ID: 1139834195

View in Genome Browser
Species Human (GRCh38)
Location 16:69825060-69825082
Sequence ACATAAAAGCTACAGATGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 252}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139834195_1139834197 30 Left 1139834195 16:69825060-69825082 CCTTGCATCTGTAGCTTTTATGT 0: 1
1: 0
2: 1
3: 13
4: 252
Right 1139834197 16:69825113-69825135 CATACAAAGTTTTTCAAAGTGGG 0: 1
1: 0
2: 0
3: 27
4: 307
1139834195_1139834196 29 Left 1139834195 16:69825060-69825082 CCTTGCATCTGTAGCTTTTATGT 0: 1
1: 0
2: 1
3: 13
4: 252
Right 1139834196 16:69825112-69825134 TCATACAAAGTTTTTCAAAGTGG 0: 1
1: 0
2: 1
3: 27
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139834195 Original CRISPR ACATAAAAGCTACAGATGCA AGG (reversed) Intronic
900185191 1:1329877-1329899 ACACAAATGCCACACATGCATGG - Intergenic
901824177 1:11849779-11849801 ACAAAAAAGCTACAGCCCCAGGG - Intergenic
903092951 1:20939128-20939150 AAAAAAAAGCTAGAGTTGCAGGG + Intronic
904867343 1:33590956-33590978 AAATAAAAGCTTCAAATGAAAGG - Intronic
905127056 1:35723056-35723078 AAAAAAAAGCTCCAAATGCAGGG + Intronic
907590450 1:55662300-55662322 ACATATATGCTACATATACATGG + Intergenic
908524680 1:64976322-64976344 ACATAAAATCTCAAAATGCATGG - Intergenic
909316205 1:74222962-74222984 ACATAATAGCTACATATCTATGG + Intronic
909652151 1:77987557-77987579 ACATATAAAATAAAGATGCATGG - Intronic
909774916 1:79471832-79471854 ACATAAAAGGTCAAGATGAAGGG + Intergenic
910010002 1:82450188-82450210 ACACAGAACCAACAGATGCATGG - Intergenic
910163334 1:84297910-84297932 AGAGAAAAGCTAAAGATGCAGGG - Intergenic
910725965 1:90339243-90339265 TCATCAAAGCCACATATGCAAGG - Intergenic
910818294 1:91316403-91316425 AAATAGAAGAGACAGATGCAAGG - Exonic
912462563 1:109846054-109846076 TCATTAAAGCTATAGATCCAAGG + Intergenic
912589334 1:110799050-110799072 TCATAAAAGTTAAAGAGGCAGGG + Intergenic
914384488 1:147154704-147154726 ACTTAAAAAATACAGATGCCTGG + Intergenic
917803126 1:178588309-178588331 ACATAATAACTACATATTCATGG + Intergenic
920741064 1:208581777-208581799 TCACAAAAGCTGCAGCTGCAAGG - Intergenic
921691573 1:218157124-218157146 ATATAAAACCTAAAGATGTAAGG + Intergenic
1065282179 10:24150752-24150774 ACACAGAAGCTAGAGATGCTGGG - Intronic
1068377680 10:56205553-56205575 CAATAAAACCTACAGATGCGTGG + Intergenic
1069377471 10:67808290-67808312 ACAGAAAATCTATATATGCATGG + Intronic
1069875936 10:71562845-71562867 ACACAAAAGCCACAGTTACAGGG - Intronic
1070691932 10:78533401-78533423 AAATAAAAGGAACAGATGCAGGG - Intergenic
1071872750 10:89813491-89813513 ACAGAACAGCTACTGATTCAGGG - Intergenic
1071982777 10:91020514-91020536 ACATGAAGGCTAGAGCTGCAAGG + Intergenic
1072205429 10:93200176-93200198 ACCTAACAACTAAAGATGCAGGG + Intergenic
1073392556 10:103191889-103191911 AAATAAAAACTCCACATGCAGGG - Intronic
