ID: 1139848829

View in Genome Browser
Species Human (GRCh38)
Location 16:69938749-69938771
Sequence CTCTAAAAGCAGAACGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 158}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139848825_1139848829 8 Left 1139848825 16:69938718-69938740 CCATTAAGCAGTCACTCCCATAT 0: 1
1: 4
2: 9
3: 112
4: 484
Right 1139848829 16:69938749-69938771 CTCTAAAAGCAGAACGTGGATGG 0: 1
1: 0
2: 0
3: 15
4: 158
1139848823_1139848829 16 Left 1139848823 16:69938710-69938732 CCTTATACCCATTAAGCAGTCAC 0: 5
1: 33
2: 123
3: 299
4: 479
Right 1139848829 16:69938749-69938771 CTCTAAAAGCAGAACGTGGATGG 0: 1
1: 0
2: 0
3: 15
4: 158
1139848822_1139848829 23 Left 1139848822 16:69938703-69938725 CCAAAAACCTTATACCCATTAAG 0: 1
1: 0
2: 4
3: 24
4: 202
Right 1139848829 16:69938749-69938771 CTCTAAAAGCAGAACGTGGATGG 0: 1
1: 0
2: 0
3: 15
4: 158
1139848824_1139848829 9 Left 1139848824 16:69938717-69938739 CCCATTAAGCAGTCACTCCCATA 0: 1
1: 5
2: 16
3: 108
4: 405
Right 1139848829 16:69938749-69938771 CTCTAAAAGCAGAACGTGGATGG 0: 1
1: 0
2: 0
3: 15
4: 158
1139848820_1139848829 25 Left 1139848820 16:69938701-69938723 CCCCAAAAACCTTATACCCATTA 0: 1
1: 1
2: 6
3: 55
4: 289
Right 1139848829 16:69938749-69938771 CTCTAAAAGCAGAACGTGGATGG 0: 1
1: 0
2: 0
3: 15
4: 158
1139848826_1139848829 -8 Left 1139848826 16:69938734-69938756 CCCATATTTAGTCATCTCTAAAA 0: 1
1: 0
2: 7
3: 56
4: 688
Right 1139848829 16:69938749-69938771 CTCTAAAAGCAGAACGTGGATGG 0: 1
1: 0
2: 0
3: 15
4: 158
1139848827_1139848829 -9 Left 1139848827 16:69938735-69938757 CCATATTTAGTCATCTCTAAAAG 0: 1
1: 0
2: 2
3: 32
4: 402
Right 1139848829 16:69938749-69938771 CTCTAAAAGCAGAACGTGGATGG 0: 1
1: 0
2: 0
3: 15
4: 158
1139848821_1139848829 24 Left 1139848821 16:69938702-69938724 CCCAAAAACCTTATACCCATTAA 0: 1
1: 1
2: 7
3: 46
4: 231
Right 1139848829 16:69938749-69938771 CTCTAAAAGCAGAACGTGGATGG 0: 1
1: 0
2: 0
3: 15
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139848829 Original CRISPR CTCTAAAAGCAGAACGTGGA TGG Intronic
901328043 1:8380925-8380947 CTCAAGAAGCCGAACGTGGTAGG - Intronic
902096735 1:13951812-13951834 TTATAAAAGCAGAAAGTGGGTGG - Intergenic
905240204 1:36576355-36576377 GTCTGAGAGCAGAACGTGGGTGG + Intergenic
906265875 1:44428943-44428965 CTCTAAAAACAGAATGGGGCAGG - Intronic
914978334 1:152388143-152388165 CTCTAAAAGTAGAATGAGGTTGG - Intergenic
915869852 1:159547125-159547147 CTCTAAACTCTCAACGTGGATGG - Intergenic
917356822 1:174134129-174134151 CTCTAAAAGCAGAACCTCTTAGG + Intergenic
917587451 1:176442160-176442182 CGCTAAAGGCAGAATGTGGCTGG - Intergenic
918028106 1:180773736-180773758 CTCTTAAAGCAAAACATGGAGGG - Intronic
918200274 1:182259832-182259854 CTCTAAAACAAGAAAGTGGAGGG - Intergenic
923868600 1:237966330-237966352 CTAAAAAAGGAGAACATGGATGG + Intergenic
