:46628635-46628657 GTGTCTGAGGGGCAGGTGGAGGG + Intronic
1184900627 22:47444415-47444437 ATGTCTGATGGGCAGGTGGGTGG + Intergenic
1185384273 22:50524665-50524687 CTTGCTGAGGTGCAGGTGCAGGG - Intronic
950549968 3:13660280-13660302 CTGTGAAAGGGGCAGGTGTTGGG + Intergenic
950594312 3:13965338-13965360 CAGTCTGAGGGGCACCTGGAAGG + Intronic
951548118 3:23849504-23849526 CTGTCAGAGGGTGAGGGGTAAGG - Intronic
951628516 3:24693270-24693292 CTGTCTGGGGGGTGGGGGTAAGG - Intergenic
952973329 3:38671149-38671171 CTCTCTGAGGGGCAGCTCAAAGG - Intergenic
954878416 3:53818284-53818306 CTGTCTGAGGGGATGGTGTTTGG + Intronic
954909792 3:54094725-54094747 CTGCTTGAGGGCTAGGTGTATGG - Intergenic
955002232 3:54938121-54938143 GTGTCTGAGGGGCAGCAGAATGG + Intronic
956229441 3:66997977-66997999 CATTCTGAGGGGCTGGGGTAGGG - Intergenic
957675359 3:83357256-83357278 GGGTCTGAGGGGCAGGTGGGAGG + Intergenic
957843198 3:85698216-85698238 CTGTCAGAGGGGCTGGTCCAAGG + Intronic
957916464 3:86693734-86693756 CTGTCTGAGGGCCATGACTAAGG + Intergenic
959531592 3:107439993-107440015 CTGTATGAGGAGCAGGTTTGCGG + Intergenic
961397530 3:126606546-126606568 TTGGCTGTGGGGCAGGGGTAGGG - Intronic
961460160 3:127045119-127045141 CTGGCTCAGGTGCAGGTGGAGGG + Intergenic
962602107 3:137000265-137000287 CTGTGTGAGGTACAGGTGTGGGG - Intronic
963049295 3:141127927-141127949 CTGTGGGAGGGGCAGGGCTAAGG - Intronic
964089738 3:152860829-152860851 CTGTCTCAGGGGCAAGCATAAGG + Intergenic
964223385 3:154370353-154370375 CTGTCTGAGGGCCATGTCTAAGG - Intronic
964916902 3:161850744-161850766 CTGTCTGAGGGCCATGACTAAGG + Intergenic
965398410 3:168188768-168188790 CTGTCTTAGGAGCTGGGGTAAGG + Intergenic
965651836 3:170942428-170942450 CTGGGTGAGGGGGTGGTGTATGG + Intergenic
966263528 3:178009185-178009207 CTGTCGGAGGGGCCGGGGAAGGG + Intergenic
967707883 3:192673535-192673557 CTGTCAGGGGGGCAGGAGGAGGG - Intronic
967929613 3:194681311-194681333 CTTTCAGAGGGGCAGGTTGAAGG + Intergenic
967942568 3:194777451-194777473 CAGTCTGAGGGGCAGAGGAAAGG + Intergenic
968667817 4:1830754-1830776 CTGTTTGAGGCCCAGGTGCAGGG + Intronic
968728114 4:2257574-2257596 TTGTCCGAGGGGCAGATGGAGGG - Intronic
968870402 4:3239174-3239196 CTCTCAGAGGGGCCGGTGTATGG + Intronic
969509399 4:7609078-7609100 CTGCATGAGGGGCTGGTGAAGGG + Intronic
970323760 4:14901630-14901652 CTGTCTGTGGGGCAGGGGTTGGG + Intergenic
970929872 4:21496987-21497009 CTCTCTAAGGGGCATGTGGAGGG + Intronic
971511371 4:27429499-27429521 CAGTCTGAGGGGCGGGGGAAGGG - Intergenic
972238942 4:37167831-37167853 CTGTTGGAGGGGCAGGGGGATGG + Intergenic
973180208 4:47257537-47257559 CTGTGTGTGGGGTGGGTGTAGGG + Intronic
