ID: 1139843462

View in Genome Browser
Species Human (GRCh38)
Location 16:69901378-69901400
Sequence TCTTTTCTTTAGGATGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 6, 3: 36, 4: 349}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139843459_1139843462 27 Left 1139843459 16:69901328-69901350 CCAGTGTATTCTTCTTAAGTTTA 0: 1
1: 0
2: 3
3: 20
4: 409
Right 1139843462 16:69901378-69901400 TCTTTTCTTTAGGATGTGAAAGG 0: 1
1: 0
2: 6
3: 36
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139843462 Original CRISPR TCTTTTCTTTAGGATGTGAA AGG Intronic
901720355 1:11192445-11192467 TCCTTTCTTTAAACTGTGAATGG - Intronic
903393778 1:22983751-22983773 GCTGTGCTTTAGGGTGTGAAAGG - Intergenic
904715214 1:32462818-32462840 TTTTTTCTTATGAATGTGAAGGG - Intergenic
904752562 1:32750015-32750037 CGTTTTCTTTAGCATGTGACAGG - Intronic
904863267 1:33556599-33556621 TCTTCTCTTAAGGACGTGTAAGG + Intronic
905011680 1:34751380-34751402 TCCTTTCTTTCGAATGTGGAAGG - Intronic
905846336 1:41236279-41236301 TCTCTTCTTTGGGATGGGAGGGG + Intronic
905884651 1:41485119-41485141 TCTGTTGTGTGGGATGTGAAAGG + Intergenic
907144276 1:52218629-52218651 TGTTTTATTTAGGGTGCGAATGG + Intronic
907631421 1:56086706-56086728 TTTGTTGTTGAGGATGTGAAGGG + Intergenic
908104111 1:60823807-60823829 TCTGTTCTCTAGAATGTCAAAGG + Intergenic
909594852 1:77395122-77395144 TTTTTTTTTTAGGATAAGAATGG + Intronic
909754971 1:79214404-79214426 TCTTTTCTTTATGTAGAGAAGGG + Intergenic
910015759 1:82521275-82521297 TCTTTTCTTTAGGATAAGAAGGG + Intergenic
911493385 1:98597832-98597854 ACTGTTCTTTAGGATCTGATTGG - Intergenic
911942982 1:104070870-104070892 TGTTTTATTTAAGATCTGAAGGG - Intergenic
912038932 1:105360067-105360089 TGTTTTCTTTAAGAAATGAATGG + Intergenic
912049089 1:105500911-105500933 TCTTTTCTTTTTATTGTGAATGG - Intergenic
912124859 1:106523213-106523235 TCTATCCTTTATGCTGTGAAAGG - Intergenic
913231918 1:116747039-116747061 GCTTTTGTTTAGTGTGTGAATGG - Intergenic
913423339 1:118697880-118697902 ACATTTCTCTAGAATGTGAATGG - Intergenic
915145340 1:153793376-153793398 TCTTCTCTTTAGGATGGGGCTGG + Intergenic
915866613 1:159506826-159506848 TCTTCACTTTAGGATGTCACTGG + Intergenic
918775330 1:188621833-188621855 TCTTTTCTTTAGCATATCATTGG - Intergenic
919248460 1:195019929-195019951 TTTTTTTTTTTGGATGGGAAGGG + Intergenic
921254965 1:213330770-213330792 TCTTTTCTTGAGAAGGTGAACGG + Intergenic
922504599 1:226119202-226119224 TCTTGGCTGTAGGTTGTGAAGGG - Intergenic
923916053 1:238506021-238506043 TCTTTTCTTTTTGATTTTAAAGG - Intergenic
1063812302 10:9725338-9725360 TCTTTTCTTCAGGATTAGCATGG - Intergenic
1064281189 10:13953027-13953049 TCTCTTCTGTAGGATGAGGATGG + Intronic
1065193655 10:23239347-23239369 TTTTTTCCTTTGGATGTGACTGG + Intronic
1065622485 10:27597249-27597271 TCTTTTGGTTAGCATGTGCATGG + Intergenic
1065807475 10:29408300-29408322 TATTTTCAGTAGGATGTGCAGGG + Intergenic
1065923753 10:30417344-30417366 TCTTTTCTTCAGAATAAGAAAGG + Intergenic
1065957085 10:30703505-30703527 CCTTTTCTGTAGGGTGGGAAGGG - Intergenic
1067387273 10:45827361-45827383 TCTTTTCTTCATAATGTGCACGG + Exonic
1067504209 10:46836479-46836501 TCTTTTCTTCATAATGTGCACGG - Intergenic
1067590379 10:47503514-47503536 TCTTTTCTTCATAATGTGCACGG + Exonic
1067637501 10:48011616-48011638 TCTTTTCTTCATAATGTGCACGG + Intergenic
1067688144 10:48480192-48480214 TCTTGTCTTCAGGATGGGGAAGG - Intronic
1067875992 10:50008718-50008740 TCTTTTCTTCATAATGTGCACGG - Exonic
1069633195 10:69910097-69910119 TGGTTTCTTTGGGATGTGGAGGG + Intronic