1073722657 10:106191067-106191089 ATTTAAAAGATACAGATGCTTGG + Intergenic
1073970677 10:109043195-109043217 ACATAAAAGATCAAGCTGCAGGG - Intergenic
1078296909 11:10080651-10080673 ACTTAAAAGATACAGATTCGTGG + Intronic
1078632396 11:13014898-13014920 ACAGAAACTCTACAGAAGCAGGG + Intergenic
1079849899 11:25518711-25518733 ACATAAAAGCTAAGAATGCTTGG - Intergenic
1081229460 11:40566786-40566808 GCATAACAGCCTCAGATGCATGG + Intronic
1081550939 11:44111810-44111832 ACACAATATTTACAGATGCAAGG - Intronic
1082600901 11:55152417-55152439 ACATAAAAGCTAGACACGGACGG - Intergenic
1082666933 11:55986243-55986265 ACATAAAAAGTACACATTCAAGG + Intergenic
1082818592 11:57528010-57528032 ACACAAAAGTGACAGGTGCAGGG + Intergenic
1084558154 11:69887305-69887327 TGATAAAAGCTCCAGATGCTGGG - Intergenic
1084602650 11:70155327-70155349 ACATGAAAGCAACAGAGGCATGG + Intronic
1084644772 11:70449569-70449591 ACATGAAAGGTACAGAGGCCAGG + Intergenic
1086981138 11:93198547-93198569 ACATTAACGCTAAAGATGAAGGG + Intergenic
1088235450 11:107718462-107718484 ACATCAAAGCTACTCATACATGG + Intronic
1089100255 11:115957095-115957117 ACATAAAAGCAAAAAATGGATGG + Intergenic
1089524904 11:119090522-119090544 ACGTAAACTCTACATATGCAGGG - Intronic
1092750798 12:11717555-11717577 ACATGACAGCTAGAGATGGACGG - Intronic
1093934132 12:24983294-24983316 ACAGAAAAGCTATAGAGGTAGGG - Intergenic
1094064607 12:26349943-26349965 ATAAAAAAGCTACAGCTGGAAGG + Intronic
1095106552 12:38240460-38240482 CCATAAAAGGGACAAATGCAAGG - Intergenic
1096003003 12:48144996-48145018 ACATAAAAATTACAGAGGGAAGG - Intronic
1098298402 12:69028168-69028190 AAAGAAAACCTAGAGATGCATGG - Intergenic
1098860088 12:75699513-75699535 AGATAAAAAATACAGAAGCAAGG + Intergenic
1100014476 12:89992469-89992491 ACAGAAAAGAAACAGATACAGGG + Intergenic
1101852395 12:108414394-108414416 AGAGAGAAGCTACAGCTGCATGG - Intergenic
1102418501 12:112785237-112785259 AAAAAAAAGATACAGCTGCATGG + Intronic
1103190159 12:118994248-118994270 ACATAAATGCTATAGAGCCAAGG - Intronic
1103589865 12:121984048-121984070 ACAGAAAAGACGCAGATGCAGGG + Intronic
1104535951 12:129618156-129618178 ATATAAATGTTACAGATGCGAGG + Intronic
1104574468 12:129954213-129954235 CCTTAAAAGCTACTCATGCATGG + Intergenic
1104680473 12:130747756-130747778 ACATAGAAGCCAGAGATGTATGG - Intergenic
1105426401 13:20298439-20298461 ACGTAAAAGCTACTGGTGCAGGG - Intergenic
1105844798 13:24284994-24285016 AAAAAAAAGCTAAAGCTGCAGGG - Intronic
1107312872 13:39098569-39098591 ACATAGTGGATACAGATGCAAGG - Intergenic
1108339370 13:49482395-49482417 ACATAAAAGCTACAATTTTATGG + Intronic
1108708945 13:53014896-53014918 ACAAAAAAGCCACACTTGCAAGG - Intergenic
1109102418 13:58202006-58202028 ACAGAGAAGCTAGTGATGCAAGG - Intergenic
1109279405 13:60338837-60338859 ACAAAATAGTTACAGATGCTAGG - Intergenic
