ID: 1139836329

View in Genome Browser
Species Human (GRCh38)
Location 16:69841568-69841590
Sequence CTTGAGAAACAGCTATTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 212}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139836325_1139836329 11 Left 1139836325 16:69841534-69841556 CCTTGAAACATTTGGTAGGGATT 0: 1
1: 0
2: 2
3: 11
4: 159
Right 1139836329 16:69841568-69841590 CTTGAGAAACAGCTATTGAAGGG 0: 1
1: 0
2: 1
3: 18
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139836329 Original CRISPR CTTGAGAAACAGCTATTGAA GGG Intronic
900615585 1:3564335-3564357 CTGGACAAACAGCTACTGGAGGG + Intronic
902135186 1:14299062-14299084 CTCAATAAACAGCTGTTGAATGG - Intergenic
902220265 1:14960132-14960154 CTTGGGAAACAGCCATAGAAAGG - Intronic
902579752 1:17401034-17401056 GTTGAGAAACAGCCATTGTAGGG + Intronic
902898550 1:19496882-19496904 CTTGAGAAAAATCTAGTGAAAGG + Intergenic
904352547 1:29918246-29918268 CTTGAGAAAGAGCACGTGAACGG + Intergenic
904819318 1:33230768-33230790 CTTGAGAAGCAGCCATTGTTTGG - Intergenic
905338084 1:37259094-37259116 ATGGAGAAGGAGCTATTGAAGGG + Intergenic
906070332 1:43011655-43011677 CTAGAGAGACAGCTATGGTAGGG - Intergenic
906230932 1:44163399-44163421 AGTGAGAAATAACTATTGAAAGG - Intergenic
910430333 1:87153642-87153664 CTTGATAACCAGCTGTTGAATGG + Intronic
910902615 1:92137972-92137994 CTTGAGAAACATGTATTGTTTGG + Intronic
911410809 1:97504156-97504178 CCTGAGAGACAGCTTTTAAAAGG + Intronic
915725299 1:158013106-158013128 TTTTAGAAAAAGCTATGGAAGGG - Intronic
916740958 1:167646727-167646749 CTTGAGAAAGAGCTCTGGAAAGG - Intronic
917593673 1:176504954-176504976 CTTAAGTAACTGCTATTGGAAGG + Intronic
918813761 1:189156085-189156107 ATTGAGAAACAGGTAGTGAAGGG + Intergenic
919197268 1:194302111-194302133 CTTGAGAAACAGCAGTTTGAGGG + Intergenic
919672609 1:200351396-200351418 CTTCAGAAACACCCATAGAAAGG - Intergenic
922308650 1:224367227-224367249 CTTAAAAAACAGCCAATGAATGG - Intronic
923140120 1:231154692-231154714 GTTGAGAATCAGCCATTCAACGG + Intergenic
923197466 1:231682346-231682368 CTTGAAAAACAGCAAGTGCAGGG - Intronic
923852058 1:237806927-237806949 CTTGAAAAATAGCAAGTGAACGG - Intronic
1064603752 10:17017609-17017631 CTTCAGGAATAGCTATTGATAGG + Intronic
1066798353 10:39152504-39152526 TTTGAGAAACTGCTATGTAAAGG + Intergenic
1068282130 10:54886816-54886838 CTTGGAAAACAGATTTTGAAAGG + Intronic
1068623447 10:59211808-59211830 CTTTAGTAAAAGCTAATGAAAGG + Intronic
1071170752 10:82860935-82860957 TTTGAGAAATAGCCAGTGAAGGG + Intronic
1071393846 10:85202121-85202143 CTTGATAAACACATATTGATAGG - Intergenic
1072271171 10:93778655-93778677 ATTGAGAAATAGCTGTTGAAAGG - Intronic
1079740391 11:24051596-24051618 CTTGTGAAGCAGATACTGAAAGG - Intergenic
1080079579 11:28200230-28200252 TTTGAGGTACAGCTAATGAATGG - Intronic