1070045520 10:72830924-72830946 TCTTTCCTTGAGGATTTGGAAGG - Intronic
1071014265 10:80976065-80976087 ACATTTCTTTTGAATGTGAATGG + Intergenic
1073576865 10:104633389-104633411 TCTTTTCTTTAGGAGGTAAATGG + Intergenic
1074500347 10:114017976-114017998 TCTATTCTGTAGGAAGTGGAGGG - Intergenic
1075003775 10:118816380-118816402 TCTTTTCTTTTGCATGTGAGTGG + Intergenic
1075239871 10:120768617-120768639 TCCGTGCTTTAGGATGTGCAAGG + Intergenic
1075462464 10:122626510-122626532 TTTTTCCTTTAGGATATAAATGG + Intronic
1075737676 10:124674047-124674069 TCTTTCCCTTAGGATATGAGAGG + Intronic
1076018037 10:127044867-127044889 TTTTTTCTTTATGCTGTGATGGG + Intronic
1077180663 11:1212315-1212337 TCTTTTCTACAGGATATAAAAGG + Intergenic
1077829177 11:5845720-5845742 TTTTTTCTCTAGTCTGTGAAGGG - Intronic
1078992385 11:16662979-16663001 ACTTTTTTTTAGGATGGGTATGG - Intronic
1079374466 11:19879765-19879787 TGATTTCTTTAGGATATGACAGG - Intronic
1082910683 11:58370870-58370892 TATTTTCTTTAGGAGATAAAAGG - Intergenic
1082995907 11:59255364-59255386 TCTTTACTTTAGAATGACAAGGG + Intergenic
1084467168 11:69331429-69331451 TCTTTTCTTTCTGATGAGTAGGG + Intronic
1085701461 11:78749726-78749748 GCCTTTCTATAGGGTGTGAATGG + Intronic
1086295259 11:85359846-85359868 TCTTTTCTTTTGTGTGTGACGGG - Intronic
1086451947 11:86925985-86926007 TCTTTACTTTCTGATGGGAAAGG - Intronic
1087325452 11:96716713-96716735 TGTATTTTTTAAGATGTGAAAGG + Intergenic
1087376934 11:97354334-97354356 TCTTTTTTTGAGGGTGAGAAAGG - Intergenic
1087409917 11:97778758-97778780 CCTTTTCTTTATGCTCTGAATGG - Intergenic
1090626546 11:128613691-128613713 TCTTTTCTACAGGAAGGGAAGGG - Intergenic
1090960821 11:131555216-131555238 TGTTATGTTTAGGATGTGTATGG - Intronic
1091147658 11:133293861-133293883 TTTTTTCTTTAGGATGTTAAGGG - Intronic
1091608747 12:1984055-1984077 TCTTTTCATTAGTATTTGCATGG + Intronic
1093629499 12:21391724-21391746 TTTTTTCTTTTGAATGTCAACGG - Intronic
1094488955 12:30946762-30946784 TCTTTTCTTTGGCCTCTGAAAGG - Intronic
1094664182 12:32502018-32502040 TCCTTCCTTTAGGATTTGCAAGG + Intronic
1095403265 12:41839370-41839392 TGTTTTCTTGAGGATGAGAGAGG - Intergenic
1095443588 12:42262006-42262028 TCTTTTTATTATGAAGTGAAAGG + Intronic
1096302242 12:50440427-50440449 TTTTCTTTTTAGGAAGTGAAAGG + Exonic
1096429230 12:51529709-51529731 TCCTTTCTTTGGAATGTGCAAGG - Intergenic
1096909979 12:54973646-54973668 GCTTTTCTTTAAGATATGAGAGG + Intronic
1098366759 12:69711828-69711850 TCTTGTCTCTAGGAAGGGAAAGG - Intergenic
1099317128 12:81098069-81098091 GCACATCTTTAGGATGTGAAAGG - Intronic
1101227257 12:102701703-102701725 GCTTTTCTTCTGGATGTGTAGGG - Intergenic
1102087509 12:110155194-110155216 TCTTTTGTTTACTATTTGAATGG + Intronic
1103770256 12:123317007-123317029 TCTTTTCTTTTGGTGGAGAAAGG + Intronic
1103857013 12:123978146-123978168 TTTATTCTTTAGGAAGAGAAGGG + Intronic
1103967440 12:124648871-124648893 TCTTTTCTTTGGAATGTGCAGGG - Intergenic
1104024994 12:125019245-125019267 TGTTTTCTTTAGGATTTTCAGGG + Intronic
1104088759 12:125496844-125496866 GACTTTCTTTAGGCTGTGAACGG + Intronic
1104537488 12:129631809-129631831 CTTTTTCTTTAGGATGCCAATGG - Intronic
1107083275 13:36397777-36397799 TCTTTTTTTTTGGAGATGAATGG - Intergenic
1107557270 13:41527805-41527827 TCTTTTCCTTAGGAAGTCAAGGG - Intergenic
1107751231 13:43569626-43569648 TCTTTTCCTTAGAATATAAAGGG + Intronic
1109312209 13:60709099-60709121 TCTATTCATTAGTATTTGAATGG + Intergenic
1109684669 13:65802020-65802042 TCTTTTCACTTGGATGTGACTGG + Intergenic
