ID: 1139836826

View in Genome Browser
Species Human (GRCh38)
Location 16:69845751-69845773
Sequence AAGAATAATCAGATGAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 598
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 565}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139836824_1139836826 8 Left 1139836824 16:69845720-69845742 CCATTTCTTAGTGGGATCTTGCC 0: 1
1: 0
2: 1
3: 10
4: 114
Right 1139836826 16:69845751-69845773 AAGAATAATCAGATGAAGCCTGG 0: 1
1: 0
2: 3
3: 29
4: 565

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139836826 Original CRISPR AAGAATAATCAGATGAAGCC TGG Intronic
901048805 1:6415869-6415891 AGGGATAATCAGTTGAACCCAGG - Exonic
901338424 1:8471902-8471924 CAGAAGAATCACATGAATCCGGG - Intronic
901832933 1:11904832-11904854 AAAAATAAACAAATTAAGCCTGG + Intergenic
901989210 1:13098810-13098832 AAGAAGAATCACTTGAATCCCGG + Intergenic
901992603 1:13127954-13127976 AAGAAGAATCACTTGAATCCCGG - Intergenic
902342121 1:15790704-15790726 AAGAAGAATCATTTGAACCCAGG + Intergenic
902594668 1:17500920-17500942 AAGAATAATCCTAAGAGGCCAGG + Intergenic
902811748 1:18891933-18891955 CAGAAGAATCACATGAACCCGGG + Intronic
902909979 1:19588661-19588683 CAGAAGAATCACATGAACCCAGG - Intergenic
902941787 1:19805378-19805400 CAGAAGAATCAGTTGAACCCAGG - Intergenic
903098956 1:21010325-21010347 CAGAAGAATCAGTTGAACCCAGG + Intronic
903443168 1:23403461-23403483 AATAATACTCATATGAAACCTGG - Intronic
903562638 1:24239685-24239707 ATGAATTATCAGATGAAGAGGGG + Intergenic
903606257 1:24577043-24577065 AAGAAGCATCACATGAATCCAGG + Intronic
905618608 1:39420369-39420391 AAGAAAAATCAGATAGAGGCAGG - Intronic
906097653 1:43235115-43235137 CAGAAAAATCAGATGAGGCGTGG - Intronic
906349333 1:45044290-45044312 AAGAAAAAACTGATGAGGCCAGG + Intronic
906491940 1:46275288-46275310 AGGAATAATTAGACGAAGCGGGG - Intronic
906754700 1:48299419-48299441 AAGAAGAATCACTTGAAACCGGG + Intronic
907239435 1:53072967-53072989 CAGAAGAATCACATGAACCCGGG + Intronic
907728516 1:57043549-57043571 AAAAAATATCAGATGAGGCCGGG + Intronic
908242882 1:62202774-62202796 CAGGAGAATCAGTTGAAGCCAGG - Intronic
908350719 1:63284630-63284652 AAGAAAAATAAAATGAGGCCGGG - Intergenic
908459624 1:64336790-64336812 GAGAAAAATCATAGGAAGCCAGG + Intergenic
908459904 1:64339196-64339218 GAGAAAAATCATAGGAAGCCAGG + Intergenic
908872451 1:68629490-68629512 AAGAATAATTAGGTAAAGCAGGG - Intergenic
908953500 1:69591752-69591774 AACAAGAATCAGATGAAGCAAGG + Intronic
910753451 1:90659599-90659621 AAGAACAATCACTTAAAGCCAGG - Intergenic
912677905 1:111702658-111702680 AAGAAGAATCACTTGAACCCGGG - Intronic
913303859 1:117402521-117402543 AAGAATAAACAGATCAAAACAGG - Intronic
913944162 1:125141961-125141983 CAGAATAATCACTTGAACCCAGG - Intergenic
916475648 1:165166116-165166138 AAGAAGAATCACTTGAACCCGGG + Intergenic
917345812 1:174027109-174027131 AAAAAAAATCAGAGGAGGCCAGG - Intergenic
918284207 1:183036189-183036211 CAGAAGAATCACTTGAAGCCGGG - Intronic
918505616 1:185250753-185250775 AAGAACAATCACTTGAACCCGGG - Intronic
919722627 1:200855687-200855709 CAGAAGAATCACTTGAAGCCAGG - Intronic
919791834 1:201296249-201296271 ACATATAATCAGATGAAACCTGG + Intronic
920057930 1:203206206-203206228 AATAATAAACTGATGAGGCCAGG - Intergenic
920129310 1:203719411-203719433 AAGTATAATCAAATGCAGTCTGG + Intronic
920222064 1:204411401-204411423 AAGAAAAAGGAGATGGAGCCGGG - Exonic
921201629 1:212811793-212811815 AAGAAGAATCACTTGAACCCGGG - Intronic
921423529 1:214976125-214976147 AAGAATGACAAGTTGAAGCCAGG + Intergenic
922160204 1:223074193-223074215 AAGAAGAATCACTTGAACCCGGG - Intergenic
922297120 1:224260550-224260572 AATAATTATCAGATGAAGGCTGG - Intronic
922587996 1:226750371-226750393 AAGAATTAACTGATGAGGCCGGG - Intergenic
922976017 1:229784014-229784036 AAGAAAAATAAGATAAAGCCAGG - Intergenic
923969305 1:239181692-239181714 AAGGAGAATCAGTTGAACCCGGG + Intergenic
924314462 1:242781659-242781681 CAGAATCACCAGACGAAGCCAGG + Intergenic
1064060895 10:12136398-12136420 AAGAAGAATCACTTGAACCCAGG - Intronic
1064066489 10:12186598-12186620 AAGAAAAATCTGATGAAGAAGGG - Intronic
1064271906 10:13872889-13872911 AAGGATAGTTAGATGGAGCCTGG + Intronic
1064310898 10:14210818-14210840 CAGAAGAATCACATGAACCCTGG - Intronic
1065629025 10:27658925-27658947 AAGAATTATCAGAGGAGGCCGGG - Intergenic
1065874992 10:29989897-29989919 CAGAAGAATCAGTTGAACCCAGG - Intergenic
1066591688 10:37001648-37001670 AGGTATAATAAGATGAGGCCAGG - Intergenic
1066665099 10:37775063-37775085 AAGAATAAACAAAAGAGGCCAGG - Intergenic
1066951529 10:42122701-42122723 CAGAAGAATCACTTGAAGCCGGG + Intergenic
1067122301 10:43483959-43483981 CAGAAGAATCACTTGAAGCCAGG - Intergenic
1067124037 10:43500168-43500190 AAAAATATAAAGATGAAGCCAGG - Intergenic
1068004886 10:51381162-51381184 CAGAATAATCAGTTGAACCCAGG + Intronic
1068187743 10:53608322-53608344 AAGAATAAACTGATGATACCAGG - Intergenic
1069131735 10:64712810-64712832 TATAAAAATCAGATGGAGCCAGG + Intergenic
1070364914 10:75727175-75727197 AAGAAAAATCAGGTGAAGGATGG - Intronic
1071661817 10:87511664-87511686 AAAAAGCATCAGATGAAGACAGG - Intronic
1071749030 10:88453779-88453801 AAGAAAACTCAGATCAAACCAGG - Intronic
1072254657 10:93609802-93609824 AAGAATGAACAAATGAGGCCAGG + Intergenic
1072516297 10:96186488-96186510 CAGAAGAATCAGTTGAACCCAGG - Intronic