1110500192 13:76218644-76218666 ACATAGAAGATGCAGATGCTGGG - Intergenic
1110603680 13:77406039-77406061 ATAAAAATGCTACAGCTGCATGG + Intergenic
1110708041 13:78617676-78617698 ACAGAAAAGCTTCAGATCAAGGG - Intronic
1111005656 13:82244572-82244594 AGATAAAGGCTACAGATCAAAGG + Intergenic
1111394652 13:87649430-87649452 ACATAAAGCCTATAGATACATGG - Intergenic
1116210758 14:41940121-41940143 ACATAAAAGATTCAGATGGAAGG - Intergenic
1116310653 14:43322209-43322231 ACATAAAATCAACACATGTATGG + Intergenic
1116584092 14:46680173-46680195 ACTTAAAAGATACAGCTGCCGGG + Intergenic
1119061344 14:71477979-71478001 GTATAAAAGTTTCAGATGCATGG + Intronic
1119399473 14:74352533-74352555 ACAAAAAAGCTACATTTGAAAGG - Intronic
1120605811 14:86576596-86576618 AAATAAAGGCTACATATGTAGGG - Intergenic
1124472740 15:30002700-30002722 ACATTAAAGTTTCAGATGCAGGG - Intergenic
1124499664 15:30216326-30216348 ACATAAAACCTTCAATTGCAAGG + Intergenic
1124743915 15:32322341-32322363 ACATAAAACCTTCAATTGCAAGG - Intergenic
1125665568 15:41427517-41427539 AAATAAAAGCTACATAAGCTGGG + Intronic
1127347755 15:58117861-58117883 ACATAAAAGTCACAGAGTCAAGG + Intronic
1127612784 15:60653243-60653265 ACATATGAGCCACAGATACAAGG + Intronic
1128552912 15:68609722-68609744 GCATGAAAGCTACTGATGGAAGG + Intronic
1131807693 15:96140017-96140039 ACATAACAGAGACAGATGAAAGG - Intergenic
1134436757 16:14266497-14266519 ACATAAAGGCAATAGATGAATGG - Exonic
1135251991 16:20908083-20908105 ACATAAAAGCCACCAGTGCAGGG - Intronic
1139074262 16:63424495-63424517 ATGTAAAAGTAACAGATGCATGG - Intergenic
1139834195 16:69825060-69825082 ACATAAAAGCTACAGATGCAAGG - Intronic
1140508354 16:75488913-75488935 ACATAAAACATAAAGATGGAAGG + Intronic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1142123468 16:88398627-88398649 ACATATGAGCCACAGATGAAGGG + Intergenic
1143896499 17:10140883-10140905 ATACAAATGCTAAAGATGCAGGG + Intronic
1144315874 17:14060664-14060686 AAAAAAAAGATACAAATGCAGGG + Intergenic
1147576312 17:41601702-41601724 AGATAAAAGCTAGAGACGTATGG + Intergenic
1148600968 17:48893827-48893849 TCTTAAAAGATACAGATGCCTGG - Intronic
1150472786 17:65451339-65451361 ACATAAATGCCACAGAAGCAGGG + Intergenic
1150767919 17:68016953-68016975 ACAGAAAAGCTGCAAATGTAGGG + Intergenic
1151478997 17:74359334-74359356 ACAAAAAAACTACAGTTTCACGG - Intronic
1153108979 18:1560917-1560939 ACATCAAAGTTACACATGAATGG - Intergenic
1153603500 18:6807123-6807145 ACACAAAAACCACAGATTCAAGG - Intronic
1154935313 18:21048880-21048902 ATATAAATTCTACAGAAGCATGG + Intronic
1157356328 18:46938244-46938266 ACATAAATGCTATATATTCATGG + Intronic
1160456319 18:79004498-79004520 ACATAAAAGTAATAAATGCATGG + Intergenic
1161028928 19:2049107-2049129 TCAGCAAAGCTACAGATGGACGG + Intronic
1162709361 19:12580239-12580261 ACAGAAAAGCTACGAATGTATGG - Exonic