1109984513 13:69960950-69960972 TCTTTTCTTTTGGAAATGATGGG - Intronic
1110070670 13:71172938-71172960 TATTTTCTTTGGGATGGCAAAGG + Intergenic
1111129231 13:83953118-83953140 TTTGTTTTTTAGTATGTGAATGG - Intergenic
1114824137 14:26056464-26056486 TCATGTATTTAGGATGTCAAGGG + Intergenic
1116602157 14:46939748-46939770 TCTTCACTTTAGTCTGTGAAAGG - Intronic
1117561984 14:56949858-56949880 TCTTTTTATTTTGATGTGAAAGG + Intergenic
1118113533 14:62749522-62749544 TCTCTTCCTTAGGAGGGGAAGGG + Intronic
1119041981 14:71282612-71282634 CCTTTTCTGTAGGCTGTTAATGG + Intergenic
1119057027 14:71432990-71433012 TCTTTTGCTTAGAGTGTGAATGG + Intronic
1120034374 14:79680049-79680071 GCATTTCTTTAGCATGTGAATGG - Intronic
1120034379 14:79680085-79680107 TCATTTCCTTAGGATGTTATAGG - Intronic
1120520159 14:85518013-85518035 TTTTTTCTTTAGTATATGAATGG - Intergenic
1121412105 14:93755353-93755375 TCTTTTTTTTACGAGCTGAATGG + Intronic
1121533539 14:94675421-94675443 ACTTTTCTTTGGGATGGTAAAGG + Intergenic
1121945148 14:98113248-98113270 TCTGTTCCTTAGCAGGTGAAGGG - Intergenic
1123508899 15:20975323-20975345 TCTTTTCGTTATGATTTGCATGG + Intergenic
1123566121 15:21549072-21549094 TCTTTTCGTTATGATTTGCATGG + Intergenic
1123602381 15:21986359-21986381 TCTTTTCGTTATGATTTGCATGG + Intergenic
1126305461 15:47250652-47250674 TGTTATCTTTAAGAAGTGAAAGG + Intronic
1126795230 15:52254937-52254959 TCATTTCTTTAGCATTTGCAAGG - Intronic
1126850520 15:52794377-52794399 TCTTCTCTTTGGGATATGGAAGG - Intergenic
1126904540 15:53350153-53350175 TGTTTTCTTTATGATTTGATTGG - Intergenic
1127820183 15:62648033-62648055 TCTTTTATTTAGTATTTGACAGG + Intronic
1128426799 15:67550022-67550044 TTCTTTGTTTAGGATGTGATAGG + Exonic
1129043700 15:72713528-72713550 TCTTTTTTTTAGTAAGTGGAAGG + Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1131353111 15:91719394-91719416 TATCTTCTTTGGGATGTGAGCGG + Intergenic
1131575082 15:93581010-93581032 TCTTTTCTTTATGATCTTTATGG - Intergenic
1202974488 15_KI270727v1_random:276162-276184 TCTTTTCGTTATGATTTGCATGG + Intergenic
1135284788 16:21184136-21184158 TATTTTCTTTAGAAACTGAATGG + Intergenic
1135426178 16:22338672-22338694 TCTTTTCTTTCTGATGTGGGTGG - Intergenic
1135793050 16:25415755-25415777 TCTTTATTTTGGCATGTGAATGG - Intergenic
1135826325 16:25731715-25731737 TCCTTTCTTTGGAATGTGGAGGG + Intronic
1135878962 16:26234121-26234143 TCTTTTCTTTGCCATATGAATGG + Intergenic
1137383724 16:48022370-48022392 GCTTTTCTTTGGCCTGTGAAAGG + Intergenic
1139825729 16:69755764-69755786 TGTCTTCTTTAGGACATGAAGGG + Intergenic
1139843462 16:69901378-69901400 TCTTTTCTTTAGGATGTGAAAGG + Intronic
1141112120 16:81278444-81278466 GCTTTTCTTTGGGCTGTCAAGGG - Intronic
1142295866 16:89221833-89221855 TGTTTTCTTGAGGAAGTGTATGG + Intronic
1144112845 17:12054021-12054043 TCATTTCTTTAGGACTTAAAAGG - Intronic
1146300055 17:31681057-31681079 TCTTTTGGTTAGGATTTGCATGG - Intergenic
1146446019 17:32933618-32933640 CCTTTTCTTTAGGATCTCAGGGG + Intronic
1147905851 17:43822666-43822688 TTTTTTTTTTAGGATGGGAGTGG - Intronic
1149149567 17:53544117-53544139 TATTTTCTTTAGGATGGGTGCGG - Intergenic
1152086602 17:78223399-78223421 TCTTATCTACAGGATGTGACTGG + Intronic
1152777863 17:82213475-82213497 CCTTTTTCTGAGGATGTGAATGG - Intergenic
1153026084 18:674264-674286 TTTTTTCTTTCTGAAGTGAAAGG - Exonic
1153991157 18:10401967-10401989 TCTTTTCATTACGTTTTGAATGG - Intergenic
1155122246 18:22833326-22833348 TGTTTTCTTTAGGTTGTGCTTGG - Intronic
1155194235 18:23458285-23458307 TCATATCTTTAGGAAGTGGAAGG + Intronic