1072853200 10:98918992-98919014 AAGAAAAATAAGATACAGCCTGG + Intronic
1072941697 10:99770157-99770179 AAGAAGAATCACTTGAACCCAGG - Intergenic
1073359019 10:102882337-102882359 CAAAAAAATCAGAAGAAGCCAGG - Intronic
1073763384 10:106655148-106655170 AATAAATATCAGATGAGGCCAGG - Intronic
1074148281 10:110736476-110736498 AAGAAAATTCAGATGAAAACAGG - Intronic
1074505884 10:114070039-114070061 AAAAATAATAAGACAAAGCCAGG - Intergenic
1076041507 10:127253576-127253598 AAGAATAATACAATGGAGCCAGG + Intronic
1078213780 11:9293875-9293897 AAAAAGAATCAGAAGTAGCCAGG - Intronic
1078540435 11:12209006-12209028 AAAAAAAATCAGGTGAAGCCTGG - Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1079417781 11:20255651-20255673 GAGCATCATAAGATGAAGCCAGG + Intergenic
1080636447 11:34128058-34128080 AAGAAAAATCACCTGTAGCCAGG + Intronic
1081193702 11:40135705-40135727 AAGAATAATCTGAAAAAGCACGG + Intronic
1081680119 11:44996427-44996449 CAGAAGAATCACATGAACCCAGG + Intergenic
1083563822 11:63696410-63696432 AAGAATATTGTGATGAAGCCAGG + Intronic
1084733210 11:71087922-71087944 AAAAATAGTCAAATGCAGCCAGG - Intronic
1084759343 11:71259066-71259088 CAGAAGAATCACATGAACCCAGG - Intergenic
1085320515 11:75571242-75571264 CAGAATAATCAGATGCAGGGGGG - Intronic
1086232861 11:84591566-84591588 AAGGATAATCACTTGAACCCGGG + Intronic
1086647448 11:89242298-89242320 AAGAAGAATCACTTGAACCCGGG - Intronic
1087537968 11:99475958-99475980 AGCAAAGATCAGATGAAGCCTGG - Intronic
1087650740 11:100864275-100864297 CAGGAGAATCACATGAAGCCGGG - Intronic
1087864462 11:103207012-103207034 CAGAAGAATCGCATGAAGCCAGG - Intronic
1088429727 11:109745705-109745727 AAGTGCAATCAGATGAAGCCAGG - Intergenic
1090027998 11:123184185-123184207 CAGAATAATCACTTGAACCCGGG - Intronic
1090092368 11:123709723-123709745 AAGAAGCATCAGAGGAGGCCAGG - Intergenic
1090909480 11:131105911-131105933 CAGAAGAATCACATGAACCCGGG + Intergenic
1093094066 12:14952672-14952694 AAGACTAATCAGATGAGACAGGG + Intronic
1093109344 12:15130427-15130449 AAAAGTTAACAGATGAAGCCAGG + Intronic
1093979750 12:25463292-25463314 AAGACAAACCAGGTGAAGCCTGG - Intronic
1094535100 12:31314196-31314218 AAGAAAAATCAGATCCAGCCTGG + Intronic
1095977046 12:47946910-47946932 AAGAAGAAGCTGATGAAACCAGG + Intergenic
1096149468 12:49299564-49299586 AAGAAGAAGAAGAAGAAGCCCGG + Intergenic
1096973925 12:55687784-55687806 AAGATAAATCAGATGCAGGCTGG - Intronic
1097960888 12:65531032-65531054 CAGAAGAATCAGTTGAACCCAGG + Intergenic
1098742802 12:74195667-74195689 AAGAATAACCAAAACAAGCCTGG + Intergenic
1099290852 12:80774838-80774860 AAGGAGAATCATATGAACCCAGG - Intergenic
1099350836 12:81566429-81566451 CAGAAGAATCACTTGAAGCCGGG + Intronic
1099412512 12:82348584-82348606 AAGGAGAATCATATGAACCCAGG + Intronic
1099569543 12:84298442-84298464 AAGAAACATCACAGGAAGCCGGG - Intergenic
1099614167 12:84913207-84913229 GAGAATATTCAGATGGTGCCAGG - Intronic
1099656932 12:85505259-85505281 TAGAAGAATCACTTGAAGCCAGG + Intergenic
1100070945 12:90716964-90716986 AACAATAATCACTTGAACCCAGG + Intergenic
1100566061 12:95795179-95795201 AGGAATGAGCAGCTGAAGCCAGG - Intergenic
1100868941 12:98890031-98890053 ATGAATGATCAGAAGAAGACAGG + Intronic
1100969754 12:100055582-100055604 CAGGATAATCAGTTGAACCCAGG + Intronic
1101483634 12:105129036-105129058 AAGGAAAATCACATGAACCCAGG - Intronic
1101858107 12:108461012-108461034 AAGAAAAATCAGATGAGACATGG + Intergenic
1102282307 12:111627977-111627999 AATAATAAGAAGAAGAAGCCAGG - Intergenic
1102910633 12:116711236-116711258 AAGAATAGTGAGATGTGGCCAGG + Exonic
1103031439 12:117616858-117616880 AAGAATAAAAAGATGAATCATGG - Intronic
1103459879 12:121095442-121095464 AAGCATATTCAGATAAAGCTGGG + Intergenic
1103534106 12:121622977-121622999 CAGAATAATCGGTTGAACCCAGG + Intergenic
1103600205 12:122050067-122050089 CAGAAGAATCAGTTGAACCCGGG - Intronic
1104427351 12:128688717-128688739 AATAATAACCAGAAGAAACCTGG + Intronic
1104756114 12:131270331-131270353 CAGCATCATCAGATGAAGGCAGG + Intergenic
1104777662 12:131400694-131400716 CAGCATCATCAGATGAAGGCAGG - Intergenic
1105496154 13:20932762-20932784 AAGGATAATCACTTGAACCCAGG - Intergenic
1106060734 13:26288850-26288872 CAGGAGAATCAGATGAACCCAGG - Intronic
1106093655 13:26622680-26622702 AAGAAGAATCACTTGAACCCGGG + Intronic
1106726065 13:32487097-32487119 AAGAAGGATCACATGAGGCCAGG + Intronic
1106925258 13:34606773-34606795 CAGAACAATCAGTTGTAGCCTGG - Intergenic
1106947494 13:34845209-34845231 AATCAGATTCAGATGAAGCCTGG - Intergenic
1107302988 13:38985476-38985498 AAGAATGATAAGATGATGCAAGG - Intronic
1107382453 13:39871399-39871421 AAGAATAATAAAATGTAACCTGG + Intergenic
1107625437 13:42277327-42277349 TAGAATAATCAGATGAAGGCAGG - Intronic
1107653025 13:42563568-42563590 AAGAAGAATCACTTGAACCCAGG + Intronic
1107910778 13:45103960-45103982 CAGAAGAATCACATGAATCCAGG - Intergenic
1108062891 13:46551413-46551435 AAGAATCTTCAGCTGAAACCAGG - Intergenic
1108350833 13:49589425-49589447 AACAATAAACAGAAGTAGCCAGG - Intergenic
1108484090 13:50907260-50907282 AAGAAACAACAGATGAGGCCGGG - Intergenic
1108833956 13:54516990-54517012 CAGGAGAATCAGATGAACCCAGG - Intergenic
1109177341 13:59172965-59172987 AAGAATAACCAGGTGATGCCAGG + Intergenic
1109974959 13:69819203-69819225 AAGAATGATGAGATGAATTCAGG + Intronic
1110193579 13:72759802-72759824 AAGAAAAAGAAGATGAAGCTTGG - Exonic
1110417316 13:75267693-75267715 AAGAATACTCAGATGCGGCAGGG + Intergenic
