ID: 1139840294

View in Genome Browser
Species Human (GRCh38)
Location 16:69873248-69873270
Sequence TGGTGCTGCCACAGAACTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139840294_1139840305 20 Left 1139840294 16:69873248-69873270 CCTTCAGTTCTGTGGCAGCACCA 0: 1
1: 0
2: 2
3: 23
4: 174
Right 1139840305 16:69873291-69873313 CGTGGCTGCTGCTGTTGCCTGGG 0: 1
1: 0
2: 3
3: 34
4: 332
1139840294_1139840300 2 Left 1139840294 16:69873248-69873270 CCTTCAGTTCTGTGGCAGCACCA 0: 1
1: 0
2: 2
3: 23
4: 174
Right 1139840300 16:69873273-69873295 TGGGGGCTTCAGAGTCCCCGTGG 0: 1
1: 0
2: 2
3: 24
4: 173
1139840294_1139840304 19 Left 1139840294 16:69873248-69873270 CCTTCAGTTCTGTGGCAGCACCA 0: 1
1: 0
2: 2
3: 23
4: 174
Right 1139840304 16:69873290-69873312 CCGTGGCTGCTGCTGTTGCCTGG 0: 1
1: 0
2: 2
3: 44
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139840294 Original CRISPR TGGTGCTGCCACAGAACTGA AGG (reversed) Intronic
901899689 1:12349146-12349168 TGGCTCTGCCACAGAAATAAGGG - Exonic
902993195 1:20204034-20204056 TGGCGCAGCCACTGAACAGAGGG + Intergenic
904870348 1:33613770-33613792 TTGTGCTGACATGGAACTGATGG - Intronic
907411963 1:54289546-54289568 TTGTGGTGACAGAGAACTGAGGG + Intronic
907586310 1:55620905-55620927 TGGAGCTGCCCAAGAACTGTGGG + Intergenic
908343414 1:63205998-63206020 TGATTCTGCCACTGATCTGATGG - Intergenic
908516095 1:64894292-64894314 AGGTGCAGACACATAACTGAGGG - Intronic
910415377 1:86992024-86992046 TAGTGCTGCCACTGATCTGACGG - Intronic
910900590 1:92115825-92115847 TGGTGCTGCCCAAGAACGGAAGG + Intronic
912972479 1:114296940-114296962 TGGTGCAGAGACAGGACTGACGG + Intergenic
915304267 1:154968890-154968912 TGGGGCTGCCACAGGGCTGGGGG + Intronic
917748789 1:178036311-178036333 TGATGCCGCCACTGATCTGACGG - Intergenic
919196631 1:194295244-194295266 TGATGCAGCTAAAGAACTGAGGG - Intergenic
919806760 1:201385125-201385147 TGGTGCCCCCACAGAGCTCATGG - Intronic
920751366 1:208680620-208680642 TGGTTCTGCCACTGAATAGACGG - Intergenic
922291648 1:224213580-224213602 TGCTGCTGCCAGAGAGCTGTGGG - Intergenic
923998237 1:239521110-239521132 GGATGCTGCCACAGAAATGTGGG - Intronic
924271979 1:242343539-242343561 TGGTGCTGACACAGACCAGTAGG - Intronic
1062852858 10:759200-759222 TGCTGCTGCCCCAGGACTGTGGG + Intergenic
1066712692 10:38252586-38252608 TGGTGCTGACACAGACCAGTAGG + Intergenic
1067086107 10:43239105-43239127 TGCAGCTGCCACAGAACGTATGG - Intronic
1067913500 10:50371743-50371765 TGCTGCTGTAACAGAATTGAAGG + Intronic
1070962548 10:80509294-80509316 CGATGGTGCCACAGAACTGCAGG - Exonic
1075401885 10:122166971-122166993 TGGGGCTGCCACAGAATCAAGGG - Intronic
1075879951 10:125842419-125842441 TGGTGCTGACACAGGACCTAGGG + Intronic
1076547631 10:131256361-131256383 TTGTCCTGCCACAGAACAGCTGG - Intronic
1077309253 11:1881224-1881246 TCAGGCTGCCCCAGAACTGACGG + Intronic
1081069879 11:38597430-38597452 TGGTGCTGCCAGAGAATTTCAGG - Intergenic
1082098480 11:48151280-48151302 TGTTGCTGCCACAAAACCAAGGG - Intronic