1156706105 18:39884339-39884361 TCTTCTCTATGGGAGGTGAAAGG - Intergenic
1157087974 18:44601592-44601614 TTTTTTCTTCAGGACTTGAAAGG + Intergenic
1157754859 18:50208572-50208594 TCCTTTCTTTGGAATGTGCAGGG + Intergenic
1158706788 18:59799704-59799726 TCTTTTCTTCTGGATTTGATGGG + Intergenic
1160154441 18:76422876-76422898 GCTTTTCTTAAGGATTTGTATGG - Intronic
1161676658 19:5654356-5654378 TCTTTTCTGTAGGAAGTCGAGGG + Exonic
1164361897 19:27522088-27522110 TCTTTTCTTGAAACTGTGAAGGG + Intergenic
1164492697 19:28729146-28729168 TCCTTTCTTTAGGATATGGAGGG - Intergenic
1166441052 19:42815806-42815828 TCTGTGTTTTAGGATGGGAATGG - Intronic
1166460525 19:42984413-42984435 TCTGTGTTTTAGGATGGGAATGG - Intronic
1166702324 19:44889234-44889256 CCTTTTCTGTGGGATGTGAAGGG + Intergenic
926164576 2:10512492-10512514 TTTTTTCTTAAAAATGTGAAAGG - Intergenic
926316975 2:11717011-11717033 TCTTGTCTTTAGGTTGGGAAAGG + Intronic
928436766 2:31259575-31259597 TTTCTTCCTTAGGATGTGACTGG - Intronic
929169799 2:38920353-38920375 TTTTCTCTCTAGGTTGTGAATGG + Intronic
930072408 2:47377740-47377762 TATTTACTTTAGGATGTTACTGG + Intronic
931019002 2:58021365-58021387 TTTTTTATTTTGGATATGAAGGG - Intronic
931542412 2:63344046-63344068 TTTTTTCTTTTTTATGTGAATGG + Intronic
932369467 2:71175405-71175427 TCCTTTTTTTGGGATGTGCAGGG - Intergenic
933088458 2:78087775-78087797 CCTTTTCTTTAGGGTCTAAAAGG - Intergenic
933641468 2:84765884-84765906 TCTTTTCATTAGTATTTGCATGG - Intronic
934603063 2:95672966-95672988 TCTTTGCTTTAGGATCTAGATGG - Intergenic
934971022 2:98764444-98764466 TCATTTCCTTTGGATGTGTATGG + Intergenic
935330521 2:101974210-101974232 TGTTTTCTTTGGGAATTGAATGG + Intergenic
935539530 2:104333413-104333435 TCTTTTCTTCAGGATGAAACAGG - Intergenic
936380379 2:111980113-111980135 TCTTTTCTAGAGGAAGTGAGCGG - Intronic
936536447 2:113315163-113315185 TCTTTGCTTTAGGATCTAGATGG - Intergenic
937838606 2:126499947-126499969 TCTTTTGTTTAGTACTTGAATGG - Intergenic
938547581 2:132348508-132348530 GCTTTTCTTTAAGATGGGAATGG - Intergenic
939430728 2:142103493-142103515 TATGTTCTTTGGTATGTGAAAGG + Intronic
939797061 2:146658149-146658171 TCCTTTCTTTAGAAGGTAAAGGG - Intergenic
939931838 2:148244961-148244983 TCTTTTGTTTAAGATGGCAAAGG - Intronic
942226300 2:173819467-173819489 TCTTTTCTTTATGAAGTGTAGGG - Intergenic
943326631 2:186506691-186506713 TCTTTTCTATATGTTGTTAAAGG + Exonic
943805704 2:192122460-192122482 TCTTTTCTTAAGAATGGGATAGG + Intronic
944609051 2:201381454-201381476 TCTTTTCAGTGGGATATGAAAGG + Intronic
944708504 2:202314725-202314747 TACTTTCTTTAGTATGTAAAGGG + Intergenic
944956697 2:204820365-204820387 TCTGTTGTTTAGGATGGGCATGG - Intronic
944977653 2:205074713-205074735 GCTTTTCTTTAGTCTGTAAATGG + Intronic
945979211 2:216295597-216295619 TCTTTTTGTTAGCATGTGAAGGG - Intronic
946104960 2:217360947-217360969 TCCTTCCTCTAGGCTGTGAAGGG - Intronic
946745371 2:222839984-222840006 TTTTTTTTTTAATATGTGAATGG - Intergenic
947165070 2:227253549-227253571 TTTTGTCTTTAGGGTGTGAAAGG + Exonic
947165383 2:227256331-227256353 TCTTTTCTTTAGGGAGTCAAGGG + Exonic
948053509 2:234995204-234995226 TCTGTCCTCCAGGATGTGAAGGG + Intronic
1169002863 20:2180563-2180585 TGTTCTGTTTAGGATGAGAACGG + Intergenic
1169765680 20:9145561-9145583 TCTTTTCTTGAGGTTGGGCAGGG + Intronic
1170139138 20:13107950-13107972 TGTTTTCTTAAGGATGTTAAAGG + Intronic
1170328632 20:15183753-15183775 GCTTTTGTTCAGGATGTGATTGG - Intronic
1171490923 20:25516656-25516678 TTCCTTCTTTAAGATGTGAAAGG - Intronic