1112198221 13:97247290-97247312 AAGAAAAAGCACTTGAAGCCTGG + Intronic
1112346558 13:98594876-98594898 CAGAAGAATCACATGAACCCAGG + Intergenic
1114039721 14:18666192-18666214 CAGGAGAATCAGTTGAAGCCAGG + Intergenic
1114044761 14:18864744-18864766 CAGGAGAATCAGTTGAAGCCAGG + Intergenic
1114119462 14:19654781-19654803 CAGGAGAATCAGTTGAAGCCAGG - Intergenic
1114337383 14:21705172-21705194 AAGAATAAAAAGATGTAGTCTGG + Intergenic
1116251524 14:42489663-42489685 AAGAAAAAGCAGATGAAATCTGG - Intergenic
1116567185 14:46463263-46463285 AACAATAATCACATGAAAGCTGG - Intergenic
1116695047 14:48164289-48164311 AAGGGTAATCAGAAGAAGCCTGG - Intergenic
1116825752 14:49671859-49671881 AAGAAGAATCACTTGAACCCAGG + Intronic
1117519297 14:56534280-56534302 CAGGATAATCACTTGAAGCCAGG + Intronic
1117777236 14:59195436-59195458 AAGTATAACAAGATGAGGCCAGG - Intronic
1119233337 14:72998688-72998710 AAGAAAAAACAGATAAGGCCAGG + Intronic
1120879173 14:89401347-89401369 CAGAAGAATCACTTGAAGCCAGG + Intronic
1120920186 14:89747937-89747959 AAAAAAAATCACATTAAGCCAGG + Intergenic
1121383768 14:93498172-93498194 CAGAATAATCACTTGAACCCAGG + Intronic
1122118457 14:99539075-99539097 AAGAAAAACCCAATGAAGCCTGG - Intronic
1122728677 14:103778552-103778574 AAAATTAATCAGATGAGGCCAGG - Intronic
1202828367 14_GL000009v2_random:1257-1279 AGGACTAATCAGATGAAGAGGGG - Intergenic
1123452997 15:20385011-20385033 AAAAATCATCAGATGAAGAACGG - Intergenic
1124425863 15:29562075-29562097 GAGGATAATCAGATGGATCCAGG + Intronic
1125019523 15:34970617-34970639 GAGAATAATCACTTGAAGCTGGG + Intergenic
1125292692 15:38167096-38167118 AAGAAGAATCACTTGAACCCAGG + Intergenic
1125322557 15:38503783-38503805 AAGAAAAATCATCGGAAGCCTGG + Intronic
1125917679 15:43503749-43503771 AAGAAGAATCAGGAGAAGGCAGG - Intronic
1126053344 15:44707395-44707417 CTGAATAATCAGAAGTAGCCAGG - Intronic
1127052453 15:55098935-55098957 AAGAATACACAGTTGAAGACAGG + Intergenic
1127119999 15:55763256-55763278 CAGAAGAATCAGATGAACCCGGG + Intergenic
1127398754 15:58564632-58564654 CAGAAGAATCAGTTGAACCCAGG + Intronic
1127433811 15:58936884-58936906 CAGGATAATCACTTGAAGCCGGG - Intronic
1127435929 15:58958300-58958322 CAGGATAATCACTTGAAGCCGGG - Intronic
1127470918 15:59289278-59289300 TAAAATAATCAGCTGAATCCAGG + Intronic
1127676569 15:61245025-61245047 CAGAAGAATCAGTTGAACCCGGG - Intergenic
1128422487 15:67507154-67507176 CAGAAGAATCACATGAACCCAGG - Intergenic
1129047048 15:72744828-72744850 CAGAAGAATCACTTGAAGCCAGG + Intergenic
1129353289 15:74970226-74970248 CAGAAGAATCAGTTGAACCCAGG - Intronic
1129554956 15:76498016-76498038 AAAAATAAGCACATGAGGCCTGG + Intronic
1129992298 15:79975640-79975662 AAGAAGAATCACTTGAACCCAGG + Intergenic
1130544893 15:84848785-84848807 AACACTAATCAGATGAAAGCTGG + Intronic
1130761479 15:86824962-86824984 AAGGGGAATCACATGAAGCCAGG + Intronic
1131287190 15:91070022-91070044 AACAATAATTGGATGCAGCCGGG - Intergenic
1131416145 15:92260148-92260170 AAGAAGAATCACTTGAACCCGGG + Intergenic
1131732123 15:95293194-95293216 AAGGCTACTCAGATGTAGCCTGG - Intergenic
1131744437 15:95431302-95431324 AAAAGTAATCAGCAGAAGCCTGG - Intergenic
1132459989 16:47979-48001 AAGGAGAATCACATGAACCCGGG - Intronic
1132487582 16:203056-203078 CAGGATAATCAGTTGAACCCAGG + Intronic
1133088585 16:3385231-3385253 AAGAAGAATCACTTGAACCCAGG + Intronic
1133209001 16:4252556-4252578 AAGAAGAATCACTTGAACCCGGG + Intergenic
1133547367 16:6820427-6820449 AGGAAAAATCAGTTGAGGCCAGG + Intronic
1133797507 16:9058071-9058093 AAGAAGAATCACTTGAACCCAGG + Intergenic
1133865899 16:9643167-9643189 AAGAATCATCACTTGAACCCGGG - Intergenic
1134653529 16:15929261-15929283 AGGAAAAATCAGTTGAACCCAGG - Intergenic
1135179439 16:20260097-20260119 AAGAATGATGAGAAGAAGGCCGG + Intergenic
1135396000 16:22132086-22132108 AAAATTAACCAGATGTAGCCAGG + Intronic
1135539796 16:23321132-23321154 CAGAATAATCACTTGAACCCAGG - Intronic
1136055482 16:27685443-27685465 TAGAAAAATAAGATGAAACCAGG + Intronic
1136698491 16:32108973-32108995 AAGAAAAATGGCATGAAGCCGGG + Intergenic
1136798995 16:33052270-33052292 AAGAAAAATGGCATGAAGCCGGG + Intergenic
1137680337 16:50337553-50337575 AAGAATGAACAGATGAGGCCAGG - Intronic
1137754234 16:50888761-50888783 GAGAATAAACAGATCCAGCCTGG + Intergenic
1137815525 16:51394361-51394383 AAGGATAATCACTTGAACCCAGG + Intergenic
1138011650 16:53386385-53386407 AAGAATAAAAACATGAGGCCGGG - Intergenic
1138806961 16:60101171-60101193 AAGAATAAACAAATGAAGATTGG - Intergenic
1139836826 16:69845751-69845773 AAGAATAATCAGATGAAGCCTGG + Intronic
1139920992 16:70460495-70460517 CAGAATAATCACTTGAACCCAGG - Intronic
1140258228 16:73355315-73355337 AATAATAATAAGAGGAAACCTGG + Intergenic
1140691744 16:77491366-77491388 CAGAATAATCACTTGAACCCTGG - Intergenic
1141059389 16:80851950-80851972 AAGCATAATCAGAAGATGACTGG - Intergenic
1141065054 16:80907602-80907624 CAGAAGAATCACTTGAAGCCAGG + Intergenic
1141127368 16:81410365-81410387 AAGAATAATCCTTTGAGGCCGGG + Intergenic
1141666516 16:85468407-85468429 CAGAATAATCACTTGAACCCAGG - Intergenic
1142038192 16:87875596-87875618 CAGAAGAATCAGTTGAACCCGGG - Intergenic
1203020696 16_KI270728v1_random:401794-401816 AAGAAGAATCACTTGAATCCAGG + Intergenic
1203039031 16_KI270728v1_random:674952-674974 AAGAAGAATCACTTGAATCCAGG + Intergenic