1163270167 19:16248320-16248342 ACAGGGAAGCTACAGATGGAGGG + Intergenic
1164185885 19:22869263-22869285 ACATAAAAAATAAAGATGTAGGG - Intergenic
1167313000 19:48747987-48748009 CCAAAAAAGCTACAGAGACACGG + Intergenic
1168126054 19:54283724-54283746 ATAGAAAAGTTACAGGTGCAAGG - Intergenic
924974576 2:160911-160933 CCATAGAAGCTACAACTGCAAGG - Intergenic
927229300 2:20804168-20804190 ACAGACAAGCAACTGATGCAAGG + Intronic
929544226 2:42845244-42845266 ACACATTAGTTACAGATGCAGGG - Intergenic
930249378 2:49018391-49018413 ACATAAAAGCTAATGAAACAGGG - Intronic
932236104 2:70122263-70122285 ACATGAAAGCTAAAAAAGCAAGG - Intergenic
932636857 2:73397101-73397123 AGATAAAACTTACAGAAGCATGG + Intronic
933149770 2:78900430-78900452 ACATGAAAGCTTCAAATTCACGG + Intergenic
934945910 2:98541515-98541537 ACATAAAAACTGAAGATACATGG - Intronic
935849860 2:107206619-107206641 ACAAAAAAGTTAGAAATGCAAGG - Intergenic
935901075 2:107794240-107794262 AAAGACAAGCTACAGATGTAGGG + Intergenic
937601617 2:123743088-123743110 AAATAAAAGCTACATATAGAAGG + Intergenic
939228901 2:139400672-139400694 AAATGAATGCTACAGATTCATGG - Intergenic
940253596 2:151706260-151706282 ACATAAAATCCACAAATGCTAGG + Intronic
941086061 2:161119904-161119926 CAAGAAAAGCCACAGATGCATGG - Intergenic
941431613 2:165421030-165421052 AAAAAAAAGATACAGATGTAGGG - Intergenic
943327572 2:186520255-186520277 ACATAAAAGCAACATATTTAGGG - Intergenic
944566570 2:200997539-200997561 ACCTAAAAACAACAAATGCAAGG + Exonic
944886345 2:204066275-204066297 AGATAAATGCTATAAATGCAAGG + Intergenic
945840836 2:214886223-214886245 ACATAAAAGGTACAGCTTGAGGG + Intergenic
947376951 2:229505575-229505597 ACAGGAGAGCTACAGATTCAAGG + Intronic
1172522321 20:35576095-35576117 ACACAAAACCTACAGAAGGAAGG - Intergenic
1173425166 20:42936335-42936357 AGACAGAAGCTGCAGATGCAAGG + Intronic
1174668066 20:52278987-52279009 ACATAGAAGATACAAATTCAGGG - Intergenic
1177160470 21:17541603-17541625 AAAAAAAATCAACAGATGCAGGG - Intronic
1178696379 21:34796427-34796449 ACAGAAGAGCTACAGCTGGATGG - Intronic
1179216785 21:39374357-39374379 ATATAAAAGCCACCGATGAAGGG + Intergenic
1181435233 22:22906583-22906605 CCACAAAAGCTACAGCTGCCAGG + Intergenic
1182067379 22:27440291-27440313 ACAGAAAAGTTAAAGATGAAAGG + Intergenic
950820440 3:15752547-15752569 AAATAAAAGCAGCACATGCATGG + Intronic
950850619 3:16058996-16059018 CCATAAAAAGTACAGATGAAGGG + Intergenic
951546827 3:23834455-23834477 ACAGAAAAGCTACAGAGTAATGG - Intronic
952936494 3:38402472-38402494 ACAGAAAAATTACAGATGCTTGG - Intronic
954253809 3:49389644-49389666 AAATAAAAGTTACAGAAGCCGGG + Intronic
955430510 3:58839470-58839492 ACATAAAAGCTTCTGAGTCAAGG + Intronic
957411933 3:79852441-79852463 GCAGAAAAGCTAGAGATGGAGGG + Intergenic