1080562858 11:33479787-33479809 ATTGAGAAACAGATTTTAAAAGG + Intergenic
1082209367 11:49479438-49479460 CTTGAGAAACATCTACGTAAGGG - Intergenic
1083432682 11:62622387-62622409 ATTGAGCAACAGCTATTGGGTGG - Intergenic
1083654448 11:64222718-64222740 CTTGGGAAACAACTAATCAAAGG - Intronic
1086455081 11:86953333-86953355 TTGGAGAAACAGCTTTTGCAGGG - Intronic
1086640255 11:89145785-89145807 CTTGAGAAACATCTACATAAGGG + Intergenic
1089661054 11:119985510-119985532 TTAGAGAAACAGAGATTGAAGGG - Intergenic
1089721375 11:120426523-120426545 GTTTAGAAACAGCTAAAGAAAGG + Intronic
1090284325 11:125486212-125486234 CTGAAGAAACAGCCATTGCATGG + Intronic
1091238331 11:134036474-134036496 CTTGAGTACCAGCTGTAGAAGGG + Intergenic
1092043679 12:5408659-5408681 CTTGACAAACAGATAGTGAGGGG - Intergenic
1093154218 12:15661412-15661434 ATTGAGAAACAAATACTGAAAGG - Intronic
1095502777 12:42858956-42858978 CTTGCTAAACAGCAGTTGAATGG + Intergenic
1095578553 12:43767696-43767718 ATTGAGAAACATAAATTGAAAGG + Intronic
1099264909 12:80433455-80433477 TTTGAAAAACAGCTATTATATGG - Intronic
1102940202 12:116934281-116934303 CTCGAGGGACAACTATTGAAAGG - Intronic
1105419269 13:20238358-20238380 TTTGAGAAGTAGCTGTTGAATGG + Intergenic
1105830246 13:24157719-24157741 CTTGAGAAACCCCTGCTGAATGG + Intronic
1106184210 13:27394709-27394731 CGTGAGAACCAGCTGTTAAAGGG - Intergenic
1106374007 13:29166170-29166192 CTAGAGAAATAGATATTGCAAGG - Intronic
1107181448 13:37465359-37465381 CTTGAGAAACATCTTATGACAGG + Intergenic
1109264046 13:60176303-60176325 GGTGAGAAACAGTTATAGAATGG - Intergenic
1112269068 13:97951714-97951736 ATTCAGAATCAGCGATTGAATGG - Intergenic
1112580519 13:100673885-100673907 CTTGAGAAACAGTTATAGTAGGG - Intronic
1113518339 13:110920100-110920122 CATGGGAAACAGCTTTGGAAAGG - Intergenic
1113732095 13:112648907-112648929 CTTGAGAAATATGAATTGAATGG - Intronic
1116086434 14:40244532-40244554 ATTGAGAAATATCTATTAAATGG - Intergenic
1119174265 14:72557609-72557631 CTTGAGCACCATCTATTCAAAGG + Intronic
1119485383 14:74983464-74983486 CTTGAAAAACAGGTTATGAATGG + Intergenic
1119529566 14:75350274-75350296 CTTGAGGAAGAGCTTATGAAGGG + Intergenic
1120431525 14:84422809-84422831 ATTGAGACACAGCCATTTAAAGG - Intergenic
1127075821 15:55324399-55324421 CTGGAGAAACTGCTAATGACTGG + Intronic
1127485567 15:59414702-59414724 CTTGAAAAACAGCAAATGCAAGG - Intronic
1128890601 15:71328483-71328505 CTTGATAAATATATATTGAATGG - Intronic
1129532354 15:76278633-76278655 TTTAGGAAACAGCTAATGAAAGG - Intronic
1129545596 15:76391688-76391710 CTTGAGAAACAGCTGTTCATTGG - Intronic
1129648147 15:77457281-77457303 CTGGTGAAACAGCAATTAAAAGG - Intronic
1136569673 16:31089080-31089102 TCTGAGAAACAGTTGTTGAATGG + Intronic
1138748393 16:59390035-59390057 TTTGTGAAACAGCTATTTAGGGG - Intergenic
1139056136 16:63186933-63186955 CTTGATAAACTTCTAGTGAAAGG + Intergenic