1142579164 17:930339-930361 CAGAAGAATCACTTGAAGCCGGG + Intronic
1142834172 17:2572564-2572586 CAGAATAATCACTTGAACCCGGG - Intergenic
1143096054 17:4479033-4479055 CAGAAGAATCAGTTGAACCCAGG - Intronic
1144132084 17:12255760-12255782 AAGAACAATCAGCTGAAAGCAGG - Intergenic
1144864412 17:18325762-18325784 AAGAATTTTCAGTTGAGGCCGGG + Intergenic
1145692642 17:26759240-26759262 CAGAAAAATGACATGAAGCCGGG + Intergenic
1146068587 17:29658094-29658116 AAGGAGAATCAGTTGAACCCAGG - Intronic
1146366130 17:32229752-32229774 CAGGAGAATCACATGAAGCCGGG - Intronic
1148249143 17:46059528-46059550 AAGGAGAATCATATGAACCCGGG + Intronic
1148620229 17:49029098-49029120 AATATAAATCAGATGAGGCCAGG - Intronic
1149151509 17:53570230-53570252 AAAAATAAACAGAGGAGGCCGGG + Intergenic
1149672011 17:58422786-58422808 CAGGATAATCAGTTGAACCCAGG - Intronic
1149694074 17:58602650-58602672 AAAAGAAATCAGATGAAGCTGGG + Intronic
1149707234 17:58705920-58705942 GATAATATTTAGATGAAGCCTGG - Intronic
1149738881 17:59024119-59024141 AAGAAGAATCACTTGAACCCAGG + Intronic
1149822406 17:59792567-59792589 AATAATTATCAGATGAGGCTGGG + Intronic
1149904803 17:60515867-60515889 AAGGAACATCAGATGAAGCTGGG + Intronic
1150051781 17:61971383-61971405 AAGAAGAATCACTTGAACCCGGG - Intronic
1150883236 17:69055323-69055345 AACAATAATCAGAAGAAAGCTGG + Intronic
1151075324 17:71265708-71265730 AAGAAAAAACACAGGAAGCCAGG + Intergenic
1151264734 17:72945946-72945968 TAGAAAAATCAGATAAAGTCTGG + Intronic
1152972297 18:174356-174378 AAGGAGAATCACTTGAAGCCAGG - Intronic
1153154066 18:2129214-2129236 AAGAAGAATCAGTTGAACCAAGG - Intergenic
1153264858 18:3260377-3260399 CAGAAGAATCACATGAACCCGGG + Intergenic
1155020335 18:21890402-21890424 AAGAAGAATCACTTGAACCCTGG + Intergenic
1156327800 18:36090005-36090027 CAGAAGAATCACTTGAAGCCCGG + Intergenic
1156346979 18:36266226-36266248 AAGAAGAATCACTTGAACCCGGG - Intronic
1156625976 18:38909550-38909572 AAGAATGGTCAGATCAAGCCTGG + Intergenic
1156638234 18:39057279-39057301 AAGAAGAAGAAGAAGAAGCCAGG - Intergenic
1157494305 18:48144184-48144206 CAGAAGAATCACTTGAAGCCGGG + Intronic
1158871013 18:61688336-61688358 AAGAATAATAAAATGAACCCAGG + Intergenic
1159833169 18:73303380-73303402 AAGGAGGATCAGTTGAAGCCAGG - Intergenic
1159959501 18:74544624-74544646 AAGAAAAATCACTTGAACCCGGG + Intronic
1160576142 18:79854806-79854828 AAGAATAAGCCAATGAGGCCAGG - Intergenic
1161054560 19:2183717-2183739 AAGAAGAATCACTTGAACCCCGG - Intronic
1161666199 19:5578466-5578488 AAGCAGAAACAGATGAACCCAGG - Intergenic
1161673552 19:5628255-5628277 AAAAAGAATCAGCTGAAGCTGGG + Intronic
1161740456 19:6018066-6018088 CAGAAGAATCACTTGAAGCCTGG - Intronic
1162055006 19:8057313-8057335 AATAATAATGAGCTGGAGCCAGG - Intronic
1162838009 19:13334186-13334208 AAGAAGTCTAAGATGAAGCCAGG - Intronic
1163028334 19:14527272-14527294 CAGAAGAATCAGTTGAACCCAGG - Intronic
1163052385 19:14694175-14694197 AAGGATTCTCAGATGAGGCCGGG + Intronic
1163435999 19:17295497-17295519 AAGGAGAATCAGTTGAACCCAGG - Intronic
1163578681 19:18125120-18125142 AAGAAAGGGCAGATGAAGCCAGG + Intronic
1163626722 19:18394396-18394418 AAGAAGAATCACTTGAACCCAGG - Intronic
1163707594 19:18824453-18824475 AAGTATAAGCAGTTGAGGCCTGG - Intergenic
1163873248 19:19843238-19843260 CAGAAGAATCACATGAACCCAGG + Intergenic
1164048408 19:21562841-21562863 CAGAATAATCACTTGAACCCAGG + Intergenic
1164209794 19:23088963-23088985 AAGAAGAATCACTTGAACCCGGG - Intronic
1164563651 19:29310858-29310880 AAGAAGAATCACCTGAGGCCGGG - Intergenic
1164983271 19:32630061-32630083 AAAAATAACAAGATGAAGCTGGG - Intronic
1164991211 19:32685543-32685565 CAGAAGAATCACTTGAAGCCAGG + Intergenic
1165198564 19:34126725-34126747 CAGAATAATCACTTGAATCCGGG + Intergenic
1165243474 19:34484294-34484316 AAGAATGAGCAGAGGAGGCCAGG + Intronic
1165548199 19:36560162-36560184 CAGAACAATCACATGAACCCAGG + Intronic
1165873823 19:38991771-38991793 AAGGAGAATCAGTTGAACCCGGG - Intronic
1165880300 19:39037936-39037958 AAGGAGAATCACTTGAAGCCAGG - Intergenic
1166372280 19:42308842-42308864 TAGAATGACCAGATGAGGCCAGG - Exonic
1166452971 19:42917454-42917476 CAGGATAATCACATGAACCCAGG - Intronic
1167007133 19:46783371-46783393 GAGAATAATCACTTGAACCCGGG + Intronic
1167212889 19:48144592-48144614 CAGAAGAATCACTTGAAGCCAGG - Intronic
1167222325 19:48208680-48208702 AAAAATACTCAAATGAGGCCAGG + Exonic
1167330912 19:48855509-48855531 AAGAAGAATCACTTGAACCCGGG + Intronic
1167861612 19:52288936-52288958 AAGAAGAATCACTTGAACCCGGG - Intronic
1168226652 19:55000057-55000079 AAAAATAAGCAAATCAAGCCAGG + Intronic
1168281476 19:55308318-55308340 AAGAAAAATAAGTTGGAGCCAGG - Intronic
1168395464 19:56043870-56043892 AAGAATAGTCAGCAGAGGCCAGG - Intronic
925070430 2:962551-962573 AAAAATAATTAGATGAAGTAAGG + Intronic
925748070 2:7061341-7061363 ATAAATATTCAGCTGAAGCCTGG - Intronic
925980697 2:9174680-9174702 CAGAAGAATCACTTGAAGCCAGG + Intergenic
926206464 2:10837441-10837463 GAAAAAAATAAGATGAAGCCAGG + Intronic
926262145 2:11274959-11274981 AAGAATAATAAGAACAGGCCGGG + Intronic
926548299 2:14269757-14269779 AAGAAAAATCCAATCAAGCCTGG + Intergenic
926825164 2:16898903-16898925 AAGGATAAGCAGATGGAGGCTGG + Intergenic
927656092 2:24947999-24948021 AATAATAATCAGATGAAAACAGG + Intronic
928098626 2:28421660-28421682 CAGAAGAATCACATGAACCCGGG - Intergenic
928879123 2:36077261-36077283 AAGAAAAATCAGAGAAAGGCAGG + Intergenic