975000804 4:69222070-69222092 CTGTCTGAGGGCCATGACTAAGG + Intergenic
975004643 4:69270198-69270220 CTGTCTGAGGGCCATGACTAAGG - Intergenic
975013063 4:69379178-69379200 CTGTCTGAGGGCCATGACTAAGG - Intronic
975662471 4:76701165-76701187 CTGTCTGGGTGTCAGGGGTAGGG + Intronic
978838491 4:113182240-113182262 CTGTGTGAGGAGCAGGTTTGAGG + Intronic
981624332 4:146738695-146738717 CTCGCTGCGGGGCAGGTGAAAGG - Intronic
981742768 4:148020443-148020465 CTGTCAGCGGGGCAGGGGGAGGG - Intronic
984303246 4:177951622-177951644 GTGTGTGAGTGGCAGGTGTTGGG - Intronic
985266881 4:188159189-188159211 CTGTCGGTGGGGCAGGGGGAGGG - Intergenic
985511834 5:317899-317921 CAGGGTGAGGGGCAGGTGCAAGG - Intronic
985600339 5:825521-825543 CTGTCTTAGGCACTGGTGTAGGG - Intronic
985837877 5:2283739-2283761 CTGTCTGTGGGTCAGGTTTGGGG + Intergenic
986165617 5:5269416-5269438 ATGACCCAGGGGCAGGTGTAAGG - Intronic
990480118 5:56202138-56202160 CTGTCAGAGGGGGTGGTGTGGGG + Intronic
991468141 5:66936536-66936558 TTCTCTGACGGGCAGGAGTACGG + Intronic
992302346 5:75395970-75395992 CTGTCTGATGGGCAGATATTAGG - Intronic
992335388 5:75762831-75762853 CTGTCAGTGGGGCAGGAGGAGGG - Intergenic
993834593 5:92802262-92802284 CTATCTGAAGGGCTGGTGCAAGG + Intergenic
993909257 5:93661427-93661449 CTGTTTCAGGGACAGGAGTAAGG + Intronic
995583366 5:113622871-113622893 CTGTCTGAGGGCCATGACTAAGG + Intergenic
997691228 5:135828815-135828837 CTGTAGGAGGGGCAGCTGGAAGG - Intergenic
998596051 5:143531620-143531642 CTGTCTTGGGGGCAGGGGGATGG - Intergenic
998633290 5:143925138-143925160 TTCTCTGGCGGGCAGGTGTAGGG + Intergenic
999044572 5:148453202-148453224 GTTTCTGAGGGGCTGCTGTAAGG - Intronic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
999529460 5:152446409-152446431 CTGTCAGGGGGTGAGGTGTAAGG - Intergenic
999921985 5:156331321-156331343 CTGTCTGAGAGGCAGGTCAGAGG - Intronic
1000812013 5:165874757-165874779 CTGTGGGAGGAACAGGTGTAAGG + Intergenic
1001492850 5:172168012-172168034 CTGGCTGAGTGGCAGGTGTGAGG + Intronic
1002783905 6:386854-386876 CTCTCAGACGGGCAGGTGCATGG - Intergenic
1002898978 6:1394964-1394986 CTGGCTAAGTGGCAGGTGTGTGG - Exonic
1004179096 6:13365461-13365483 GTGTGTGAGGTGCAGGTGCACGG - Exonic
1004862853 6:19823310-19823332 CTGTGTGAGGAGCAGGTTTGGGG - Intergenic
1005378324 6:25207768-25207790 CTGTGGGAGGGGCAGCTGTGGGG + Intergenic
1006349265 6:33509148-33509170 CTGTGGGAGGAGCAGGTTTATGG - Intergenic
1006808783 6:36806444-36806466 CTCTCTGAGTGGGAGGTGGAGGG - Intronic
1006901983 6:37508563-37508585 CTGTGAGAGAGGCAAGTGTAAGG + Intergenic
1010269869 6:73906729-73906751 CTGTCTGAGGGCCATGACTAAGG - Intergenic
1010664652 6:78614404-78614426 CTGTCAGTGGGGCAGGGGGAGGG + Intergenic