1063095729 10:2907362-2907384 CTCTCAGAGCAAAACGTGGAAGG - Intergenic
1066477457 10:35761733-35761755 CTCTGAGAGCAGAGCATGGATGG + Intergenic
1067656166 10:48193243-48193265 CTGTAAAAGCAGAAAGCAGAAGG - Intronic
1069491408 10:68864218-68864240 CTCAAAAAGCAGAACTTGGCCGG - Intronic
1073184412 10:101607146-101607168 CACAAAAAGCAGAACCAGGAGGG - Intronic
1073940419 10:108691619-108691641 CTCACATAGCAGAAGGTGGAAGG + Intergenic
1075921134 10:126214554-126214576 CTCTAAAAGAAGATTCTGGAGGG + Intronic
1076985466 11:232994-233016 CTCTACACGCAGAACATCGATGG - Exonic
1077365376 11:2159403-2159425 CTCTAAAAATAGAACCTGGGAGG + Intronic
1078249721 11:9607141-9607163 CAGTTAAAGCAGAAAGTGGAGGG + Intergenic
1078795513 11:14588351-14588373 CTCTAACAGGAGTAGGTGGAGGG + Intronic
1079254019 11:18810916-18810938 CTCTCACAGCTGAACGTGGCTGG + Intergenic
1079343930 11:19635565-19635587 CACTCATGGCAGAACGTGGAAGG + Intronic
1079395297 11:20057095-20057117 TTGAAAAAGCAGAATGTGGAGGG + Intronic
1080245294 11:30173162-30173184 CTCTGAAAGCAGGAAGTGTAGGG - Intergenic
1082091456 11:48093420-48093442 CAATAAAAGCAGCACATGGATGG - Intronic
1083513871 11:63237454-63237476 ATCTCACAGCAGAAGGTGGAAGG - Intronic
1088314034 11:108488997-108489019 CTGTAAAAGCAAAACTTGGAAGG + Intronic
1088640703 11:111870678-111870700 CCTTAAAAGCAGGAAGTGGAAGG - Intronic
1089330709 11:117687067-117687089 GTCTACATGCAGAATGTGGATGG + Intronic
1092752597 12:11732689-11732711 CTCTAGAGGCAGAAGGAGGACGG - Intronic
1093875511 12:24344789-24344811 CTTTAAAAGCAAAACTTGGGAGG + Intergenic
1095395383 12:41756849-41756871 CTCTATTAGCACAATGTGGAGGG - Intergenic
1097374861 12:58829881-58829903 CTCTAAGATCAGAACATGCAAGG + Intergenic
1097634576 12:62106990-62107012 TTCCAAAAGCAGAACGAGAAAGG + Intronic
1098594888 12:72260591-72260613 CTCTAAAAGTAGAACAGGGAAGG + Intronic
1100837057 12:98576351-98576373 CTCTAAATGCACAACCTGAATGG + Intergenic
1101988122 12:109463164-109463186 CATCAAAGGCAGAACGTGGAAGG - Intronic
1102418640 12:112786531-112786553 CTCTTAAAGGAGAAGGAGGAGGG + Intronic
1103533065 12:121615889-121615911 CTCAAAAAGAAGAATGTGGCCGG - Intergenic
1108992708 13:56682079-56682101 CTCTAAAAGCAGAGGTTGGGGGG - Intergenic
1112720796 13:102242470-102242492 ATCTTATAGCAGAAAGTGGAAGG + Intronic
1113821974 13:113221111-113221133 CACCAGAAGCAGAGCGTGGAGGG + Intronic
1115324349 14:32121772-32121794 CTGTAAAGGCAGAAAGTTGATGG - Intronic
1116764199 14:49050785-49050807 CTCTCAAAGCAGAAACTGTAAGG + Intergenic
1118007117 14:61573480-61573502 CTCTGAAAGCAGAACTTGGGTGG - Intronic
1121351566 14:93177477-93177499 CTCTAAAAGCAGAGTGAGGCTGG + Intergenic
1123432461 15:20230169-20230191 CTCTAGAAGTATAACATGGAGGG - Intergenic
1125091924 15:35802885-35802907 CTCACATAGCAGAAGGTGGAAGG + Intergenic
1125797745 15:42416026-42416048 CTCAAAACTCAGAACGTGGCCGG - Exonic