928920553 2:36522504-36522526 AAGAATAAATAAATGAGGCCAGG + Intronic
929968396 2:46552526-46552548 GAGAATATTCAGATGAAGGAGGG - Intronic
930197440 2:48523648-48523670 AAGAAATTTCAGATGAGGCCTGG + Intergenic
930649987 2:53954746-53954768 CAGAAGAATCAGTTGAACCCTGG + Intronic
930742915 2:54851111-54851133 AAGAATAACCCAATGAGGCCAGG + Intronic
931046365 2:58358313-58358335 AAGGATAATCAGATGCAGATAGG - Intergenic
931122858 2:59239730-59239752 AAAGATAATCAGATGTTGCCAGG - Intergenic
931788898 2:65645980-65646002 ATGAATAATAAAAGGAAGCCAGG - Intergenic
931876833 2:66522679-66522701 TGGAGTAATTAGATGAAGCCAGG + Intronic
932245976 2:70196761-70196783 TAAAATAATCATTTGAAGCCAGG - Intronic
933740112 2:85526631-85526653 GAGAATAATAAGTTGAGGCCAGG - Intergenic
933817284 2:86078336-86078358 AAGAAAAATTAAATCAAGCCAGG - Intronic
935062189 2:99618326-99618348 AAGGAGAATCATATGAACCCAGG - Intronic
936105730 2:109623032-109623054 AAGAAGAATCACTTGAACCCAGG + Intergenic
937013348 2:118581474-118581496 TATAATAATCAGATGAGGCAGGG - Intergenic
937145707 2:119642629-119642651 AAGGATAATCAGTTGAGCCCAGG - Intronic
938270839 2:129969412-129969434 CAGGAGAATCAGTTGAAGCCAGG - Intergenic
938446423 2:131383614-131383636 AAGACTGATCAGATGAAGAGGGG + Intergenic
939230111 2:139413551-139413573 AAGAAGAATCACTTGAACCCGGG - Intergenic
939306573 2:140419132-140419154 AATAATAATCAAAAGAAACCTGG + Intronic
939312034 2:140492915-140492937 AAGAATATTGAGAGGAAGCAAGG - Intronic
941435168 2:165461508-165461530 CAGAATAATCACTTGAACCCGGG - Intergenic
941539189 2:166761249-166761271 CAGGATAATCACTTGAAGCCAGG - Intergenic
941730145 2:168908483-168908505 AACAGGAATCAGATGCAGCCTGG - Intronic
942019579 2:171853170-171853192 AATAAGAAAAAGATGAAGCCAGG - Intronic
943270622 2:185797916-185797938 AAGAAGGATCACATGAGGCCAGG - Intronic
943474433 2:188337229-188337251 AAGAAGAATCACTTGAATCCGGG - Intronic
945947161 2:216005542-216005564 AAGAAGAATCACTTGAAGCTGGG - Intronic
948029710 2:234807381-234807403 CAGAAGAATCATTTGAAGCCAGG - Intergenic
1168760138 20:344889-344911 AAGAAGAACCAGATGAGGCCAGG - Intergenic
1169140493 20:3224755-3224777 AAGAAGAATCACATGCTGCCTGG + Intergenic
1169416380 20:5420323-5420345 AAGAAGAAGCAGATAAGGCCAGG - Intergenic
1169608570 20:7352318-7352340 AAATATAATCAGAAGGAGCCTGG - Intergenic
1169728316 20:8759996-8760018 CAGAAGAATCACTTGAAGCCAGG - Intronic
1170672303 20:18445847-18445869 CACAATAATCACTTGAAGCCAGG - Intronic
1170858400 20:20079082-20079104 AAGAAAAATCAGATGAACTTTGG + Intronic
1170915813 20:20624232-20624254 AAGAAGAATCACTTGAACCCGGG + Intronic
1171894299 20:30745499-30745521 AGGACTAATCAGATGAAGAGGGG + Intergenic
1172578410 20:36027766-36027788 CAGAAGAATCACTTGAAGCCAGG - Intronic
1172710141 20:36915642-36915664 CAGAAAAATCACTTGAAGCCAGG + Intronic
1172874014 20:38153227-38153249 AAGAATGAGCAGATGTGGCCGGG + Intronic
1173120095 20:40281085-40281107 AAGAATTATAAGATCACGCCAGG + Intergenic
1176607548 21:8846086-8846108 AGGACTAATCAGATGAAGAGGGG - Intergenic
1176929386 21:14789884-14789906 AAGAAAAATTAGAAGAAGCAAGG - Intergenic
1177639607 21:23830026-23830048 AAGGAGAATCACATGAACCCAGG + Intergenic
1179197685 21:39181294-39181316 AAAAATAAAAAAATGAAGCCAGG - Intronic
1180357636 22:11855878-11855900 AGGACTAATCAGATGAAGAGGGG - Intergenic
1180380629 22:12136455-12136477 AGGACTAATCAGATGAAGAGGGG + Intergenic
1180463284 22:15587301-15587323 CAGGAGAATCAGTTGAAGCCAGG + Intergenic
1180942379 22:19667738-19667760 CAGAAGAATCAGATCACGCCTGG - Intergenic
1182536190 22:31004908-31004930 GATAATAATCAGTGGAAGCCAGG + Intergenic
1182719354 22:32385074-32385096 CAGAAGAATCACATGAACCCGGG - Intergenic
1183486686 22:38091148-38091170 CAGAATAATCACTTGAAGCCGGG - Intronic
1183991465 22:41599852-41599874 AAGAATAATGATGTGAGGCCTGG - Exonic
1184234512 22:43175760-43175782 AAGAAGAATCACTTGAAACCTGG - Intronic
1184530875 22:45054865-45054887 AAAAAAAAACAGAGGAAGCCGGG + Intergenic
1184579768 22:45408116-45408138 AATAATAATAAGATGAAGGAAGG - Intronic
1184632849 22:45798686-45798708 AAGAAAAATCAGATGCATGCAGG + Intronic
949727244 3:7063387-7063409 AAGACTAAGCAGGTGAAGCTGGG + Intronic
950017477 3:9764403-9764425 AAGAAGAATCACTTGAACCCAGG - Intronic
950058574 3:10049801-10049823 AAGAATAATTAAATTTAGCCTGG + Intronic
950400216 3:12764006-12764028 CAGGATAATCACTTGAAGCCGGG - Intronic
950908209 3:16558360-16558382 AAGAAAAATAAAATGGAGCCAGG + Intergenic
951893895 3:27592509-27592531 AAGAAGAATCACTTGAACCCTGG + Intergenic
952270586 3:31827206-31827228 AAAAATAATTAGGTGAAGCCAGG - Intronic
952812541 3:37417395-37417417 AATAATAAACAGAGGAAGGCGGG + Exonic
953137850 3:40198972-40198994 AGGAAAGATAAGATGAAGCCAGG + Intronic
953415830 3:42716247-42716269 AAAAAAAATCAGGTCAAGCCAGG + Intronic
953730133 3:45440169-45440191 GAGAATCATCTGATGTAGCCTGG + Intronic
953948986 3:47173507-47173529 AAGAAGAATCACTTGAACCCAGG + Intergenic
954052438 3:47991758-47991780 AAGAGTAATCACTTGAACCCGGG - Intronic
954546031 3:51435616-51435638 CAGAATAATCACTTGAACCCGGG + Intronic
954557301 3:51528167-51528189 CACAAAAATCAGTTGAAGCCAGG - Intergenic
954562930 3:51573527-51573549 CAGAATAATCATTTGAACCCAGG - Intronic
955134700 3:56205198-56205220 AAAGAAAATCAGATGAAACCTGG - Intronic
955192726 3:56776583-56776605 AAGAAAAATCTAATGAGGCCAGG - Intronic
955342312 3:58134544-58134566 AAGAAAAGTCAGATGCAGCTGGG + Intronic