1012492633 6:99799427-99799449 CTTTCTGAGGTCCAGGTGGAAGG + Intergenic
1013163634 6:107569986-107570008 CATTGTGAAGGGCAGGTGTAGGG + Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013780225 6:113720564-113720586 CTGTCGGAGGGGCATGAGTCAGG - Intergenic
1018426306 6:163685817-163685839 CAGTCTGAGGGGCAGATTAACGG + Intergenic
1018460504 6:163994354-163994376 CTGTCAGAGGGGCAAGGGAAGGG + Intergenic
1019064864 6:169288291-169288313 CTTTATGAGAGGCAGGTGGAAGG - Intergenic
1019726001 7:2603046-2603068 GTGTCTGTGGGGCAGGTCTAGGG - Intronic
1022185815 7:27967294-27967316 ATGTCTCAGGGGTAGGGGTATGG - Intronic
1026505741 7:70981057-70981079 CTGTCTTGGGGGCAGGAGCAGGG - Intergenic
1028887078 7:95946146-95946168 CTGTCAGGGGGGCAGGGGGAGGG + Intronic
1029010069 7:97250445-97250467 CTGTCAGAGGGGCAGGGGGAGGG - Intergenic
1030420553 7:109302132-109302154 CTGTCTGAGGGTCATGACTAAGG - Intergenic
1031468574 7:122143706-122143728 CTGGCTGAGGGGGCGGTGGATGG - Intronic
1031737798 7:125388665-125388687 CTGTGTGAAGGGCATGTGAATGG + Intergenic
1031952565 7:127907345-127907367 CTGTCTGTGGGACAGGTGTGAGG + Intronic
1032500620 7:132396998-132397020 CTGTCAGAGTGGCAGGTGTCTGG - Intronic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033118140 7:138644592-138644614 CTGTCTGAGAGGCAGGGCGATGG - Intronic
1033286752 7:140048044-140048066 CTCTCTGTGTGGCAGGTGGACGG + Intronic
1033611829 7:142970620-142970642 CTGTCAGAGGTGCTGGTGGAGGG + Intergenic
1034873075 7:154700909-154700931 CTGTCTGATGGGAAGGTCTCTGG - Intronic
1034931470 7:155167135-155167157 TTGGCTGAGGGGCTGGTGTCTGG - Intergenic
1035732564 8:1863179-1863201 CTTCCTGAGTGGCAGGTGTCAGG - Intronic
1036698691 8:10996624-10996646 ATATGTGAGGGGCAGGGGTAAGG + Intronic
1037188589 8:16094447-16094469 CTTTCTGTAGGGAAGGTGTAAGG + Intergenic
1038311715 8:26450059-26450081 CTGAGAGAGGGGCAGCTGTAGGG + Intronic
1039028747 8:33286574-33286596 CTCCATGAGGGGCAGGTGTCAGG + Intergenic
1039901151 8:41753421-41753443 CTGACTGAGGGGAAGGGGTCTGG - Intronic
1039990638 8:42484889-42484911 CTGTCTCAGGGCCAGCTGCATGG - Intronic
1040516123 8:48136532-48136554 ATGTCTGAGGGGCAAGGGGAGGG - Intergenic
1040617080 8:49047633-49047655 ATGGTTGAGTGGCAGGTGTACGG + Intergenic
1041480227 8:58311982-58312004 CTGTCAGGGGGTCAGGGGTAGGG - Intergenic
1041703222 8:60815445-60815467 CTGTTTGAGGGGCAGGGAGAGGG + Intronic
1043058389 8:75469110-75469132 AGGTCTGAGGTGCAGGTGGAAGG + Intronic
1043629247 8:82308081-82308103 CTGTTTAAGGAGCAAGTGTAGGG - Intergenic
1047523590 8:125614514-125614536 GTGTGTGAGGGTCAGGTGTGAGG + Intergenic
1047718012 8:127613569-127613591 CTGCCTCAGTGGCTGGTGTAGGG + Intergenic