1082745130 11:56952891-56952913 TGGCCTTGCCAAAGAACTGATGG - Intergenic
1083456552 11:62782679-62782701 TGGTGCTCCCACAGGACTCATGG + Exonic
1084399189 11:68933807-68933829 TGTGGCTGCCACAGAAGAGACGG + Exonic
1086336234 11:85803431-85803453 TGGTGCTGCTTCATAACTGCAGG + Intronic
1086471288 11:87114777-87114799 TGGCACTGCCTGAGAACTGAGGG + Intronic
1087568566 11:99895157-99895179 TAGTACTGACACTGAACTGATGG - Intronic
1089177289 11:116558025-116558047 TGGGGCGGCCAAAGAATTGATGG - Intergenic
1101907190 12:108836187-108836209 AGGTGCTGCATCAGAATTGAAGG + Intronic
1102199458 12:111047377-111047399 TGGTACAGCCACAGAAAGGAGGG - Intronic
1104273735 12:127305778-127305800 TGGTGCTGCCACATGACAGCCGG + Intergenic
1105728079 13:23185671-23185693 TGTAGCTGCCACAGAGCTGGAGG + Intronic
1105859183 13:24394623-24394645 TAGTTCAGCCACAGCACTGAAGG - Intergenic
1107301310 13:38968504-38968526 TGATGATGCCACCGAACTGTGGG - Exonic
1107964500 13:45587062-45587084 TGGTGCTACGACAGAACTGCCGG - Exonic
1108025868 13:46176976-46176998 TGCTGCAACCACAGAACTGTGGG + Intronic
1111701779 13:91698977-91698999 CTGTGATGCCACAGACCTGAGGG + Intronic
1111941780 13:94616418-94616440 AGGTGCTGCCCCAGAACCCAAGG + Intronic
1112397685 13:99048016-99048038 TGGTGCTGCCCCCAAACTGGAGG - Intronic
1114140728 14:19907466-19907488 TGATGCTGCCCCAGAGCTGTGGG + Intergenic
1117976013 14:61297686-61297708 TAGTGCTGCCACTGATCTGACGG + Intronic
1119543908 14:75458128-75458150 TGGTGCTGCTACAGCACTGTAGG - Intronic
1119561731 14:75595810-75595832 TGGTGCTGGCAAAAAGCTGAAGG - Intronic
1122580734 14:102770124-102770146 GGTGGCTGCCACAGAAGTGATGG - Intergenic
1123065035 14:105614345-105614367 TAATGCTGCCACTGATCTGACGG - Intergenic
1123088331 14:105729572-105729594 TAATGCTGCCACTGACCTGACGG - Intergenic
1123094283 14:105758941-105758963 TAATGCTGCCACTGATCTGACGG - Intergenic
1126232006 15:46338341-46338363 TGGGCCTGCCACAGAGATGATGG - Intergenic
1127804156 15:62503282-62503304 TGCTGGTGACACAGGACTGATGG - Intronic
1128675233 15:69603537-69603559 TGGGGCTGCCACAGGATTGTTGG - Intergenic
1130011875 15:80158550-80158572 AGCTGCTTCCACAGAACTGGAGG - Intronic
1130919182 15:88329867-88329889 TGCTGCTGACAGAGAAGTGAAGG - Intergenic
1131646867 15:94354203-94354225 AGGTGCTGAGACAGAACAGAAGG - Intronic
1133186895 16:4106394-4106416 CGGTGCTGCCGCGGAACAGAAGG - Intronic
1136288984 16:29260386-29260408 TGGGGCTGCCCCAGTGCTGAAGG - Intergenic
1138231969 16:55344564-55344586 TGGTGAAGTCACAGAACAGATGG - Intergenic
1138322260 16:56125689-56125711 TGGTGCCCCCACAGAGCTAATGG - Intergenic
1139122840 16:64041740-64041762 TGATGCTGCCATATAACTGTAGG - Intergenic
1139352369 16:66345063-66345085 TAATGCTGCCACTGATCTGACGG - Intergenic
1139840294 16:69873248-69873270 TGGTGCTGCCACAGAACTGAAGG - Intronic
1140605312 16:76529426-76529448 TTGTCCAGCCACAGAAATGATGG + Intronic
1140882500 16:79211637-79211659 TGCTGCTGTCCCAGAACTGGAGG + Exonic
1141154932 16:81590614-81590636 TGATGCTTCCATAGAACTTAGGG + Intronic
1142094717 16:88233313-88233335 TGGGGCTGCCCCAGTGCTGAAGG - Intergenic