956874957 3:73453311-73453333 CAGAAGAATCACTTGAAGCCGGG + Intronic
957738917 3:84237524-84237546 AAGAATAGACAGATTAAGGCGGG + Intergenic
957842754 3:85692931-85692953 AAGAAAAATCAGAAGGAGGCCGG + Intronic
958128788 3:89390878-89390900 CAGGAGAATCAGATGAACCCGGG - Intronic
958787288 3:98612195-98612217 CAGGATAATCACTTGAAGCCGGG + Intergenic
959776315 3:110168160-110168182 AAGACTAATGAGATTAGGCCAGG - Intergenic
960406860 3:117271681-117271703 AAGATTAATGAGATAAAGTCAGG + Intergenic
961258694 3:125581601-125581623 CAGAAGAATCACATGAACCCTGG + Intronic
962730095 3:138273907-138273929 AAGAAGAATCACTTGAACCCGGG - Intronic
963905309 3:150768904-150768926 AAGGAGAATCACTTGAAGCCAGG + Intergenic
964023813 3:152047087-152047109 AAGGAGAATCACTTGAAGCCAGG - Intergenic
965777929 3:172253257-172253279 AATATTAATAAGATGAAGCAGGG + Intronic
966178288 3:177163414-177163436 CAGAAGAATCACATGAAACCAGG + Intronic
966428433 3:179806218-179806240 CGGGAAAATCAGATGAAGCCAGG + Intronic
966600715 3:181772713-181772735 AATAATAATGATATGAAGTCTGG + Intergenic
968784706 4:2611567-2611589 AAGAAAATGCAGATTAAGCCGGG - Intronic
969991051 4:11262666-11262688 AGAAATATTCAGATGAGGCCAGG + Intergenic
970166300 4:13241752-13241774 AAGAATAAATAAATGGAGCCAGG - Intergenic
970765312 4:19541319-19541341 TAAAGTAATCAGATGAAGCCTGG - Intergenic
971314016 4:25552228-25552250 CAGAAAAATCACTTGAAGCCAGG + Intergenic
971550353 4:27947470-27947492 ATGAACAATCTGATGAAGCTTGG + Intergenic
971601734 4:28600487-28600509 GAGCATAATCATATGAAACCAGG + Intergenic
972525200 4:39903253-39903275 AACAATAATCAGATGTACACAGG - Intronic
972697689 4:41464104-41464126 AAGAAACATCAGCTGAACCCAGG - Intronic
973212093 4:47627276-47627298 AATAATAATCAGATGAGGCCAGG - Intronic
973641628 4:52908638-52908660 AAGAAAAGCAAGATGAAGCCAGG - Intronic
973905919 4:55530680-55530702 CAGAAGAATCAGCTGAACCCAGG + Intronic
974583431 4:63836948-63836970 AAGAATCATCAGGTGGAGGCAGG + Intergenic
975205224 4:71637919-71637941 ATGAGTGATCAGATGAATCCTGG + Intergenic
976545833 4:86334656-86334678 AGGAATAGTCAGATGAAGTGGGG - Intronic
978133578 4:105230132-105230154 AAGAAGAATCACCTGAACCCAGG - Intronic
978404542 4:108365107-108365129 AAGAAGAAACAGAAGAAGGCAGG + Intergenic
978406165 4:108380983-108381005 CAGGAGAATCAGTTGAAGCCAGG + Intergenic
978581900 4:110240034-110240056 AAGAATGATGGGATGAGGCCGGG - Intergenic
978782799 4:112574931-112574953 CAGAATAATCACTTGAACCCAGG + Intronic
979228208 4:118315938-118315960 TTGAATAATTAGTTGAAGCCAGG - Intronic
981315169 4:143334786-143334808 AAGAAAAATCTGAAAAAGCCTGG - Intergenic
981467269 4:145087749-145087771 AACAATAAAGAGATGAGGCCAGG + Intronic
981925150 4:150131181-150131203 TAAAATGATCAAATGAAGCCAGG - Intronic
982452655 4:155571384-155571406 CAGCATAATCAGTTGAAACCTGG - Intergenic
982934274 4:161451421-161451443 AGGAAAAATGAGAGGAAGCCAGG + Intronic
983644944 4:169980092-169980114 AAGAGTATTTAGATAAAGCCAGG - Intergenic
983651865 4:170043670-170043692 CAGAAGAATCAGTTGAACCCAGG + Intergenic
984357103 4:178675609-178675631 AAGAAGAATCACTTGAACCCGGG + Intergenic
984812772 4:183809381-183809403 AATAAAAATCAGATCAGGCCAGG - Intergenic
984833641 4:183999421-183999443 GAGAAAAATCAGCAGAAGCCAGG - Intronic
985168314 4:187121435-187121457 CAGAATAATCACTTGAACCCAGG + Intergenic
985322190 4:188725323-188725345 CAGGATAATCACTTGAAGCCAGG - Intergenic
986041433 5:3997728-3997750 AAGAGTGATCAGAAGAAACCAGG - Intergenic
986541663 5:8851021-8851043 AAGAAAAATAAGAAGCAGCCCGG - Intergenic
986634675 5:9809641-9809663 CAGAATGAACAGATGAAGACAGG + Intergenic
986826861 5:11531531-11531553 CAGAATAATCACTTGAACCCGGG + Intronic
987754287 5:22080870-22080892 CAGAAGAATCAGTTGAACCCAGG - Intronic
987927625 5:24363449-24363471 AAGAAGAATCACTTGAACCCGGG - Intergenic
988318165 5:29658842-29658864 AAAAATAATCTGAGGAAGGCTGG + Intergenic
988514780 5:31894980-31895002 CAGAACAATCAGCTGAACCCAGG - Intronic
989078448 5:37589671-37589693 AAGAAGAATCACTTGAACCCAGG - Intronic
989601497 5:43204610-43204632 AACAAGAATCAGTTGAACCCAGG + Intronic
989796344 5:45478825-45478847 AAGAATAAGCTGAAGAAGGCAGG + Intronic
991460954 5:66858047-66858069 TAGAAGAATCAGTTGAACCCAGG - Intronic
992404644 5:76445555-76445577 CAGAAGAATCAGTTGAACCCAGG - Intronic
992742660 5:79789830-79789852 AAGAATAAACAGAACAAGGCTGG - Intronic
993127357 5:83851583-83851605 AAGAAAAACCAGATGCAGGCCGG - Intergenic
994581545 5:101648818-101648840 AAGAATAATAAGAACAGGCCGGG + Intergenic
994590297 5:101762427-101762449 AAGAATACTCAAAAGAGGCCAGG + Intergenic
996102720 5:119460905-119460927 CAGAAGAAGCAGCTGAAGCCAGG + Intronic
997554000 5:134778987-134779009 CAGAAGAATCACTTGAAGCCAGG - Intronic
997945551 5:138197587-138197609 CAGAAGAATCACATGAACCCGGG - Intronic
998117112 5:139546573-139546595 GAGAATAATCACATGAACCTGGG - Intronic
998226314 5:140329260-140329282 CAGAATAATCACTTGAGGCCAGG - Intergenic
998242931 5:140466296-140466318 CAGAAGAATCAGTTGAACCCAGG + Intronic
999221381 5:149981301-149981323 AAGAACCTTCAGATTAAGCCAGG + Exonic
999274873 5:150323527-150323549 AAGAAGAATGAGCTGAAGGCAGG - Intronic
999297592 5:150469478-150469500 AAGAAGAATCACTTGAACCCAGG + Intergenic
1000277283 5:159749140-159749162 AAGATTAATTAGAGGAAGCTGGG - Intergenic
1000371465 5:160540547-160540569 AAGAATAATAAAATGAGGCTGGG + Intergenic