1171876448 20:30581264-30581286 GCTTTTCTTTAAGATGGGAATGG - Intergenic
1172905615 20:38366971-38366993 TCTGTTATTTAGGCTTTGAAAGG - Intronic
1173022497 20:39278722-39278744 TCTTATTTAAAGGATGTGAAGGG - Intergenic
1173266922 20:41492382-41492404 TGTTTTCTTTGGCATATGAAAGG - Intronic
1174719475 20:52796613-52796635 TCTGTCCTTTAGGCTGTCAAAGG + Intergenic
1174904532 20:54536717-54536739 TCTCTTCTTTAGTGTTTGAATGG - Intronic
1174961334 20:55160475-55160497 TCCTTTATTTAGAATGTGTAGGG + Intergenic
1175266230 20:57705055-57705077 TCTTCTCTTTGGGTTGGGAATGG - Intronic
1176890429 21:14311215-14311237 TGTTTTCATTTGTATGTGAAAGG + Intergenic
1177037876 21:16067149-16067171 TCATCTTTATAGGATGTGAAAGG - Intergenic
1177454135 21:21313522-21313544 TCTTTTGATTAGCATTTGAATGG + Intronic
1177887397 21:26762853-26762875 TCCTTGCTTTAAGGTGTGAAAGG + Intergenic
1177941246 21:27414100-27414122 CCTTTTAGTTAGCATGTGAATGG + Intergenic
1178137645 21:29645984-29646006 TCTTCTCTTTGGAATGTGCAAGG - Intronic
1178755249 21:35343324-35343346 CCTTGTCTTTAGGCTGTTAATGG + Intronic
1181660321 22:24342315-24342337 TCTCTGCTTAAGTATGTGAAGGG + Intronic
1181993131 22:26853080-26853102 TCTTGTCTTGCGGATGTGATGGG + Intergenic
1182138004 22:27924139-27924161 TCTTTTCTTTTTGATTTGTAGGG + Intergenic
1182186759 22:28412175-28412197 TCTGTTCTTTAGAAGATGAATGG + Intronic
1182252408 22:29011581-29011603 TTTTATCTTTAGGTTCTGAATGG + Intronic
1184271066 22:43384379-43384401 TTTTTTCTTTAAGCTGTTAATGG - Intergenic
1184546764 22:45175486-45175508 TCATTTCTTTAGGCAGTAAATGG + Intronic
1185304838 22:50109159-50109181 TTTCTTCTTTGGGATGTGAAAGG + Intronic
1185355035 22:50363309-50363331 TCTGTGCTTTAGGATGTGGCAGG + Intronic
949214144 3:1545152-1545174 TCATTTCTTTATGATGTTGATGG + Intergenic
950500319 3:13359557-13359579 CCATTTCTTTGGGACGTGAAGGG - Intronic
951708048 3:25563953-25563975 TTTTTTTTTTTTGATGTGAAAGG + Intronic
952304162 3:32130647-32130669 TCTTTTCATTCGGATCTAAAGGG - Intronic
953160256 3:40412759-40412781 TCTTTTCATTATCATGTTAAAGG - Intronic
954244641 3:49321329-49321351 ACTATTCTTGAGGATGAGAAAGG - Intronic
955013188 3:55040083-55040105 TCTCTTCTTTAGTTAGTGAATGG + Intronic
955036539 3:55273597-55273619 TCTTTCCTTTTAGATGGGAAAGG - Intergenic
957300298 3:78383248-78383270 TGTTTAATTTAGGATTTGAATGG - Intergenic
957342005 3:78912084-78912106 TTTTTTCTTTAAGCTGTGTAAGG - Intronic
958208977 3:90443533-90443555 TCTTTTTTTTAGAATATGCAAGG - Intergenic
958706277 3:97660366-97660388 TCATTTCTTTCCAATGTGAATGG - Intronic
959476498 3:106818598-106818620 GCTTTTGCTTAGGATGTAAAAGG - Intergenic
959810840 3:110617453-110617475 TCTTTTCTTTTGAATATTAATGG - Intergenic
961225204 3:125238108-125238130 ACTTTTGTTTATGATGTGAGAGG - Intronic
961413449 3:126740487-126740509 CATTTTCTTTGGGGTGTGAAGGG - Intronic
962115759 3:132505693-132505715 TCTTTTCGCTAGTAAGTGAAAGG + Intronic
963471134 3:145743417-145743439 TCTCTTCTTTAGGTTCTGACTGG + Intergenic
963664925 3:148170696-148170718 TACTTTCTTTAGGATTTGACTGG + Intergenic
964784468 3:160379969-160379991 TCTTTTCCTTTGCATGTGGATGG + Intronic
965400458 3:168206818-168206840 TCTCATCTTTAAGATGGGAATGG + Intergenic
966474405 3:180326881-180326903 TGTTTTCTTTAAAATGTGAAGGG + Intergenic
967353593 3:188543076-188543098 TCTTTCCTTTAGGATGTGACTGG + Intronic
967469110 3:189842303-189842325 TCTTCTCTTTAAGATGTTATTGG - Intronic
967560945 3:190919437-190919459 TCTTTGCTTTATAATGTTAATGG + Intergenic
967710384 3:192700429-192700451 TCTTTTTATTATGATGTGACAGG - Intronic