1139057405 16:63201883-63201905 CTTGAGAAACAGATATAAATAGG - Intergenic
1139415305 16:66803104-66803126 CTTGAGCAGCAGCTCCTGAAAGG + Exonic
1139836329 16:69841568-69841590 CTTGAGAAACAGCTATTGAAGGG + Intronic
1140230695 16:73114987-73115009 CTTGAGGAATCGCTATAGAAGGG - Intergenic
1140760714 16:78106237-78106259 CTTGAGACACAGCTCTGCAAGGG + Intronic
1143753970 17:9052921-9052943 TTTCAGAAGCAGCTATTGAGAGG - Intronic
1143811963 17:9479099-9479121 CTTGGTAAACACCTGTTGAATGG + Intronic
1144284935 17:13764696-13764718 CTTGAGAAACTGCTCTAGAGCGG - Intergenic
1147808632 17:43150567-43150589 CTTGAGAAACAGCTAATTAGAGG - Intergenic
1148506367 17:48130653-48130675 CTTGGAAAACAGGTATAGAAGGG + Intergenic
1149253814 17:54801415-54801437 TTTTAAAAACAGCTATTGAAAGG + Intergenic
1149283353 17:55132508-55132530 CTTTAGAAAAAGATGTTGAAAGG - Intronic
1151333383 17:73424394-73424416 CTTGCAAAACAGCCAGTGAAAGG + Intronic
1156047148 18:32889651-32889673 CTTAAGAGATAGTTATTGAATGG + Intergenic
1158073397 18:53499936-53499958 CCTGAGAAATGACTATTGAAAGG - Intronic
1158418023 18:57267011-57267033 CTTGACAAACATCTATTGAAGGG + Intergenic
1165987068 19:39778737-39778759 CTAAATAAACAGATATTGAATGG + Intronic
1166443546 19:42838032-42838054 CTTGAGAAACAGAAGCTGAACGG - Intronic
1166463237 19:43008694-43008716 CTTGAGAAACAGAAGCTGAATGG - Intronic
1166469381 19:43065252-43065274 CTTGAGAAACAGAAGCTGAACGG - Intronic
1166480511 19:43168790-43168812 CTTGAGAAACAGAAGCTGAATGG - Intronic
1166807006 19:45493362-45493384 CTCCAGGAACAGCTATGGAATGG - Exonic
1167002635 19:46755314-46755336 ATTGAGAAAGAGCTGTAGAAAGG + Intronic
929230188 2:39551286-39551308 CTTTAAAAACTGCTATTGTATGG + Intergenic
930057794 2:47265269-47265291 CTTGGGAAGGAGCTATTAAAAGG + Intergenic
931002524 2:57803265-57803287 CTTGTGAAACAAATTTTGAAAGG + Intergenic
931222498 2:60300503-60300525 CTTGAGAAATGGATTTTGAATGG - Intergenic
931687307 2:64805580-64805602 CTCCACAAACAGCTATTAAATGG + Intergenic
935115408 2:100131291-100131313 CTTGAGAAACCTATATTAAAAGG - Intronic
935257663 2:101326592-101326614 CTTTAAAAAAATCTATTGAAAGG + Intergenic
937796782 2:126032437-126032459 ATTGAGAAAAACCTATAGAAAGG + Intergenic
938141588 2:128799083-128799105 CTTGAGGCACAACTACTGAAAGG - Intergenic
938553362 2:132401066-132401088 CTTGTGAAACACCTACTGTAGGG - Intergenic
939039512 2:137171003-137171025 CATGAGAATGATCTATTGAAGGG - Intronic
939166678 2:138648200-138648222 TTTGAGAAACTGTCATTGAAGGG + Intergenic
940974288 2:159926185-159926207 CTTGAGAAAGATCTACTAAAAGG - Intergenic
943851758 2:192732280-192732302 CTTGAGTAACAGCCTTTCAAGGG - Intergenic
944510863 2:200464596-200464618 CTTGAAAAGCAGCTAGTAAAGGG - Intronic
946538809 2:220661179-220661201 GTTGAGAAACAGCAAGAGAAAGG - Intergenic
1169796646 20:9469778-9469800 CTTTAGACACAGCTGGTGAAGGG + Intronic