957482420 3:80815996-80816018 AGAGAAAAGGTACAGATGCTGGG + Intergenic
958094585 3:88927248-88927270 ACCTAAAACCAACAGATGTAAGG + Intergenic
958152675 3:89710882-89710904 ACATTAAATCTAGAGAAGCATGG - Intergenic
958542842 3:95501519-95501541 ACATAAAAATTACAGATAGAGGG + Intergenic
962357707 3:134709064-134709086 AGATGAAAGGTACAGATGAAAGG + Intronic
964504855 3:157388126-157388148 ACATCAAAGATACACTTGCAAGG + Intronic
964878920 3:161401683-161401705 GCGTCAAAGCTCCAGATGCAGGG - Intergenic
966168554 3:177050515-177050537 AGATAAAAACTTCAGATTCATGG + Exonic
967051794 3:185791818-185791840 ACAAAAATGCTACAGTTCCAGGG + Intronic
969806189 4:9610889-9610911 TCAGAAAAGCCACAGAAGCAGGG + Intergenic
970161297 4:13192144-13192166 ACAGAAAAACTACACATGCTTGG + Intergenic
971049764 4:22848523-22848545 ACATAAAAGGTACAGGTCCAAGG - Intergenic
974176389 4:58331156-58331178 ACATAAAAGAATCAGTTGCAAGG - Intergenic
974583405 4:63836829-63836851 ACATATAAGCTACAGTAGTATGG + Intergenic
974635204 4:64555150-64555172 AAATAAAAACTACAGATTAAAGG + Intergenic
975491757 4:74996689-74996711 ACATAAAAACTACAGAGCAAAGG - Intronic
975492688 4:75005915-75005937 ACATGAAAGGGACAGATTCAGGG - Intronic
976162731 4:82220646-82220668 AAATAGCAGCTACAAATGCAAGG + Intergenic
976222403 4:82767771-82767793 ACTTAAAAACTAAAGATACATGG + Intronic
976381914 4:84408968-84408990 CCATAAAAGCTACAGAAGTAAGG + Intergenic
976869137 4:89769322-89769344 AGATAAAAGGTACAGAGGAATGG - Intronic
977658177 4:99548619-99548641 ACATAAAAGCTGCAAATAGAGGG + Exonic
978939675 4:114421238-114421260 ACATCACAGCTACACGTGCAGGG - Intergenic
978996211 4:115156769-115156791 ACATAAAATCACCAAATGCATGG - Intergenic
980486399 4:133462456-133462478 ACATAAGAGCTGCAGCAGCATGG + Intergenic
981573689 4:146180022-146180044 ACGTAAAATCTACATAGGCAAGG - Intronic
982113365 4:152076164-152076186 TGATAAAAGCTACAGATACCAGG + Intergenic
982668790 4:158296430-158296452 ACATAAAACCTGCAGATTTATGG + Intergenic
984503128 4:180581361-180581383 AGGAAAAAGCTAAAGATGCAAGG + Intergenic
984631876 4:182069815-182069837 ACACTAAGGCTACAGATGAAGGG + Intergenic
986039804 5:3982067-3982089 AGATAAAAGCTTCAAATGCCCGG - Intergenic
986122101 5:4849641-4849663 ACATAAAATCAACTGAGGCATGG - Intergenic
986126521 5:4887088-4887110 ACAGAAATGCTCCAGATGAAGGG - Intergenic
986164250 5:5259745-5259767 ACAAGAAAGCTGCAGATACAAGG - Intronic
987587617 5:19876656-19876678 ACATAAAAGTTAAAGATTCCTGG - Intronic
989206477 5:38814323-38814345 ATAAAAAAGCTACAGATGGCTGG + Intergenic
990681221 5:58246492-58246514 CCAACATAGCTACAGATGCAAGG - Intergenic
991396128 5:66207132-66207154 TCACAAAAGATACAGATGAATGG + Intergenic
991676142 5:69091584-69091606 GCATAAAACCTACAGATGTGGGG - Intergenic
992037813 5:72798298-72798320 ACAGAAAAGGCAGAGATGCAGGG + Intergenic
992313628 5:75529474-75529496 ACATAAAAACCATGGATGCATGG + Intronic