1142189593 16:88711818-88711840 TGGTGCTGCCCCTGCACTGAGGG + Intronic
1145265633 17:21378414-21378436 AGGTGCCACCAGAGAACTGAGGG - Intronic
1145789158 17:27614240-27614262 TGGTGCGGCCACAGGACATAAGG - Intronic
1147178628 17:38671907-38671929 TGGAGCTGCCGAACAACTGAGGG - Exonic
1147369427 17:39981286-39981308 GGGTGATCCCAAAGAACTGAGGG - Intronic
1147620076 17:41860416-41860438 GGGTCCTGCCTCAGAGCTGATGG + Intronic
1149448484 17:56732115-56732137 TGGTGCTGCTAAAGATCTCAGGG + Intergenic
1154033225 18:10772315-10772337 TGTAGCTGCCACAGACATGAGGG + Intronic
1155885423 18:31202112-31202134 TGTTGATGCCACAGGACAGAGGG + Intergenic
1157749160 18:50162752-50162774 TGGTGCTGCCTCAGAAAGGTTGG - Intronic
1158289528 18:55923682-55923704 TAATGCTGCCACTGATCTGACGG + Intergenic
1160352088 18:78192220-78192242 AGGTGCTGCCTCAGCACTCAGGG + Intergenic
1160467523 18:79094081-79094103 TGGTGGTGAAACAGAACTGGGGG - Intronic
1165828894 19:38720762-38720784 AGGTGCTGGGACAGAGCTGAGGG + Intronic
1167617214 19:50541920-50541942 TGTTGCTGCTACAGAATTGATGG - Intronic
925153821 2:1635252-1635274 TGGTGCTTCCATAGGAGTGAAGG + Intronic
927333695 2:21895764-21895786 TGGTGCTTGCCCAGAGCTGAGGG - Intergenic
928397964 2:30957596-30957618 TGGTGCTGCCTCAGAACCTCTGG - Intronic
929409727 2:41684470-41684492 TAATGCTGCCACTGATCTGACGG - Intergenic
930337547 2:50069083-50069105 TGCTGCTGTCACAGAACACATGG - Intronic
932341541 2:70965322-70965344 CGGTGCTGCGGAAGAACTGAAGG + Exonic
934508165 2:94912810-94912832 TGGTGCTGGCAAAAAGCTGAAGG + Intergenic
935421392 2:102872591-102872613 TAGTGTTGGCACAGACCTGAAGG + Intergenic
936949728 2:117965868-117965890 TTTTTCTGCCAGAGAACTGATGG - Intronic
937595760 2:123671140-123671162 TGGTGCTGCCTAAGCACTGCAGG + Intergenic
937835001 2:126462608-126462630 TAGAACTGCCACAGAACTCAGGG + Intergenic
939867735 2:147492897-147492919 AGGTGCTGCCCCAGAACTCTTGG - Intergenic
941567553 2:167127917-167127939 GAGTGCTGCCCCAAAACTGAGGG + Intronic
941755090 2:169176463-169176485 AGGTGCTGCCACTCAGCTGAAGG + Exonic
942162944 2:173211305-173211327 TGGTGAGGCCACAGTAATGAGGG - Intronic
942399420 2:175585738-175585760 TGGTGCGGCCACAGGATGGATGG + Intergenic
947463697 2:230323735-230323757 TGGTGCTGCACAAGGACTGAGGG + Intergenic
947472543 2:230412298-230412320 TGGTGCTGCACAAGGACTGAGGG + Intergenic
947770756 2:232668398-232668420 TGGATCTGCCCCAGACCTGAGGG + Intronic
947848708 2:233266676-233266698 TGGTGCTGCCACAAACATGATGG - Intronic
1169074795 20:2753918-2753940 GGGTACTGCCCCAGAACTGAAGG - Intronic
1169142323 20:3233568-3233590 TGGTTCGCCCACAGAACTGGGGG - Exonic
1169149058 20:3275066-3275088 TGGTGCAGCCACAGAAAGTAGGG + Intronic
1170390468 20:15867719-15867741 TAGTCCTGCTAGAGAACTGAAGG + Intronic
1171191511 20:23162674-23162696 TGGGGCTGCGCCAGGACTGATGG + Intergenic
1171936400 20:31278655-31278677 TGGTGCTGGGAAAGAACTGGAGG + Intergenic
1175679806 20:60977649-60977671 GGGTGATGCCCCAGACCTGAGGG + Intergenic
