ID: 1139849283

View in Genome Browser
Species Human (GRCh38)
Location 16:69940935-69940957
Sequence CGCCACTGGGGACTGCCTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 310}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139849283_1139849296 -1 Left 1139849283 16:69940935-69940957 CCCCCAGGCAGTCCCCAGTGGCG 0: 1
1: 0
2: 4
3: 49
4: 310
Right 1139849296 16:69940957-69940979 GGGACACAGGGGTCCGGCTGTGG 0: 1
1: 0
2: 1
3: 29
4: 286
1139849283_1139849298 20 Left 1139849283 16:69940935-69940957 CCCCCAGGCAGTCCCCAGTGGCG 0: 1
1: 0
2: 4
3: 49
4: 310
Right 1139849298 16:69940978-69941000 GGAGCTCCCCTGCCAGCCCCTGG 0: 1
1: 2
2: 3
3: 65
4: 536
1139849283_1139849302 29 Left 1139849283 16:69940935-69940957 CCCCCAGGCAGTCCCCAGTGGCG 0: 1
1: 0
2: 4
3: 49
4: 310
Right 1139849302 16:69940987-69941009 CTGCCAGCCCCTGGAGCTCCAGG 0: 1
1: 0
2: 5
3: 84
4: 631
1139849283_1139849295 -7 Left 1139849283 16:69940935-69940957 CCCCCAGGCAGTCCCCAGTGGCG 0: 1
1: 0
2: 4
3: 49
4: 310
Right 1139849295 16:69940951-69940973 AGTGGCGGGACACAGGGGTCCGG 0: 1
1: 0
2: 1
3: 18
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139849283 Original CRISPR CGCCACTGGGGACTGCCTGG GGG (reversed) Exonic
900807730 1:4778797-4778819 AACCTCTGGGGACTGCCTGCAGG - Intronic
900901514 1:5519649-5519671 TCCCACTGGGCACTGCCTAGTGG - Intergenic
900906388 1:5562639-5562661 CCCCACTGGGCACTGCCTAGTGG - Intergenic
903662325 1:24985678-24985700 GGCAGCTGGGGACTTCCTGGAGG - Intergenic
905189854 1:36224876-36224898 GGCCAATGGGGACTGGGTGGGGG - Intronic
905626263 1:39492073-39492095 CGTCGCTGGGGACAGCCGGGCGG - Exonic
905627376 1:39497924-39497946 CCCCACAGGGCCCTGCCTGGAGG + Intronic
905669053 1:39779187-39779209 CCCCACAGGGCCCTGCCTGGAGG - Intronic
905670633 1:39788382-39788404 CGTCGCTGGGGACAGCCGGGCGG + Exonic
906507342 1:46389999-46390021 CTACACTGGGAACTGCCTGCTGG + Intergenic
907037340 1:51228233-51228255 CTACACTGGGAACTGCCTGCTGG - Intergenic
907505637 1:54916130-54916152 CTACACTGGGAACTGCCTGCTGG + Intergenic
908511735 1:64854938-64854960 TGGCACAGGGGGCTGCCTGGAGG - Intronic
908746808 1:67384078-67384100 CCCCACTGGGCACTGCCTAGTGG - Intronic
911840473 1:102675623-102675645 CCCCAGTAGGGACTGCGTGGGGG + Intergenic
912463956 1:109856550-109856572 CTACACTGGGAACTGCCTGCTGG + Intergenic
913352342 1:117875498-117875520 CCCCAGTGAGGACTGCCTGGAGG - Intronic
914824660 1:151132501-151132523 CGCCGTTCGGGACGGCCTGGCGG + Exonic
915977557 1:160400846-160400868 CGCCGCTGCGAACTGCCGGGTGG - Exonic
918315479 1:183319153-183319175 CTCCACTGGAAACTGGCTGGGGG + Intronic
920425254 1:205869876-205869898 CTACACTGGGAACTGCCTGCTGG + Intergenic
921128066 1:212195672-212195694 TCCCACTGGGCACTGCCTAGTGG + Intergenic
922025228 1:221743029-221743051 CGCCACTGAGGGCTGCTCGGAGG + Intergenic
922983762 1:229850580-229850602 CACCACTGGGCACTGCCTTTGGG - Intergenic
923890903 1:238214249-238214271 CCCCACTGGGCACTGTCTAGTGG - Intergenic
1065658732 10:27982677-27982699 CATCACGGGGGACTGCCTGGAGG - Intronic
1065687728 10:28302829-28302851 CGCCTCTGGGGAGCGCCTGTCGG - Intronic
1066195111 10:33091503-33091525 AGACACTGGGGACTACTTGGTGG + Intergenic
1068103164 10:52581475-52581497 GTCCACTGGGCACTGCCTAGTGG - Intergenic
1068244179 10:54342580-54342602 CCCCACTTGGGACTGCCTAGTGG + Intronic
1069729702 10:70602723-70602745 AGCCACAGTGGGCTGCCTGGGGG - Exonic