993313360 5:86366989-86367011 AGGTAAAAGCTAGAAATGCATGG + Intergenic
993958976 5:94273045-94273067 ACACAAATGCCACAGCTGCAAGG - Intronic
994728916 5:103469157-103469179 AGATTACAGCCACAGATGCAAGG - Intergenic
997170063 5:131709487-131709509 ACATAATATCTAAAGAAGCAAGG + Intronic
997945353 5:138195916-138195938 ACATAAAAGCAAAAGAAGCCAGG + Intronic
998106477 5:139472184-139472206 AGAAAAAAGAAACAGATGCAGGG - Intergenic
998988832 5:147792487-147792509 ATATAAAATCTCCATATGCATGG - Intergenic
1003270883 6:4606867-4606889 ACAGAAAGATTACAGATGCATGG - Intergenic
1004735743 6:18404762-18404784 ATATAAAAGATTCAGATGAAAGG + Intronic
1005532892 6:26725335-26725357 ACATAAAAGCAAAAATTGCAAGG + Intergenic
1005537903 6:26776329-26776351 ACATAAAAGCAAAAATTGCAAGG - Intergenic
1007579184 6:42945865-42945887 ACATTAAAGCTATAGAGGCCAGG - Intergenic
1008395554 6:51002691-51002713 CCTTGAAAGCTACAGATGTAAGG + Intergenic
1009611404 6:65946359-65946381 AAATAAAAGCTACCAATGTAAGG - Intergenic
1010309686 6:74370416-74370438 ACACCAAAGATACACATGCACGG + Intergenic
1011882462 6:92046909-92046931 ACATAAAAGCAACACAGTCAAGG - Intergenic
1012013591 6:93825477-93825499 ATATAAAAGCTTCATATACAAGG - Intergenic
1013147192 6:107405550-107405572 ACTTAAAAGATACAGAGGCCGGG + Intronic
1013182369 6:107728997-107729019 GCGTAAAAGTGACAGATGCATGG + Intronic
1013962635 6:115918788-115918810 ACACAGAAGCAACAGATGGAAGG + Intergenic
1015286540 6:131491632-131491654 ACAGAATAGCTACAGATAGATGG - Intergenic
1015463265 6:133517803-133517825 ACCTAAAAGAAACAGATGGAAGG + Intronic
1017110612 6:150928837-150928859 ACAAAAAAGCTACAGAAGCTGGG - Intronic
1021484612 7:21154048-21154070 AGAGAAAAGCTGCAGATTCATGG + Intergenic
1021980438 7:26048996-26049018 CCATAGAAGAAACAGATGCATGG + Intergenic
1022034106 7:26517724-26517746 ACAGATAAGCTCCAGTTGCAGGG - Intergenic
1022616642 7:31937837-31937859 ACATGAAAACTACACATTCAAGG + Intronic
1023010274 7:35919598-35919620 ATATAAAAGCTAGCCATGCATGG - Intergenic
1024286792 7:47764774-47764796 ACATTAATGCTACAGATGAATGG + Intronic
1024339377 7:48241971-48241993 CCATAAAAGCTACAGGAGGATGG + Intronic
1029507779 7:100972804-100972826 GAAGAAAAGCTACAGATGCTGGG - Intronic
1029804209 7:102979294-102979316 TCATAAAAGCTGGAGATGCTAGG + Intronic
1031163526 7:118198516-118198538 ATATAAAAGCTTCCCATGCATGG + Intergenic
1031879414 7:127179049-127179071 ACTTAAAAGATACAGAACCACGG + Intronic
1032373483 7:131384375-131384397 ACAGAAAAGACACAGATACAGGG + Intronic
1034288496 7:149907750-149907772 ACATTAAAGCAAAAGGTGCAAGG + Intergenic
1034662576 7:152785117-152785139 ACATTAAAGCAAAAGGTGCAAGG - Intronic
1035077206 7:156188335-156188357 ACATAAAACCTAGATGTGCAAGG + Intergenic
1036519159 8:9474543-9474565 ATAAAAAACCTACAGAGGCACGG - Intergenic