1175729270 20:61342502-61342524 TAATGCTGCCACTGATCTGATGG + Intronic
1176091057 20:63318836-63318858 TGGTGGTTCCACAGAGCTGAGGG - Intronic
1176787846 21:13280482-13280504 TGGTGGTGCCACATAACAGGAGG + Intergenic
1177653258 21:23984721-23984743 GGGTGCTGCCCCAGGACTTATGG - Intergenic
1178908050 21:36652359-36652381 TGGTGCAGACACAGAACCCATGG - Intergenic
1179119041 21:38525694-38525716 TGGTGCTCCCACAGATATGCAGG - Intronic
1180019103 21:45109352-45109374 CGGTGGTGCCACAGGACTCATGG - Intronic
1180142140 21:45899119-45899141 AGATGCTGCCACAGTTCTGATGG - Intronic
1182335371 22:29580449-29580471 TGGTGCTGCCACGGCACAGCAGG + Intronic
950054488 3:10013522-10013544 TGGGGCTGCCACAGGGCTGCCGG + Intergenic
952286212 3:31972062-31972084 TGGTGCTGCCACCTCACTCAGGG + Intronic
954309100 3:49750762-49750784 TGCAGCTTCCACAGGACTGAGGG + Intronic
954503693 3:51047579-51047601 AGCTGATGCCACAGAAATGATGG + Intronic
954863413 3:53709100-53709122 GGGTGCAGCCACACAACAGAGGG - Intronic
956412702 3:68995145-68995167 TGGTGTTGCCAGAGTCCTGATGG - Intronic
956775551 3:72562549-72562571 TAGTGCTGCCACTTAACTGCTGG - Intergenic
958607652 3:96379362-96379384 TGATGCTGCCACAGAAGTAAAGG + Intergenic
960539294 3:118846473-118846495 TGGTCCAGCAACAGGACTGAGGG + Intergenic
961351738 3:126308504-126308526 CAGTGCTGACACAGAGCTGAGGG + Intergenic
961461388 3:127052474-127052496 TGGTGCTGCCATGGAGCTGTGGG - Intergenic
961618147 3:128200237-128200259 TGTTACCGCCACAGAACTGGAGG - Intronic
964132460 3:153305344-153305366 TAGTGCTACCATAGAACAGACGG - Intergenic
964433746 3:156631341-156631363 TCCTGCTGCCATAGACCTGAGGG - Intergenic
965097005 3:164242892-164242914 AGGTTCTGCAACAGAGCTGAAGG - Intergenic
968761775 4:2446051-2446073 TGGTTCTGCAACAGGACTAAGGG + Intronic
972308609 4:37856513-37856535 CCTTGCTGCCAAAGAACTGATGG + Intronic
982560047 4:156918564-156918586 TAATGCTGCCACTGATCTGACGG - Intronic
985537698 5:473986-474008 TGCTGCTCCCACGGAGCTGAGGG - Intronic
985930020 5:3049789-3049811 TGATGATCCCACAGACCTGACGG - Intergenic
985980152 5:3456186-3456208 GGGAGTTGCCACAGAACTGGAGG - Intergenic
986575166 5:9204834-9204856 TAATGCTGCCACTGATCTGACGG - Intronic
987212911 5:15702269-15702291 AAGTGCTGACTCAGAACTGAAGG + Intronic
989750169 5:44883897-44883919 TGGCGCTGGCACAAGACTGACGG - Intergenic
993902276 5:93592685-93592707 TGCTGCTGCTTCAGAACTGGGGG - Intronic
997222284 5:132179319-132179341 TGGTCCTGCCACAATTCTGATGG - Intergenic
997691981 5:135833318-135833340 TGGTGCTGACACAGGACTGAGGG + Intergenic
1001101293 5:168816569-168816591 TGATGCAGACACATAACTGAAGG - Intronic
1003265291 6:4560476-4560498 TGCTGCTGCCCCAGAACTTAGGG + Intergenic
1003621916 6:7708080-7708102 TTGTGCTGCCAAAGAGCAGAGGG + Intergenic
1005366291 6:25080974-25080996 TGGTGATGTCAAAGAACTGGTGG + Intergenic
1006847160 6:37070587-37070609 TGGCGATGCCAGAGCACTGAGGG - Intergenic
1007887939 6:45253898-45253920 TGGTGCTTCCACATAACTTTTGG - Intronic
1010900817 6:81424947-81424969 TGGTGATGCAGGAGAACTGATGG - Intergenic