1172024547 20:31938993-31939015 CCTGGGAAACAGCCAATGAATGG + Intronic
1173554629 20:43956843-43956865 CTTAAGAAACAAATATGGAAGGG - Intronic
1173876756 20:46377469-46377491 CTAGAGAAACAGCTAGAAAAAGG - Intronic
1178621039 21:34176269-34176291 AGTGAGACACACCTATTGAATGG + Intergenic
1180195626 21:46191894-46191916 CTTGAGAAACAGCTCCCCAATGG - Exonic
1182987258 22:34731997-34732019 CTTTAGAAAGAGCTATTGCTTGG + Intergenic
1184109859 22:42388366-42388388 CTTAATAAACTGCTGTTGAATGG + Intronic
950437846 3:12991489-12991511 CGTGAGAAACACCTCTTGATAGG + Intronic
952594712 3:35001999-35002021 GTTGAGAAAAAAATATTGAAAGG - Intergenic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
953420868 3:42752171-42752193 CTTTAGAAACCGCTCTGGAATGG + Intronic
953502522 3:43451446-43451468 CTTGAGAATCAACACTTGAAAGG - Intronic
954564293 3:51585795-51585817 CTGGAGAACTAGCTATTTAAAGG - Intronic
956568968 3:70672736-70672758 CTTGAGAGAGAGCTTTTGGAAGG + Intergenic
957286212 3:78220792-78220814 CTTGATAAATATCTATTAAATGG - Intergenic
957530991 3:81440661-81440683 CTGGAGAAAGAGGAATTGAAAGG + Intergenic
959197412 3:103202309-103202331 ATTGAGAAATAGCTATTGTCAGG - Intergenic
960718865 3:120605459-120605481 TGTGAGAAACAGCAATTCAAAGG + Intergenic
963380093 3:144518418-144518440 CTGGAGAAAAAGATATTGCAAGG + Intergenic
963680593 3:148370871-148370893 TTTGAAAAACAGCAAATGAAAGG + Intergenic
965427218 3:168541807-168541829 CTTGAGAAAGAGTGATTGAAGGG + Intergenic
965599003 3:170436752-170436774 TTTGAGAAACAGCAAATAAAAGG + Intronic
967450729 3:189619764-189619786 CTGGAAAAACATCTATTGGAGGG - Intergenic
971062144 4:22984277-22984299 CATGTGAAAGAACTATTGAAAGG + Intergenic
971458214 4:26864461-26864483 CCTGAGAAATAGCTTATGAAAGG + Intronic
972774291 4:42227177-42227199 CTAAAGGAACAGCTATTAAAGGG + Intergenic
973031480 4:45347078-45347100 CTTGAGAAAAAGCTTTGAAAAGG - Intergenic
973143554 4:46797427-46797449 CTTGAGAAATAACTATAGGATGG - Intronic
975903823 4:79186062-79186084 CTTGAGAAACATCTTGTTAAAGG + Intergenic
976314386 4:83643680-83643702 CTTCAGAATTATCTATTGAAGGG + Intergenic
976577434 4:86690376-86690398 CTTGAGAAGAAACTATTTAAAGG + Intronic
976859267 4:89643468-89643490 CTTCAGAAACTGCATTTGAAAGG + Intergenic
979409193 4:120353860-120353882 CTTGAGAAACAGACATAGGAAGG - Intergenic
979476051 4:121158471-121158493 CTTGAGCAATAGCTAAAGAAAGG - Intronic
979792223 4:124799545-124799567 CTTTATAAAAAGCTATTCAATGG + Intergenic
980439431 4:132820491-132820513 CTTTAGAATCAGCTAGTGCAGGG - Intergenic
981890672 4:149732531-149732553 CTGGAGAAACAGCAATTAAAAGG - Intergenic
984521045 4:180801294-180801316 CTTGAGAAACAGCAGCTGGAAGG + Intergenic
984782788 4:183540997-183541019 CTTTAGAAACAGATTTTTAAAGG + Intergenic
987663523 5:20907121-20907143 ATTGAGAAACTGCTGTTGAAGGG + Intergenic