1071327055 10:84528039-84528061 CTACACTGGGAACTGCCTGCTGG + Intergenic
1072378119 10:94838233-94838255 CTACACTGGGAACTGCCTGCTGG + Intronic
1073133428 10:101205551-101205573 CGCCACCTGGGACTCCCTGAGGG + Intergenic
1073556658 10:104459613-104459635 CACCACTGGGGCCTGTCAGGGGG - Intergenic
1077186904 11:1239526-1239548 CCCCAGTGGGCACTGCCTGGTGG + Exonic
1077394029 11:2312420-2312442 CGCCCCTGGGCACTGCGGGGAGG + Intronic
1077448695 11:2620022-2620044 AGACACTGGGGACTACTTGGGGG - Intronic
1078024128 11:7678767-7678789 AGCCACTGGGGACTGCTAGAAGG + Intergenic
1079772086 11:24474968-24474990 CCCCACAGGGCACTGCCTAGTGG - Intergenic
1079887110 11:26002776-26002798 CTACACTGGGAACTGCCTGCTGG - Intergenic
1079933785 11:26594252-26594274 CTACACTGGGAACTGCCTGCTGG + Intronic
1081358586 11:42144525-42144547 CCCCACTGGGCACTGCCTAGTGG - Intergenic
1083889752 11:65589869-65589891 CTGGACTGGGGACTTCCTGGGGG + Intronic
1084634087 11:70378730-70378752 CTCCACTGGGGACTTCTTGGAGG - Intronic
1085225370 11:74915351-74915373 CGCCACAGGGGATTGTCTTGGGG - Intronic
1085601810 11:77862169-77862191 CTACACTGGGAACTGCCTGCTGG + Intronic
1088420146 11:109636223-109636245 GGCCACTAGGGTCAGCCTGGTGG + Intergenic
1088500627 11:110478835-110478857 CTCTTCAGGGGACTGCCTGGAGG + Intergenic
1088930870 11:114349425-114349447 CCACACTGGGAACTGCCTGTTGG + Intergenic
1090692620 11:129199734-129199756 CCCCACTGGGCACTGCCTAGTGG + Intronic
1092469498 12:8765339-8765361 CTACACTGGGAACTGCCTGCTGG + Intronic
1094346207 12:29471946-29471968 AGCCACTGGGGACTAAATGGAGG + Exonic
1095283881 12:40387065-40387087 CTACACTGGGAACTGCCTGCTGG - Intergenic
1095919417 12:47514324-47514346 CTCCAGTGGGGACTGTGTGGGGG - Intergenic
1096239301 12:49951040-49951062 CGTGACTGTGGCCTGCCTGGTGG + Exonic
1096352115 12:50909141-50909163 CTACACTGGGAACTGCCTGCTGG + Intergenic
1096473107 12:51891021-51891043 GACCTCTGGGGACTCCCTGGCGG - Exonic
1097343602 12:58467051-58467073 CTCCCTTGGGTACTGCCTGGTGG - Intergenic
1097377312 12:58856208-58856230 CTACACTGGGAACTGCCTGCTGG + Intergenic
1098319865 12:69232326-69232348 CCCCACTGGGCACTGCCTAGTGG + Intergenic
1099475581 12:83104278-83104300 CCCCACGGGGCACTGCCTAGTGG - Intronic
1099605223 12:84795281-84795303 CTACACTGGGAACTGCCTGCTGG - Intergenic
1100336920 12:93640390-93640412 GGCCACTGCCTACTGCCTGGGGG - Intergenic
1101609221 12:106275208-106275230 CTCCCTTCGGGACTGCCTGGGGG - Intronic
1102888480 12:116539371-116539393 AGCCTCTGGGGACTCCCTGTAGG + Intergenic
1103803004 12:123551672-123551694 CTACACTGGGAACTGCCTGCTGG - Intergenic
1103961502 12:124611742-124611764 CGCCCCTGGGGCCTGCCTCTGGG + Intergenic
1104808021 12:131601846-131601868 CCCCACTGGGCACTGCCTAGTGG - Intergenic
1104851592 12:131877852-131877874 CTACACTGGGAACTGCCTGCTGG + Intergenic
1104856351 12:131904122-131904144 TGCCACAGGGGTCTCCCTGGTGG + Intronic
1105619154 13:22050263-22050285 AGACACTGGGGTCTACCTGGGGG + Intergenic
1105694160 13:22871761-22871783 CTCCATTGGGCACTGCCTAGTGG + Intergenic
1109606768 13:64706789-64706811 CTACACTGGGAACTGCCTGCTGG + Intergenic
1109771769 13:66983873-66983895 TGACACTGGGGCCTGCCTGAGGG - Intronic
1109884943 13:68529491-68529513 AGACACTGGGGACTGCTTGAAGG + Intergenic
1110007779 13:70294019-70294041 CCCCATTGGGGACTCCCTGTGGG - Intergenic
1110635780 13:77765949-77765971 TGCCACTGGGGATGGCCTAGTGG - Intergenic
1111207830 13:85035463-85035485 CCCCACTGGGCACTGCCTAGTGG + Intergenic