1128455803 15:67830698-67830720 CTCTAAAGGCAGAAGGTCTAGGG + Intronic
1129302935 15:74636774-74636796 CTCTAAATGCAGAAATGGGAAGG - Intronic
1134637225 16:15801658-15801680 CTCTAAAAACAGACCTGGGATGG + Intronic
1136852176 16:33620968-33620990 CTCTAGAAGTATAACATGGAGGG + Intergenic
1137757437 16:50913864-50913886 CTTTAAAATGAGAAGGTGGAGGG + Intergenic
1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG + Intergenic
1139848829 16:69938749-69938771 CTCTAAAAGCAGAACGTGGATGG + Intronic
1140977911 16:80078267-80078289 CTCTATAGGAAGAAAGTGGAGGG - Intergenic
1142358081 16:89613535-89613557 CTCTGAAAGTAGAAAGAGGAGGG - Intronic
1203113773 16_KI270728v1_random:1469443-1469465 CTCTAGAAGTATAACATGGAGGG + Intergenic
1145287470 17:21516992-21517014 CTTGAAAAGCAGGTCGTGGAGGG - Intergenic
1146289189 17:31596034-31596056 CTCTCAGAGCAGAGCATGGATGG + Intergenic
1148481449 17:47962126-47962148 GTCTGAATGAAGAACGTGGAAGG - Intergenic
1149038739 17:52161191-52161213 CTCTTAAAGCAGAATATAGAGGG - Intergenic
1152917872 17:83051437-83051459 CTTCAAAATCAGAACGAGGAAGG + Intronic
1156412311 18:36842498-36842520 ATCTCAAAGCAGAGGGTGGAAGG + Intronic
1156967866 18:43117670-43117692 ATCTAAAAGTAGGACCTGGAGGG - Intergenic
1157967467 18:52224383-52224405 ATCTCATAGCAGAAGGTGGAAGG - Intergenic
1158177865 18:54677835-54677857 CTCTAAATCCAGAAAGTAGATGG - Intergenic
1159517804 18:69480643-69480665 TTCAAAAAGCAGAACGCAGAGGG - Intronic
1161079991 19:2305853-2305875 CCCCAAAAGCAGACCTTGGAGGG - Intronic
1165025021 19:32954294-32954316 CTCTAAAAACAGAAACTAGAAGG - Intronic
1165028705 19:32981571-32981593 CTCTAGAAGTATAACATGGAGGG - Intronic
925962261 2:9028593-9028615 CTCTAAAAGTTGAACGAGGCCGG - Intergenic
926039042 2:9658026-9658048 CTCTGTGAGCAGAAGGTGGAGGG - Intergenic
926638743 2:15212398-15212420 CACCAAAAGAAGAAAGTGGAAGG - Intronic
928058530 2:28084462-28084484 GTTTGAAAGCAGAACTTGGATGG + Intronic
928546587 2:32334712-32334734 CTCTAAAAACACAACTTGGCGGG - Intergenic
928929260 2:36607146-36607168 ATCTCAAGGCAGAAGGTGGAAGG + Intronic
930623620 2:53670620-53670642 GTCTAAAATCAGAACGTCTACGG - Exonic
931182395 2:59915891-59915913 CTCTAAAAGGAGACTGTGGAGGG - Intergenic
934583809 2:95470743-95470765 CTTTAAAAGGAGACTGTGGATGG - Intergenic
934595643 2:95605971-95605993 CTTTAAAAGGAGACTGTGGATGG + Intergenic
934601945 2:95664336-95664358 CTATAAAAGCAGAAGTCGGATGG + Intergenic
937482787 2:122279958-122279980 TGATAAAATCAGAACGTGGAGGG - Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
945496640 2:210515233-210515255 CTCCAAAAACAGAAAGAGGAAGG - Intronic
945695621 2:213099816-213099838 CTCTAAAAGCACAACGGGATAGG - Intronic
945945050 2:215987582-215987604 TTTTAAAAGAAGAAAGTGGAAGG + Intronic
947378129 2:229518077-229518099 ATCTCAAAGCAGAAGCTGGATGG + Intronic
948222661 2:236285332-236285354 CTCACATAGCAGAAGGTGGAAGG - Intergenic