987761524 5:22169039-22169061 CTAGAGAAACAGAGATTGGATGG - Intronic
988207720 5:28161704-28161726 CTTTTTAAACAGCTATCGAATGG - Intergenic
988759160 5:34295066-34295088 ATTGAGAAACTGCTGTTGAAGGG - Intergenic
989018904 5:36976349-36976371 AGAGAGAATCAGCTATTGAAAGG + Exonic
989256269 5:39368925-39368947 AGTAAGAAACAGCTATGGAATGG - Intronic
989547680 5:42693603-42693625 CCTGAGAAACAGCTATAAGAAGG + Intronic
990580661 5:57164471-57164493 CTTGACAAATATTTATTGAATGG + Intergenic
990649717 5:57884596-57884618 CCTGAGAAACAGGTATGGATTGG + Intergenic
990749158 5:58994105-58994127 CTTGAAAAACAACTTTTAAAAGG - Intronic
991375701 5:65964701-65964723 ATTGAGAAAGAGCTATAGAGAGG - Intronic
991896312 5:71402506-71402528 CTAGAGAAACAGAGATTGGATGG - Intergenic
992017662 5:72592342-72592364 CTAGAGAAAGAGCTATAGAGGGG + Intergenic
993862643 5:93155208-93155230 CTTGATAAATATCTATTAAATGG - Intergenic
995846568 5:116500194-116500216 CTTGGGCAACAGCTATTACAAGG + Intronic
996882509 5:128315857-128315879 CTTCAGAATCAGCAAGTGAAAGG - Intronic
997836538 5:137198437-137198459 CTGGATAAACAGCTATCAAAGGG + Intronic
998415527 5:141943634-141943656 CTTGATGAATAGCTGTTGAATGG - Exonic
998499775 5:142622160-142622182 TTTGATAAACATCTGTTGAATGG + Intronic
999884802 5:155910289-155910311 TTTGAAAATCAGCTATTGAAAGG + Intronic
1000123861 5:158224618-158224640 CTTAATAAACAATTATTGAATGG + Intergenic
1001011354 5:168101606-168101628 CTTGTGAAACAAATATTGAGTGG + Intronic
1004407280 6:15345495-15345517 ATTGAGAAAGAGCTTTTGATAGG + Intronic
1008396948 6:51019843-51019865 TGGGTGAAACAGCTATTGAAAGG - Intergenic
1011416628 6:87126932-87126954 ATTGAGAAAGAGATATTGAGAGG + Intergenic
1011480034 6:87784643-87784665 CTTGGGGAACTGTTATTGAAAGG + Intergenic
1012102267 6:95104911-95104933 GTGGTGAAACAGCCATTGAAGGG - Intergenic
1012955295 6:105563492-105563514 ATGGAAAAACTGCTATTGAAGGG + Intergenic
1013570883 6:111424371-111424393 ATGGAGGAACAGATATTGAAAGG - Intronic
1016074063 6:139775518-139775540 GTTGAGTAACAGGGATTGAAAGG + Intergenic
1017357746 6:153529642-153529664 CTTAAGAAAAAGGTATTCAAAGG + Intergenic
1017722308 6:157252418-157252440 CTGAAGAAACTGCTAATGAAGGG + Intergenic
1018303862 6:162432831-162432853 CTTGTTAAACAGATTTTGAATGG + Intronic
1020683923 7:11270294-11270316 CTTTTGAGACAGCTATTCAAAGG + Intergenic
1020712189 7:11621433-11621455 CTGGAGAAATAGTTATTAAAGGG - Intronic
1021160021 7:17261715-17261737 CTTCATAAAAATCTATTGAATGG + Intergenic
1021972435 7:25979210-25979232 TTTGAGAAACAGCTACCCAAGGG + Intergenic
1022059598 7:26779217-26779239 TTTTATAAACAGCTATTTAATGG - Intronic
1022640687 7:32179731-32179753 CTTGATAAACTGCTAGTAAAAGG + Intronic
1023454473 7:40323266-40323288 TTTGAGAAACACCAAGTGAATGG - Intronic
1023558512 7:41448227-41448249 GTTGAGAAAGAGCTATTTCAAGG - Intergenic