1015461772 6:133499863-133499885 TGGTGCTTCCACAGGACGGCTGG - Intronic
1017622856 6:156317057-156317079 TACTGGTGCCACAGAACTGATGG + Intergenic
1018141601 6:160843077-160843099 TGGTGCATCCAGAGAAATGATGG - Intergenic
1019042864 6:169120826-169120848 TGGTCCAGCAGCAGAACTGATGG + Intergenic
1020627043 7:10594398-10594420 TTGAACTGCCAGAGAACTGATGG - Intergenic
1025145660 7:56500435-56500457 TGATGCTGCCAAAGACTTGAGGG - Intergenic
1025261488 7:57422650-57422672 TGATGCTGCCAAAGACTTGATGG - Intergenic
1025738810 7:64179852-64179874 TGATGCTGCCAAAGACTTGATGG - Intronic
1026956088 7:74377183-74377205 TGGGGCTGGCACAGACCTGAAGG + Intronic
1027162354 7:75811924-75811946 TGGGGTCGCCACAGAACTGCTGG + Exonic
1027507377 7:79034167-79034189 TGGAGCTGTCACAGGACTGAAGG + Intronic
1029217667 7:98962930-98962952 TGTGTCTGCCACAAAACTGAGGG - Intronic
1031030482 7:116728844-116728866 TGGTGCTGCCAGAGACATAATGG - Intronic
1031166496 7:118234748-118234770 TGGTGCAGACCCAGATCTGAGGG + Exonic
1032587830 7:133163979-133164001 CGATGCTGCCACTGATCTGATGG + Intergenic
1034437929 7:151071935-151071957 GGTTGCTGCTACAGAACTGGAGG - Exonic
1034833797 7:154332863-154332885 TGGTGCTTCCAAAGTACTGCAGG - Intronic
1035416117 7:158688558-158688580 TGGTGCTGACACAGCAAGGATGG + Intronic
1037663304 8:20944950-20944972 TTGTGCAGCCCCAGAACTGTGGG - Intergenic
1038260081 8:25985195-25985217 TGGTGTTGGCAGAGAAGTGAGGG - Intronic
1038293305 8:26268914-26268936 TTGTGCTGCAACAGCACTGTGGG + Intergenic
1038680960 8:29667615-29667637 TGCTGCTGCCCCAGAGCTGAGGG - Intergenic
1043114020 8:76225710-76225732 TGGTGGAGCCACAGAATGGAAGG - Intergenic
1045615809 8:103908997-103909019 TGGTGCTATAAAAGAACTGAAGG - Intronic
1046019250 8:108644433-108644455 TGGTCTTGGCACAGAACTGATGG + Intronic
1049452670 8:142670341-142670363 TGTGGCTGCCCCAGAACTGCAGG - Intronic
1053565000 9:39240156-39240178 TGGTGCTGCCACTTACCTGAAGG + Intronic
1053830778 9:42078033-42078055 TGGTGCTGCCACTTACCTGAAGG + Intronic
1054132150 9:61378883-61378905 TGGTGCTGCCACTTACCTGAAGG - Intergenic
1054599780 9:67109404-67109426 TGGTGCTGCCACTTACCTGAAGG - Intergenic
1055925444 9:81505668-81505690 TGAAGCTGCCACAGAAATTAAGG - Intergenic
1057339787 9:94189559-94189581 AGGTGATGCCACATAAATGATGG - Intergenic
1060973887 9:127754024-127754046 TGGTCCTCCCACACACCTGAGGG + Intronic
1062063568 9:134513468-134513490 TGGGGATTTCACAGAACTGATGG - Intergenic
1062114773 9:134802506-134802528 TGCTGCAGCCACAGAACTGAAGG + Intronic
1062606696 9:137351704-137351726 TGGTGCAGCCACAGAAAGCAGGG - Intronic
1186157158 X:6737622-6737644 AGGTGGGGCCACAGAAGTGATGG + Intergenic
1186573486 X:10740435-10740457 TGGTGATGCCATATGACTGACGG + Intronic
1187859001 X:23664263-23664285 GGGAGCTCCAACAGAACTGAGGG + Intronic
1194672657 X:96753855-96753877 TGATGTTGTTACAGAACTGATGG - Intronic
1195716795 X:107826118-107826140 TGGTGCTGCCCCTGGACTGAGGG + Exonic
1197222631 X:123928470-123928492 TGCTCCTGACACATAACTGAAGG + Intergenic
1199684440 X:150254086-150254108 TGGAGCTCCCACAGAAGGGAGGG + Intergenic