1170235433 20:14098981-14099003 ATAAAAAAGCAGAACGTGGCTGG + Intronic
1174713365 20:52730384-52730406 CTCTAAAAATAGTACTTGGAAGG - Intergenic
1178876939 21:36420914-36420936 TGCTAAAAGCAGGACATGGAAGG - Intergenic
1180990742 22:19934232-19934254 CTCTAAAAGGAGAAACTGCAGGG + Intronic
1185043344 22:48516882-48516904 CTCTGAGAGCAGGACCTGGATGG - Intronic
1185271169 22:49929807-49929829 TTCTAAAAGGGGAACTTGGAAGG + Intergenic
949924570 3:9031163-9031185 CACAAAAGGCAGAAAGTGGAAGG - Intronic
950755316 3:15166128-15166150 CTTAAAAAGCACAACTTGGATGG - Intergenic
950820574 3:15753940-15753962 CTCAAAAAACAGAAGGTGGCTGG + Intronic
951346941 3:21558306-21558328 CACTTAAAGCAGCATGTGGAGGG - Intronic
953511785 3:43548670-43548692 CTATAAAAGCAGAACTTAGGAGG - Intronic
954046995 3:47940535-47940557 CTATAAAAGTAGAATGGGGAAGG + Intronic
959096413 3:101961281-101961303 CTCTAATAGGAGAACTGGGAAGG - Intergenic
959111707 3:102130646-102130668 ATCTTATAGCAGAAAGTGGAGGG - Intronic
959556669 3:107727414-107727436 ATCAAAAAGCAGAACGTGTTAGG - Intronic
960471000 3:118065133-118065155 CTCACAGAGCAGAAGGTGGAAGG + Intergenic
963284296 3:143417986-143418008 TTCTAAATGCAGTACATGGAGGG - Intronic
963334746 3:143961799-143961821 CTCGAGAAGCAGAACTTGAATGG + Intergenic
965888840 3:173484607-173484629 CTCTAAAAGGAGAATGAAGATGG + Intronic
967326079 3:188241162-188241184 CTCTAGGAGCAGAAGGTGGTGGG + Intronic
967662915 3:192135194-192135216 TTCTAAAAGCAGGAATTGGAGGG - Intergenic
969907787 4:10413460-10413482 ATATGACAGCAGAACGTGGAGGG - Intergenic
969953030 4:10858800-10858822 CTCTCATAGCAGAAAGTGGAAGG - Intergenic
970497711 4:16643980-16644002 CTCAAGAAGCAGCACTTGGAAGG - Intronic
974846215 4:67353513-67353535 CTCCCATAGCAGAAGGTGGAAGG + Intergenic
976151715 4:82099154-82099176 CTCTCCAAGAAGAAGGTGGAGGG - Intergenic
978624451 4:110668783-110668805 CTCTAAAAACATAACTTTGAAGG + Intergenic
979112027 4:116770831-116770853 CTCTATTAGCAGAACGAGGAGGG - Intergenic
980262615 4:130471815-130471837 CTCTAGTAGCAGAAGGTGGTCGG - Intergenic
985583716 5:715009-715031 CACTAACAGCAGAAGGTGAAGGG - Intronic
985597224 5:799306-799328 CACTAACAGCAGAAGGTGAAGGG - Intronic
987332497 5:16869566-16869588 CGCTAAAAACAGAAGGTGGCCGG + Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
992544409 5:77797429-77797451 CTCTAGAAGAAGAAGGTGAAAGG + Intronic
993205127 5:84868996-84869018 CTCTAAAAGTAAAATGTGGCTGG + Intergenic
994949756 5:106446218-106446240 CTCTAAAATCACAAAATGGAAGG + Intergenic
995656381 5:114431728-114431750 CACCAAAAGCAGTACTTGGAAGG - Intronic
995971206 5:117973636-117973658 CTCTATTAGAACAACGTGGAGGG - Intergenic
998040426 5:138947939-138947961 CTCTATCAGCAGAACATGGTGGG + Intronic
999313531 5:150569210-150569232 CTCTGAAAGCAGGACTAGGAAGG - Intergenic
1002702281 5:181132864-181132886 CTCTATAACAAGAACCTGGAAGG + Intergenic