1025713069 7:63929806-63929828 CTGGAGAAACTGCAAATGAATGG + Intergenic
1025866265 7:65384451-65384473 CCTGAGCAACAGCTCTAGAAAGG - Intronic
1026425257 7:70285319-70285341 CTTGAGGAACAAATACTGAAGGG - Intronic
1026527133 7:71163917-71163939 CTTGTAAAACAGCTACTAAAAGG - Intronic
1027566478 7:79801065-79801087 CTAGAAAAACATCTATTGATGGG - Intergenic
1027847154 7:83395022-83395044 CTTAACAAACAGCTTTTCAAAGG - Intronic
1027901738 7:84124728-84124750 TTTTAGAAATAGCTATTGGATGG - Intronic
1034918858 7:155062369-155062391 CTGGAGAAAGAGCTAGGGAAGGG + Intergenic
1035816929 8:2551285-2551307 GTTTAAAAACAGTTATTGAAAGG + Intergenic
1037044611 8:14282794-14282816 CTAGAAAAACAAATATTGAAAGG - Intronic
1037617169 8:20529988-20530010 CTTGAGCAACTGCTATTGCCAGG - Intergenic
1041042345 8:53860096-53860118 TTTTAGAAACATCTATAGAATGG + Intronic
1041121171 8:54587730-54587752 CTTGAGAATGAGCTACTGACAGG + Intergenic
1041168739 8:55118668-55118690 TTTGAGAAGCATCTTTTGAACGG - Intronic
1041204949 8:55489365-55489387 ATTGACAAACAGTTTTTGAAAGG - Intronic
1042913032 8:73846089-73846111 CTTACGAAACAGCTCTTGGATGG + Intronic
1045093129 8:98767913-98767935 CTTGAGGAAAAGGTAATGAAAGG - Intronic
1046179340 8:110622860-110622882 CTTGAATAACAACTATTTAATGG + Intergenic
1047896986 8:129377300-129377322 ATTGAGAACCACCTATTGAGAGG + Intergenic
1048460401 8:134616538-134616560 ATTGAAAAACACCTATTGAAAGG - Intronic
1051619926 9:19040230-19040252 GTTAAGAAACAGCAAATGAATGG + Intronic
1051742654 9:20266498-20266520 CTTGAAAAGCAGTTATCGAAGGG - Intergenic
1052187054 9:25611216-25611238 CTAAAGAAAGAGCTATAGAAGGG + Intergenic
1057165723 9:92923865-92923887 TTTGGGAAACAGCCATGGAAAGG + Intergenic
1058627386 9:106949301-106949323 TTTAAGAAATATCTATTGAATGG - Intronic
1059646861 9:116276571-116276593 TTTGTCAAACAGCTATTTAAAGG + Intronic
1060424474 9:123493120-123493142 CTTGAGGATCAGCTCTTGCAAGG - Intronic
1186377825 X:9026185-9026207 CTTGTGTAACTGCTATGGAAGGG + Intronic
1187159854 X:16754212-16754234 CTTGAGAAACAGCAAGTGATTGG + Intronic
1187597779 X:20793128-20793150 CATGAGAAACATCTTTTTAAAGG + Intergenic
1189781271 X:44516376-44516398 CTTGAGAATTCTCTATTGAATGG + Intergenic
1190255274 X:48757804-48757826 TTTGAGAAACAGCTCTTGGCTGG + Intergenic
1190443437 X:50498813-50498835 CTAGGGAAATAGCTATTTAAAGG - Intergenic
1190575948 X:51838341-51838363 CTTCACAAATGGCTATTGAATGG - Intronic
1192859447 X:75050687-75050709 CTTGAAAAGCAGTTATTGTAGGG - Intergenic
1192995847 X:76512506-76512528 CTTGATAAACTGCTCTTGAGAGG + Intergenic
1194545075 X:95224382-95224404 TTTGAGAATTAGCTATGGAAGGG + Intergenic
1194883270 X:99281104-99281126 ATTGAGAAGCAGCTATTAAGTGG + Intergenic
1197657174 X:129129184-129129206 CTTAAGAGACTGCTTTTGAATGG + Intergenic
1199395331 X:147330627-147330649 CTGGACAAACAGTTATTGGAGGG - Intergenic