1000420459 5:161032797-161032819 AAGAATATTCTCATGAAGGCTGG - Intergenic
1000631042 5:163591037-163591059 ATAAATAATGAAATGAAGCCTGG - Intergenic
1001187838 5:169593367-169593389 AAGTGGAATTAGATGAAGCCAGG + Exonic
1001725976 5:173900310-173900332 CAGAATAATCACTTGAACCCAGG + Intronic
1002648815 5:180676587-180676609 CAGGAGAATCAGTTGAAGCCGGG - Intergenic
1003248594 6:4404988-4405010 AACAATAAATAGATGTAGCCAGG + Intergenic
1003445528 6:6180195-6180217 AAGAATTGGCAGATGAAGCTGGG - Intronic
1003962215 6:11219393-11219415 AAAAATAATCAGAGGAAGCCGGG - Intronic
1004004993 6:11630257-11630279 AATAATCATCAGAGGAGGCCAGG + Intergenic
1004379762 6:15122646-15122668 CAGAACAATCAGTTGAACCCAGG - Intergenic
1004584182 6:16983471-16983493 AAGAAGAATCACTTGAACCCAGG + Intergenic
1004662991 6:17726617-17726639 AAGAAGAATCACTTGAACCCGGG + Intergenic
1004909928 6:20273127-20273149 CAGAAGAATCACATGAAGTCAGG - Intergenic
1005652399 6:27896240-27896262 AAGAAGAATCACTTGAACCCAGG - Intergenic
1005953576 6:30648218-30648240 AAGAATATCCAGCTGAAGCTAGG - Intronic
1006658944 6:35622945-35622967 AAGAATTATTAGATAAGGCCGGG + Intronic
1006901481 6:37505118-37505140 TAGAAAAATCAAATAAAGCCAGG - Intergenic
1009330985 6:62419480-62419502 CAGAAGAATCACTTGAAGCCAGG - Intergenic
1010028527 6:71246976-71246998 AAGAAAGAGAAGATGAAGCCAGG - Intergenic
1010689046 6:78887571-78887593 CAGAAGAATCAGTTGAACCCAGG + Intronic
1011131206 6:84053313-84053335 AAGGAAAATAAGATGAAGTCTGG - Intronic
1012023057 6:93950589-93950611 AAGAAAGATCACCTGAAGCCAGG - Intergenic
1012269737 6:97194054-97194076 AAAAATAAACAAATGAGGCCAGG - Intronic
1012928109 6:105288441-105288463 GAGAATAATCACTTGAACCCAGG - Intronic
1013120666 6:107137843-107137865 AAGAAGAATCACTTGAACCCGGG - Intergenic
1013424945 6:110003160-110003182 AAGAATAAGCAGAAGAAGGAAGG + Intergenic
1013498778 6:110726300-110726322 AAGAATAAACAGATGTTACCAGG + Intronic
1014106128 6:117563627-117563649 AAGGAGAATCACTTGAAGCCAGG + Intronic
1014238998 6:118993940-118993962 AAGAAGGATCAGATCACGCCAGG - Intronic
1015123374 6:129725414-129725436 AAGGATAAACAGATGAATCCAGG - Intergenic
1015492007 6:133837274-133837296 TAGAATAATAAAATGCAGCCGGG + Intergenic
1015591597 6:134827967-134827989 AAGAATAAAGAGATGAATCCCGG + Intergenic
1016488874 6:144573906-144573928 ATGATTAATCACATGAATCCTGG - Intronic
1016794118 6:148099645-148099667 AAGAAGAAGAAGAAGAAGCCTGG - Intergenic
1016974005 6:149789369-149789391 AAAAATAATCAGATCAGGCTGGG - Intronic
1017755881 6:157528767-157528789 AAGCACAATTAGATGAAGACTGG + Intronic
1017755887 6:157528823-157528845 AAGCACAATTAGATGAAGACTGG + Intronic
1017755895 6:157528879-157528901 AAGCACAATTAGATGAAGACTGG + Intronic
1017755903 6:157528935-157528957 AAGCATAATTAGATGAAGACTGG + Intronic
1017786076 6:157758280-157758302 AAAAAGAAGCAGATGAGGCCAGG + Intronic
1017988542 6:159466182-159466204 AAGAAGAAGAAGAAGAAGCCGGG - Intergenic
1020054941 7:5111185-5111207 AAGGAGAATCAGTTGAACCCAGG + Intergenic
1020825816 7:13026812-13026834 AAGGAGAATCACTTGAAGCCAGG - Intergenic
1021524738 7:21574654-21574676 CAGAAGAATCACTTGAAGCCAGG - Intronic
1023169788 7:37379334-37379356 AAGAAGAATGTGATGAGGCCGGG - Intronic
1023449427 7:40266921-40266943 CAGAAGAATCACTTGAAGCCAGG + Intronic
1025161004 7:56660695-56660717 AAGGAGAATCACATGAACCCTGG + Intergenic
1025321535 7:58099603-58099625 CAGAAGAATCACTTGAAGCCGGG - Intergenic
1026034634 7:66822223-66822245 CAGAAGAATCAGTTGAACCCGGG - Intergenic
1026705417 7:72687339-72687361 CAGGATAATCACTTGAAGCCAGG + Intronic
1027199829 7:76056918-76056940 CAGGAGAATCACATGAAGCCGGG + Intronic
1027986947 7:85305136-85305158 AAGAATATTCAGAAGAAGCGTGG + Intergenic
1028235325 7:88354492-88354514 AAAAATAATCTGATCAAACCAGG + Intergenic
1029121808 7:98273296-98273318 AAGAAAAATAAACTGAAGCCAGG - Intronic
1030021312 7:105278016-105278038 AAGAATAATTATTTGAGGCCAGG + Intronic
1030225319 7:107144176-107144198 AAGAAGAATCACCTGAACCCAGG - Intronic
1031782543 7:125987058-125987080 AAGATAAATAAAATGAAGCCAGG + Intergenic
1032360726 7:131252419-131252441 CAGAAGAATCACATGAACCCAGG - Intronic
1032594044 7:133221525-133221547 CAGGATAATCAGCTGAACCCAGG + Intergenic
1032891619 7:136200922-136200944 CAGAAGAATCAGTTGAACCCAGG - Intergenic
1033461991 7:141555099-141555121 TAGAAAAACCAGAGGAAGCCTGG + Intronic
1033861231 7:145630618-145630640 AGGAAGAATCAGAAGAAGCTGGG - Intergenic
1033874938 7:145804426-145804448 AATAAAAATCAAATGAAGGCAGG - Intergenic
1033874981 7:145804734-145804756 AATAAAAATCAAATGAAGGCAGG - Intergenic
1034333217 7:150301379-150301401 AACAAGAATCAGATTAACCCTGG + Intronic
1034664823 7:152808509-152808531 AACAAGAATCAGATTAACCCTGG - Intronic
1036477532 8:9106668-9106690 AAAAATATTCAGATTAAGGCCGG - Intronic
1036652045 8:10650649-10650671 AAGAAGAATCACTTGAACCCTGG - Intronic
1036660063 8:10702128-10702150 AAGGATAAGCAGAGGAGGCCTGG + Intronic
1037226153 8:16593290-16593312 AACACTAATCAAATGAAGACTGG + Intergenic
1037314833 8:17591175-17591197 CAAAATAATCAGAAGCAGCCAGG - Intronic
1038294191 8:26275776-26275798 TAAAAAAATCTGATGAAGCCAGG + Intergenic
1038390570 8:27196231-27196253 GAGAATAATGACATGAAGCCTGG - Intergenic
1039694461 8:39896137-39896159 AAGAATAATAAAATGTGGCCAGG + Intergenic
1040407693 8:47122876-47122898 AAGAATAATCAAAGGCAGCGGGG - Intergenic
1040810075 8:51441904-51441926 AATAATACACACATGAAGCCTGG + Intronic