1037436435 8:18868636-18868658 ACAAAAAGGCAACAGAAGCAAGG + Intronic
1039572462 8:38598691-38598713 GCATAAAAGATACAAATGAAGGG - Intergenic
1042504060 8:69540771-69540793 ACATAAAATCCACAAATGGAAGG + Intronic
1044514443 8:93121887-93121909 ACATCAAAGCTACAGATAACAGG - Intergenic
1045093124 8:98767831-98767853 ACATCAAAGTTAGAGAAGCAAGG + Intronic
1046845022 8:118905961-118905983 ACTTAAAAGGTACTGAGGCATGG + Intergenic
1046859760 8:119077121-119077143 ACATAAAATGTACAAAGGCAAGG + Intronic
1048515988 8:135112027-135112049 AAATAAAAGTTACTGATGCATGG - Intergenic
1049929901 9:446236-446258 GCAGAAAAGCTACAGATGCAGGG - Intronic
1050633559 9:7585705-7585727 AAAAAAAAACAACAGATGCATGG - Intergenic
1050858201 9:10389134-10389156 ACATAACAGCTGCTGAAGCAAGG - Intronic
1051614109 9:18991100-18991122 ACACAAAAACTAGACATGCAAGG + Intronic
1051851454 9:21514046-21514068 ACATAAAAATTTCAGATTCAAGG + Intergenic
1052522209 9:29562865-29562887 ACATAAAAGCTACCAAGGCTTGG - Intergenic
1055543252 9:77337858-77337880 ACATAAAATCTTAAGATGTATGG - Intronic
1056005426 9:82264805-82264827 AAATAAAATCTTCACATGCATGG - Intergenic
1056640287 9:88364470-88364492 ACAAAAAACCTACAGCTGCCAGG + Intergenic
1056687041 9:88775439-88775461 ACAAGAAAGCTGCAGATGCCTGG - Intergenic
1056846344 9:90041058-90041080 ACATTAAAGTTACAGTTGAATGG - Intergenic
1056905207 9:90641460-90641482 AAATAAAAGATACAGTGGCAAGG - Intronic
1057717584 9:97506803-97506825 ACATTAAAGTTAGAGAAGCACGG - Intronic
1058128084 9:101219654-101219676 TCATAATACCTAAAGATGCAGGG + Intronic
1058168759 9:101652627-101652649 GCATGAAAACTACAGCTGCAGGG - Intronic
1058394196 9:104531084-104531106 ATATAAAAGGTACAGTTTCATGG + Intergenic
1058625317 9:106928007-106928029 AGCCAAAACCTACAGATGCAGGG + Exonic
1061715238 9:132514721-132514743 ACATAAAAGCTAATGACGCCGGG - Intronic
1185832427 X:3314952-3314974 ACATAAGAGATAAAGATGGATGG + Intronic
1186676920 X:11827765-11827787 CCAAAAGAGCTACAGATGCATGG + Intergenic
1187108102 X:16266088-16266110 ACATAGAAGCAAGATATGCATGG + Intergenic
1189653919 X:43221033-43221055 TAATAAAATCTACAGATGCTTGG + Intergenic
1192019924 X:67377274-67377296 CCATAAAAGCTTCAACTGCAGGG - Intergenic
1192871967 X:75193349-75193371 ACAGAAAAGCTACAAAGGGAAGG - Intergenic
1194877729 X:99209784-99209806 CCATAATAGTAACAGATGCAAGG + Intergenic
1198170311 X:134098696-134098718 AAATACAAGCTACAGAAACAAGG + Intergenic
1198793688 X:140373472-140373494 ACATTAAAGCCACTTATGCAGGG + Intergenic
1199505973 X:148561968-148561990 TCATAATAGCTCCACATGCAAGG - Intronic
1199818440 X:151421029-151421051 AAATAAAAGTGGCAGATGCAGGG - Intergenic
1199981863 X:152925476-152925498 AAATAAAGGCTAGAGATTCAGGG + Intronic
1200209165 X:154338526-154338548 ACAAAAAATCCACAGGTGCAGGG + Intergenic
1200221711 X:154393603-154393625 ACAAAAAATCCACAGGTGCAGGG - Intronic