969685970 4:8674492-8674514 TCTTTTCTTTCTGACGAGAAAGG - Intergenic
969697915 4:8745655-8745677 TCTTTTTTCCAGGATGTGCACGG - Intergenic
970135773 4:12921794-12921816 TTTTTTCTGAAGGCTGTGAAGGG - Intergenic
970435428 4:16029652-16029674 TCTTTTCTTTAGGGGGTGAAGGG - Intronic
970842813 4:20495133-20495155 TCTTTTCTTTACAGTCTGAAAGG - Intronic
971065828 4:23031765-23031787 TATTTTCTTTGGGATTTCAATGG - Intergenic
971067163 4:23046010-23046032 TCTTTACTTTTGGATGTGTGTGG + Intergenic
971746881 4:30592636-30592658 TCTTTTCTTTTGTATTTGCATGG + Intergenic
972874999 4:43347886-43347908 TCTTGTCTATAGGATGTCATTGG - Intergenic
974128540 4:57725297-57725319 CCTCTTCCTTTGGATGTGAAAGG - Intergenic
974380408 4:61132577-61132599 TCTTTTCTCTAGTAGGAGAATGG - Intergenic
975084460 4:70320968-70320990 TCTTTTATTTTGGAAGGGAAAGG - Intergenic
975196280 4:71527844-71527866 TTTGTTCTTTAGCATGTAAATGG + Intronic
975461452 4:74658426-74658448 TCTATTCTTTGGGTTGAGAATGG - Intergenic
975793487 4:77982901-77982923 TTTCTTCTTTAGGATGTTGAGGG - Intergenic
977705854 4:100069150-100069172 TCTTTTCCTTAAGATGGGTATGG - Intergenic
978298414 4:107236365-107236387 TATTTTCTTCTTGATGTGAAGGG + Intronic
978415567 4:108472278-108472300 AATTTTCTTTAGCAGGTGAATGG + Intergenic
978449583 4:108817156-108817178 TCTTTTCTTTGGAATGGAAAGGG - Intronic
979830794 4:125298795-125298817 TCCTTTCTTTGGAATGTGCAAGG + Intergenic
980097582 4:128508353-128508375 TCTTTGCTTTGGAATGTGATTGG + Intergenic
980923228 4:139108591-139108613 TTTTTTTTTTAGAATATGAATGG - Intronic
981240559 4:142471804-142471826 TCTGTTCTTTAGGATTTTAGTGG + Intronic
982136307 4:152277243-152277265 TTTCTTCTGTAGGAAGTGAATGG - Intergenic
982730964 4:158954837-158954859 TTTTTTCTCTAAGAGGTGAATGG - Intronic
982791272 4:159594433-159594455 TCTTTTCTTTAAGAAATCAAAGG - Intergenic
983488576 4:168361201-168361223 TGTTCTCTTTAGGATGCGTATGG - Exonic
983532828 4:168829465-168829487 TCTGCTCTTTATGTTGTGAAAGG + Intronic
984191369 4:176609905-176609927 ACTCTTCTTTAATATGTGAAAGG + Intergenic
984384825 4:179042887-179042909 TTTTTTCTTTAGGATTTTAAGGG + Intergenic
984936617 4:184895374-184895396 TCTTTTTTGTAGGATGGGGAGGG + Intergenic
985789758 5:1919180-1919202 GCTTTAGTTGAGGATGTGAAAGG - Intergenic
986391444 5:7290959-7290981 GCTTTTTTTTAGGGTGTGTAAGG + Intergenic
987245348 5:16042791-16042813 ACTATTCCTTAGGATGAGAAGGG - Intergenic
987488621 5:18550526-18550548 TCCTTTCTTTAAGCTATGAAAGG + Intergenic
987513229 5:18870273-18870295 TTTTTTCTGTAGGGTTTGAAAGG - Intergenic
987741892 5:21919879-21919901 TCTTTTCTTAAATATTTGAAGGG - Intronic
989453324 5:41612513-41612535 GCTTTTCTTGAGGCTGTGAGTGG + Intergenic
989749515 5:44876323-44876345 TTTTTTCTTTGGCATGAGAAAGG + Intergenic
990894337 5:60681640-60681662 CCTTTTCTTTGAGATGTTAATGG - Intronic
991072025 5:62494204-62494226 TCTTTTCTTTATGATGTTTATGG + Intronic
991193383 5:63902578-63902600 TCATTTCTTTAGGAATGGAATGG - Intergenic
992141836 5:73805196-73805218 TCTTTTTTTTAGGGTGGTAAAGG + Intronic
992430379 5:76704955-76704977 GGTTTTCTTTAGGAACTGAAGGG - Intronic
993333425 5:86627695-86627717 TTTTTTTTGGAGGATGTGAAGGG - Intergenic
993514488 5:88813802-88813824 TCTTTGTTTTAGGATGTGTTTGG + Intronic
993600206 5:89913514-89913536 TCATTTCTTTTGTGTGTGAATGG - Intergenic
993651771 5:90530026-90530048 AATTTTCTTTAGGGTGGGAAAGG + Intronic
993894503 5:93516456-93516478 TACTTTCTTTAGAATGGGAAGGG - Intergenic
994360928 5:98847465-98847487 TCTGTCCTTCAGTATGTGAAGGG + Intergenic
994924733 5:106100120-106100142 ACTTTTCTCTAGAATGTGCATGG - Intergenic