1042855662 8:73264581-73264603 CAGAAGAATCACATGAACCCGGG - Intergenic
1042869065 8:73380898-73380920 CAGAAAAATCACTTGAAGCCAGG + Intergenic
1045083021 8:98648962-98648984 AAGGAAAATCACTTGAAGCCAGG + Intronic
1046095966 8:109560887-109560909 AAGAAGAAGAAGATGCAGCCTGG + Exonic
1046950220 8:120013062-120013084 CAGAAGAATCACATGAACCCGGG + Intronic
1047384130 8:124393971-124393993 AAGAATAATTAGAAGAGGCTTGG - Intergenic
1047736096 8:127766465-127766487 AAGAAAAATAGAATGAAGCCAGG - Intergenic
1048023500 8:130562684-130562706 ATTAAGAACCAGATGAAGCCAGG - Intergenic
1048083691 8:131155692-131155714 AAGAAGAAAAAGATGAAGTCCGG + Intergenic
1048239371 8:132725934-132725956 AAGAATATTCAGATTCAGACAGG - Intronic
1049234184 8:141502967-141502989 ATCAAAAATCAGTTGAAGCCAGG - Intergenic
1050172360 9:2835183-2835205 AAGAAGAATCATTTGAGGCCAGG + Intronic
1050746536 9:8882790-8882812 CAGGAGAATCAGGTGAAGCCAGG + Intronic
1050831597 9:10020657-10020679 AAGAGTTTTCAGATGAAGCAAGG - Intronic
1050831694 9:10021781-10021803 AAGAGTTTTCAGATGAAGCAAGG - Intronic
1052905352 9:33828824-33828846 CAGAATAATCACTTGAACCCGGG - Intronic
1053118929 9:35530730-35530752 CAGGATAATCACATGAACCCAGG - Intronic
1053390468 9:37731574-37731596 AAAAATAATCATTTGGAGCCGGG + Intronic
1054354355 9:64047275-64047297 AGGACTAATCAGATGAAGAGGGG - Intergenic
1054606075 9:67179689-67179711 AACAATAATCAGAAGAAATCCGG - Intergenic
1054792212 9:69266797-69266819 AATAATAACTAGATGCAGCCGGG + Intergenic
1054950704 9:70848295-70848317 AAGATAAATGAGATGCAGCCAGG + Intronic
1055036425 9:71823166-71823188 CAGAATAATTAGATGGGGCCAGG - Intergenic
1055289609 9:74769236-74769258 CAGAAGAATCACATGAACCCAGG - Intronic
1056031096 9:82554189-82554211 ATGAGTAATCAGATGCAGCATGG + Intergenic
1056558700 9:87711021-87711043 AAGAATAAAAAGATGGAGGCGGG + Intergenic
1057990232 9:99761247-99761269 AAGAATAATCAGAGGAGGCATGG - Intergenic
1058688745 9:107501446-107501468 AAGAAGAATCACTTGAACCCGGG - Intergenic
1058919487 9:109599486-109599508 AGGAATAAACAGTGGAAGCCTGG - Intergenic
1059175315 9:112164849-112164871 CAGAAGAATCACTTGAAGCCGGG + Intronic
1059460714 9:114428030-114428052 AAAAATCATCAGATGAGGCCAGG + Intronic
1060592009 9:124823199-124823221 AAGAAGAATCACTTGAACCCAGG + Intergenic
1060645441 9:125275166-125275188 CAGAAGAATCACTTGAAGCCAGG - Intronic
1060832954 9:126730462-126730484 CAGAATAATCACTTGAACCCGGG - Intergenic
1061110537 9:128566634-128566656 AATAATTATCAGATAAACCCAGG - Intronic
1061206660 9:129167896-129167918 AAGACTAAACACATGAGGCCAGG - Intergenic
1061613087 9:131761541-131761563 TAGGAGAATCAGTTGAAGCCAGG - Intergenic
1062504765 9:136867227-136867249 CAGAAGAATCAGTTGAACCCGGG + Intronic
1203742689 Un_GL000218v1:16398-16420 AGGACTAATCAGATGAAGAGGGG - Intergenic
1203702888 Un_KI270742v1:10979-11001 AGGACTAATCAGATGAAGAGGGG - Intergenic
1203567411 Un_KI270744v1:103031-103053 AGGACTAATCAGATGAAGAGGGG + Intergenic
1185762860 X:2701545-2701567 AAGAATGAGCAGAGGAAACCAGG + Intronic
1186412973 X:9360166-9360188 AAGAATTATCTGGTGAGGCCAGG - Intergenic
1187011213 X:15281989-15282011 AAGAATTATCAGATCTGGCCGGG - Intronic
1187150723 X:16679263-16679285 CAGAAGAATCACATGAACCCAGG + Intronic
1187532504 X:20109747-20109769 AAAAATATTCAGATTAAGGCTGG + Intronic
1187713132 X:22074166-22074188 AAGAAGAATAAAATGTAGCCTGG - Intronic
1187889455 X:23920594-23920616 GAAAATTATCAAATGAAGCCAGG + Intronic
1187953075 X:24489957-24489979 CAGAATCATCAGATGAGCCCAGG + Intronic
1188018552 X:25131514-25131536 ACAAATAATCAGAAGAAGGCTGG + Intergenic
1188981607 X:36731920-36731942 GAGAACAATCAGATTAGGCCCGG - Intergenic
1189533994 X:41917458-41917480 AAGAATAATCTCAAGAAGCAAGG + Intronic
1189826419 X:44922762-44922784 AAGAATATTCAAATTAGGCCGGG - Intronic
1190647865 X:52539547-52539569 AAGCATCATCAGATGAATGCAGG + Intergenic
1190813985 X:53912193-53912215 AAGAATCTTGAGATGAGGCCAGG - Intergenic
1190818269 X:53948363-53948385 AAGAAGAATCACTTGAACCCAGG - Intronic
1192073906 X:67970712-67970734 AAGAAGAATCAGTTGAACCTGGG + Intergenic
1192247988 X:69389021-69389043 AGAAATACTCAGCTGAAGCCAGG + Intergenic
1193126375 X:77874945-77874967 CAGAATAATCATTTGAACCCGGG - Intronic
1193128893 X:77898763-77898785 CAGAATAATCACTTGAACCCGGG - Intergenic
1193608199 X:83594220-83594242 CAGAATAATCAGATCACACCTGG - Intergenic
1193652445 X:84154240-84154262 AGGAAAGATTAGATGAAGCCAGG - Intronic
1193981237 X:88184404-88184426 AAAAATTATCAGAAAAAGCCAGG - Intergenic
1195056540 X:101151532-101151554 TAGAATAGTATGATGAAGCCAGG + Intronic
1196360042 X:114842613-114842635 CAGAATGCTCAGAAGAAGCCTGG + Intronic
1196799382 X:119528987-119529009 AAAAAAAATCAGATTAAGGCCGG + Intergenic
1196821404 X:119703985-119704007 AGGAAAAAACAGATGAAGCTGGG - Intergenic
1198259871 X:134956219-134956241 CAGAAGAATCACTTGAAGCCGGG - Intergenic
1198273766 X:135081372-135081394 CAGGATAATCACTTGAAGCCAGG + Intergenic
1199053114 X:143260878-143260900 AAGAATAATGAGAAGAGGCGGGG + Intergenic
1200126614 X:153818255-153818277 AAGAATCATGAGATGAAGCTGGG + Intronic
1200243837 X:154512276-154512298 AAGAAGAAGAAGAAGAAGCCGGG + Intronic
1201736675 Y:17270756-17270778 CAGGAGAATCAGTTGAAGCCAGG - Intergenic
1202346664 Y:23936036-23936058 CAGAATAATCACTTGAAACCGGG - Intergenic
1202524107 Y:25734057-25734079 CAGAATAATCACTTGAAACCGGG + Intergenic