1004031813 6:11877688-11877710 CTCTAAATGCAGAACGTCTTAGG + Intergenic
1004272617 6:14209478-14209500 CTCTAAAAGAAGCAAGTGGCCGG + Intergenic
1008154647 6:47998831-47998853 CTCTAAAAGAAGAACAGAGAAGG + Intronic
1009324765 6:62337309-62337331 CTTTAAAAGCAGAAACTAGATGG + Intergenic
1010767547 6:79793340-79793362 ATCTAAAAGCAGAAGGTGTTAGG - Intergenic
1011401972 6:86973158-86973180 ATTTAAAAGGAGAAGGTGGAGGG - Intronic
1011751350 6:90458326-90458348 CTCTATAAAAAGAACGTGTAGGG - Intergenic
1013070882 6:106728335-106728357 CTCAAAAGGCTGAATGTGGAGGG - Intergenic
1014641181 6:123912673-123912695 CACTAACAGCAGAAGGTGAAGGG - Intronic
1015763753 6:136693349-136693371 CTGGAAAAGCACAAGGTGGAAGG - Intronic
1016943848 6:149509458-149509480 AGCTAAAAGCAGCACATGGAGGG + Intronic
1017699467 6:157054221-157054243 CTCAAAAAAAAGAAGGTGGATGG + Intronic
1018572020 6:165221970-165221992 ATCTAAAAGCAACAGGTGGATGG + Intergenic
1021305261 7:19023931-19023953 AAGTAAAAGCAGAACGTGGATGG + Intronic
1022700142 7:32752706-32752728 CTCTAAAAACAGAGATTGGATGG + Intergenic
1022890050 7:34687934-34687956 ATTTAAAAGCAGAAACTGGAAGG + Intronic
1023459733 7:40383061-40383083 CTATAAAAGCATTACGTGGAGGG + Intronic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1031018285 7:116598696-116598718 CTCAAAAAGCCGAAGGTGGCTGG - Intergenic
1033531133 7:142265080-142265102 CTCTCAAATCAGAAATTGGATGG + Intergenic
1036821892 8:11947386-11947408 CTATGAAAGCAGAACCTGAAAGG - Intergenic
1052585545 9:30423764-30423786 CTCTAAAAGCAGTAACTGGTTGG + Intergenic
1052754991 9:32531840-32531862 ATCAAAAAGCAGAAACTGGAGGG - Intergenic
1055969166 9:81894551-81894573 CTCTCAGAGCAGAAAGTGGAGGG - Intergenic
1056505850 9:87257620-87257642 CTCTGGAAGCAGAACTTGGGTGG + Intergenic
1057364255 9:94404038-94404060 CTCACAAAGCAGAAGGTGGAAGG - Intronic
1057414121 9:94846225-94846247 CTGGAGAAGCACAACGTGGAAGG + Intronic
1057659079 9:96984033-96984055 CTCACAAAGCAGAAGGTGGAAGG + Intronic
1057767992 9:97940365-97940387 ATCTAGAAGCAGAGTGTGGAGGG + Intronic
1059529924 9:115026551-115026573 CGCTACAAGCTGAAGGTGGAGGG - Exonic
1060946154 9:127570090-127570112 GTCAACAAGCAGAAAGTGGATGG - Intronic
1185491357 X:519576-519598 TTCTAATAACAGAACGTGGCTGG - Intergenic
1186304708 X:8243357-8243379 CTGCAATAGCAGAACATGGAGGG - Intergenic
1186554593 X:10544408-10544430 CACTAAATGCACAATGTGGAAGG + Intronic
1186808945 X:13167990-13168012 CTCTGAGAGCAGGAAGTGGAAGG - Intergenic
1193102776 X:77634983-77635005 CTCTAAAAGAGAAACGTGGCCGG + Intronic
1193722122 X:84999271-84999293 CTCTAAAGGCAGAATCTTGAAGG - Intergenic
1193948175 X:87764171-87764193 CTCTACTAGGACAACGTGGAGGG - Intergenic
1196065708 X:111462020-111462042 CTCTAGAAGCTGAAAATGGAAGG - Intergenic
1199973598 X:152878112-152878134 CTCTAAACACTGAAGGTGGAAGG - Intergenic
1201613260 Y:15866640-15866662 CTCAAAATGCAGTATGTGGATGG + Intergenic