995351005 5:111175552-111175574 TCATCTCTTTAGAATGTGTAGGG + Intergenic
995901151 5:117067766-117067788 TCTTATCTCTAGGCTCTGAATGG + Intergenic
995957207 5:117792072-117792094 TTTCTTCTTTAGTAAGTGAATGG + Intergenic
996214519 5:120850501-120850523 TCTTTTATTTGGGAGGAGAAAGG - Intergenic
997793316 5:136782645-136782667 TCTTTCCTCTAGGTGGTGAATGG + Intergenic
998377945 5:141703382-141703404 GCTTTTATTAAGGGTGTGAAGGG + Intergenic
998892072 5:146757028-146757050 TCTTGTTTTTAGGATGTGAAAGG + Intronic
999785230 5:154884428-154884450 GCTTTTATTTAGGGTGTGAATGG - Intergenic
1000150935 5:158500275-158500297 TCTTTTCTTTACCAGCTGAACGG + Intergenic
1002317729 5:178354764-178354786 TCTTTTCTTTAGGTTGGGTGTGG + Intronic
1002807196 6:588650-588672 TCTTTTCATTAGAAAGTGAAGGG - Intronic
1003568970 6:7243608-7243630 TCAGTTGTTTAGAATGTGAAGGG + Intronic
1003702611 6:8485889-8485911 TCTTTTATTTAAAAAGTGAATGG + Intergenic
1004264048 6:14133653-14133675 TCTCTTCTTTACGCTGTGCAGGG - Exonic
1004995738 6:21190682-21190704 TCTTTGCCTTAGGAAGAGAATGG + Intronic
1005273446 6:24190943-24190965 TCTCTTCTTTAAGATGTACAGGG + Intronic
1005916036 6:30352402-30352424 TCTTTTCTTTTTGCTTTGAAGGG + Intergenic
1007004755 6:38350336-38350358 TATTGTCTTTAGTATGTTAAAGG - Intronic
1008984412 6:57525186-57525208 TCTTTTTCTTAGGATCTGAAGGG - Intronic
1010766717 6:79783542-79783564 TATTTTCTTTTGAATGTGAAAGG + Intergenic
1011091677 6:83609691-83609713 TCTCTTTTTTACCATGTGAAAGG - Intronic
1011706815 6:90008846-90008868 TCTTTCTTTCAGGGTGTGAACGG - Exonic
1016017682 6:139203305-139203327 TCTTTGAATTAGGCTGTGAAAGG - Intergenic
1016166736 6:140954556-140954578 TCATTTGTTTAGGAATTGAAAGG + Intergenic
1017056148 6:150437158-150437180 ACATTTCTTTTGAATGTGAACGG - Intergenic
1017674630 6:156800082-156800104 TCTTTTGATGAGAATGTGAAAGG + Intronic
1017769537 6:157634535-157634557 CCTTTTCTTTAGGAAGGGAGAGG - Intronic
1017982609 6:159414456-159414478 TCATTTCTTTTAGATGAGAAGGG + Intergenic
1018327760 6:162692290-162692312 TCTTTTCTTTAGAATGTGTGTGG - Intronic
1020286479 7:6685462-6685484 GCTGTTCTGAAGGATGTGAATGG - Intergenic
1021022359 7:15618074-15618096 ACTTTGCTTTATCATGTGAATGG - Intronic
1021163886 7:17309765-17309787 TGTTTTTCTTAAGATGTGAAAGG + Intronic
1021961165 7:25874517-25874539 TCTTTTGTTTAGGATGGACAGGG + Intergenic
1022088175 7:27088545-27088567 TCTTTCCTTTAGGATGCGCAGGG - Intergenic
1023080614 7:36522944-36522966 TCCTTCCTTTGGGATGAGAAGGG - Intronic
1023229931 7:38016594-38016616 TCTTGTTTTTAGGATGGGAGTGG + Intronic
1024477572 7:49829846-49829868 TCTTTCTGTTAGGATGGGAATGG + Intronic
1024528874 7:50373952-50373974 TCTGATCTTCAGGATCTGAAGGG + Intronic
1024693701 7:51833029-51833051 TATTGCCTATAGGATGTGAATGG - Intergenic
1024712214 7:52028879-52028901 TCTCTTCTTTAGGCAGTGAATGG - Intergenic
1025872901 7:65451603-65451625 TCTTTTCTTTAAGATCTCCAAGG - Intergenic
1028025839 7:85837685-85837707 TTTTTTCATTTGGATGTGTAAGG + Intergenic
1028739406 7:94255552-94255574 TCTTTTCTTGAAAATGTTAAAGG + Intergenic
1029915363 7:104203435-104203457 TCTCTGGTTTAGGATATGAAAGG + Intronic
1031521639 7:122773827-122773849 TCATTTCTTTAAAATGTGAAAGG - Intronic
1031586724 7:123539332-123539354 TCTTTCCTTTGGGATGAAAATGG - Exonic
1033647354 7:143315758-143315780 TCTCTTCTTCAGGATGCGGAAGG - Intergenic
1035051778 7:156003069-156003091 TCTTTGCTTTAGGAAGAAAAAGG - Intergenic
1036506594 8:9362333-9362355 TCTTTTTTTTAGGATATTAATGG - Intergenic
1038923370 8:32110927-32110949 TCTTATCATTAGAAAGTGAAAGG + Intronic