1048091989 8:131251036-131251058 CTGCCTGGGGGTCAGGTGTCAGG - Intergenic
1049512894 8:143038736-143038758 CTGCCTGAGGAGCAGGTCTCGGG - Intergenic
1049541194 8:143209971-143209993 CTGACTGAGGGGCAAGTGTAGGG - Intergenic
1049680514 8:143915924-143915946 CTGTGTGAGTGGCAGGTAGAAGG + Exonic
1049718819 8:144106238-144106260 CTGGGTGAGGGTCAGGTGGAGGG + Exonic
1049854947 8:144855659-144855681 CTTTCTGGGGGGCAGGTGCAGGG + Intergenic
1052249489 9:26380636-26380658 TTCTCTGAGGGGGATGTGTATGG - Intergenic
1052720161 9:32164538-32164560 CTCTCTGGCGGGCAGGTGTGGGG + Intergenic
1054859277 9:69932489-69932511 CTGCCTGAGGGGAAGGGTTAGGG + Intergenic
1055424542 9:76180675-76180697 CTGTCTGGGGGACTGGAGTATGG - Intronic
1056600410 9:88042602-88042624 CTGCCTGAGGGGAAGGTTTAGGG + Intergenic
1056852190 9:90093994-90094016 CTTTCTGAGGGACAGATGAAAGG + Intergenic
1057571785 9:96209522-96209544 CTTTCTGAGGGTCAGGAGTTTGG - Intergenic
1058941128 9:109813641-109813663 CTGTCTGTGCTGCAGGTTTAGGG + Intronic
1058956141 9:109950502-109950524 CAGACAGAGGAGCAGGTGTAGGG - Intronic
1059244689 9:112839750-112839772 CTGTCTTTGGGACAGGTCTAGGG + Intronic
1061031364 9:128085535-128085557 CTGTCTTAGGTGCTGGTCTAGGG + Intronic
1203443598 Un_GL000219v1:33942-33964 CTGGCTGGGGGGCAGATGTCTGG + Intergenic
1203514406 Un_KI270741v1:152851-152873 CTGGCTGGGGGGCAGATGTCTGG + Intergenic
1185700387 X:2227088-2227110 CTGGCTGGGGTGCAGGTGCAGGG - Intronic
1189685924 X:43563504-43563526 CTGGATGAGGGGCAGGGTTAGGG - Intergenic
1189947361 X:46192899-46192921 GTGACTGAGAGGCAGGTATAAGG + Intergenic
1191658744 X:63629376-63629398 CTGCCTGAAGGACAGGTGAAGGG - Intergenic
1192068260 X:67909859-67909881 CTGTCTGAGGGAGAGGTGTGGGG + Intergenic
1192165164 X:68823496-68823518 TTGGCTGAGGGGCAGCTGGAGGG + Intergenic
1192269646 X:69566673-69566695 CTGGAGAAGGGGCAGGTGTAGGG + Intergenic
1192559133 X:72113922-72113944 CTGTATGAGGGGCTGGACTAGGG + Intergenic
1195098869 X:101533489-101533511 CTGACTGAGGTGCTGGTGTGAGG + Intergenic
1195271977 X:103241140-103241162 CTCTCTAAGGGGCAGATTTATGG - Intergenic
1195311557 X:103636518-103636540 ATGTCTGAGGGCCACATGTATGG + Intergenic
1195579566 X:106485685-106485707 AAGTCAGAGGGGCAGGTGTAGGG + Intergenic
1196214131 X:113030385-113030407 CTGTCAGTGGGGCAGATGGAGGG + Intergenic
1199668626 X:150121804-150121826 CTGTCAGAAGGGAAGGTCTAGGG - Intergenic
1200062381 X:153489313-153489335 CTGAAGGAGGGGCAGGTGCAGGG - Intronic
1200238841 X:154483157-154483179 CTCCCTGAGGGGCAGGTGGTGGG + Intergenic
1201640212 Y:16169861-16169883 CTGTCTGAGGGCCATGACTAAGG + Intergenic
1201662602 Y:16415464-16415486 CTGTCTGAGGGCCATGACTAAGG - Intergenic