1041751278 8:61263607-61263629 TCTTTTTTTGATGAAGTGAATGG + Intronic
1041875323 8:62681330-62681352 TTTTTTCTTTAGGAAGGGAAAGG - Intronic
1042366961 8:67948174-67948196 ACTTTTTTTTAGGAAGTGATGGG + Intergenic
1043108863 8:76152093-76152115 TCCTTCCTTTAGCATGTGTATGG - Intergenic
1044161909 8:88929375-88929397 CTCTTTCTTGAGGATGTGAAAGG + Intergenic
1044658815 8:94575456-94575478 GATTTTCTTTAGTAGGTGAATGG + Intergenic
1044659063 8:94578015-94578037 TCTTTTCTTTTGGAGGGAAAGGG + Intergenic
1044690440 8:94871640-94871662 TCTTTTCTTCAGAATGTCAAAGG - Intronic
1046572764 8:115987418-115987440 TCTTATCTTTACCATATGAAAGG + Intergenic
1046677702 8:117129761-117129783 TCTTTGCTTTAGATTCTGAATGG + Intronic
1047174722 8:122529469-122529491 TCATTTATTTAGCAAGTGAAGGG + Intergenic
1049134377 8:140881688-140881710 GCTTTTTCTTAGGATGTGAATGG - Intronic
1050288816 9:4131921-4131943 TATTTTCTTTAGAAAGAGAATGG - Intronic
1050429427 9:5547083-5547105 TCTCTTCCATAGGATGTAAAAGG + Intronic
1051400064 9:16671419-16671441 CCTGTTCTTTTGGATGTGAAAGG - Intronic
1051405136 9:16728946-16728968 TCTTTTCTTAACGATTTGAAAGG - Intronic
1051952187 9:22649157-22649179 TTTTTTCTTTAGGTTTTGAGAGG - Intergenic
1052130667 9:24842683-24842705 TCTTTTTTTTTGCATGTGGATGG + Intergenic
1052873012 9:33525948-33525970 TCTTTTCTTGTGGATTTGATTGG - Intronic
1053229839 9:36398936-36398958 TCTTTTTTTGAGGCTGTGAGTGG - Intronic
1053503088 9:38618793-38618815 TCTTTTCTTGTGGATTTGATTGG + Intergenic
1055521478 9:77085448-77085470 GCTTTTCACTAGGATGTGGAAGG - Intergenic
1056390154 9:86133526-86133548 TCTTTTCTTTAACATTTTAAGGG + Intergenic
1057153040 9:92811118-92811140 TCTTTTCTTGTGGATTTGATTGG - Intergenic
1057683551 9:97214237-97214259 TCTTTTCTTTCGGATTTGATTGG + Intergenic
1057736939 9:97671294-97671316 TGTTTCCTTTAAGAAGTGAAAGG - Exonic
1059163410 9:112056610-112056632 GTTATTCTTTAGGATGTTAAAGG - Intronic
1059645292 9:116260212-116260234 TCTTTTGTTTTTGGTGTGAAAGG - Intronic
1060009535 9:120031535-120031557 TTCTTTCTTTAGGATGTTGAGGG + Intergenic
1185648923 X:1634603-1634625 TCCTCTCTTTAGAATGTGGAGGG + Intronic
1186336055 X:8589871-8589893 TTTATTCTTTAGGATGTCTAAGG + Intronic
1187405191 X:18997341-18997363 TCTTCTCATTAGAATATGAATGG - Intronic
1188427520 X:30066609-30066631 TCTTTTCTTTAGCACTTTAAGGG - Intergenic
1188687496 X:33086565-33086587 TATTTATTATAGGATGTGAAAGG + Intronic
1189608073 X:42701492-42701514 TCTTTATTCTAGGATGTGATAGG - Intergenic
1190689200 X:52899453-52899475 TATTTTCTTTTGTAGGTGAAAGG + Exonic
1190696783 X:52956339-52956361 TATTTTCTTTTGTAGGTGAAAGG - Exonic
1190907737 X:54745329-54745351 ACATTTCTTTAATATGTGAAAGG + Intergenic
1192458924 X:71300799-71300821 TGTCTTCTTTAGGACATGAAGGG - Exonic
1193798115 X:85901548-85901570 TCTTTTCTTAGAGCTGTGAAGGG - Intronic
1194018151 X:88651991-88652013 TCCTTTCCTAAGGATGGGAAGGG + Intergenic
1194525088 X:94968258-94968280 GCTTTTCTTTAGGGTGAGATTGG - Intergenic
1197496857 X:127195098-127195120 TGTTTTCCTTAGAGTGTGAATGG + Intergenic
1198005687 X:132490131-132490153 TCATTTCATTAGGAAGGGAAAGG + Intergenic
1198160281 X:134001146-134001168 TCTTTTCTTTAAGATCTCCAAGG + Intergenic
1198844109 X:140891100-140891122 TCTTTTCTGTAGGAGATGAAAGG - Intergenic
1199056310 X:143299180-143299202 TCTTTTCTTTGGAAGGTGGAAGG - Intergenic
1201282460 Y:12353504-12353526 TCTTTTCTTTTTGTTGGGAAGGG - Intergenic
1201619010 Y:15934284-15934306 TATTTTTTTAAGGATGTGGAGGG + Intergenic
1201915889 Y:19180921-19180943 ACTTTTATTTAGATTGTGAATGG - Intergenic