1111806139 13:93042288-93042310 CTACACTGGGAACTGCCTGCTGG - Intergenic
1112424643 13:99286661-99286683 AGACACTGGGGACTGCTTGTTGG - Intronic
1112440587 13:99421999-99422021 CTCCACAGGGGTCAGCCTGGTGG + Intergenic
1113942456 13:114025406-114025428 GGGCACTGGGGGCTTCCTGGAGG - Intronic
1113942474 13:114025470-114025492 GGGCACTGGGGGCTTCCTGGAGG - Intronic
1114375422 14:22141177-22141199 CACCACTGGGGACAGGCTGCAGG - Intergenic
1114384270 14:22239785-22239807 CTACACTGGGAACTGCCTGCTGG - Intergenic
1114647285 14:24262881-24262903 CCCCACTTGGGGCTGCCAGGAGG + Intronic
1115065668 14:29256925-29256947 CCCCAGTGGGGACTGTCTGTGGG + Intergenic
1115870308 14:37793433-37793455 GTCCACAGAGGACTGCCTGGAGG + Intronic
1115998426 14:39217328-39217350 AGGCACTGGGGACTGCTAGGGGG + Intergenic
1117590471 14:57263182-57263204 AGCCACTGGGTCCAGCCTGGGGG - Intronic
1121718705 14:96094682-96094704 GCTCACTGAGGACTGCCTGGAGG + Intergenic
1124445003 15:29722619-29722641 CCCCAGTGGGGACTGTCTGGTGG - Intronic
1125755090 15:42058081-42058103 TGCCACTGGGGATTGCCTCGGGG - Intergenic
1126204561 15:46030425-46030447 AGACACTGGGGACTACTTGGGGG - Intergenic
1127728496 15:61776009-61776031 AGACACTGGGGACTACTTGGGGG + Intergenic
1131092491 15:89633089-89633111 CTCCCCTGGGGGCTGGCTGGTGG - Intronic
1131137954 15:89952885-89952907 ACCCACTGGGGACAGCTTGGTGG + Intergenic
1132211612 15:100027964-100027986 CCCCAGTGGGGACTGCCATGGGG - Intronic
1132371300 15:101301225-101301247 GGCCACTGGGCACTGGCTGCTGG - Intronic
1132899011 16:2243409-2243431 CCCCGCTGGAGGCTGCCTGGTGG - Exonic
1134098544 16:11435708-11435730 GGGCACTGAGGACAGCCTGGTGG + Exonic
1134388620 16:13797430-13797452 AGACACTGGGGACTACCTGGAGG + Intergenic
1135224693 16:20645705-20645727 CTACACTGGGAACTGCCTGCTGG - Intronic
1136047036 16:27623111-27623133 CGCAACTGGGGGCTCCTTGGAGG - Intronic
1136669043 16:31839526-31839548 GGCCACTGGGGCTGGCCTGGTGG - Intergenic
1137402624 16:48165575-48165597 AGCCCCCGGGGACTTCCTGGAGG - Intergenic
1137688035 16:50400550-50400572 CACCACTGGGGAGTGGCGGGAGG + Intergenic
1139751679 16:69112788-69112810 TGGCCCTGGGGTCTGCCTGGAGG + Intronic
1139849283 16:69940935-69940957 CGCCACTGGGGACTGCCTGGGGG - Exonic
1140833457 16:78772202-78772224 AGACACTGGGGCCTGCCTGAGGG - Intronic
1141168483 16:81676351-81676373 GAGCACTGGGGACGGCCTGGAGG - Intronic
1142006175 16:87690539-87690561 CTCCACTGGGACCAGCCTGGTGG - Intronic
1142028872 16:87828672-87828694 AGCATCTGGGGACTCCCTGGGGG - Intergenic
1142130354 16:88429230-88429252 CGGCAGTGGGGACTCGCTGGGGG - Exonic
1142666953 17:1468683-1468705 CCCCGCTGGGGAGTGCTTGGTGG - Intronic
1143336835 17:6177984-6178006 AGCCAGGGGGGACTTCCTGGAGG - Intergenic
1143622369 17:8087904-8087926 AGCCAATGGGGACTGGCAGGAGG - Intergenic
1144748798 17:17633994-17634016 ATCCCCTGGGGAGTGCCTGGTGG - Intergenic
1146391811 17:32429875-32429897 CCCCACTGGGCACTGCCTAGTGG + Intergenic
1146671024 17:34737865-34737887 ACACACTGGGGCCTGCCTGGGGG - Intergenic
1148053417 17:44780075-44780097 GTCCACTGGTGGCTGCCTGGGGG - Exonic
1148827119 17:50401954-50401976 CTACACTGGGAACTGCCTGCTGG + Intergenic
1149274134 17:55015317-55015339 CTACACTGGGAACTGCCTGCTGG + Intronic
1149615026 17:57989699-57989721 CCCCATTGGATACTGCCTGGAGG + Exonic
1149853262 17:60054428-60054450 CTCCACTGAGCACTGCCTAGTGG + Intronic
1151241369 17:72760852-72760874 CCCCACTGGGCAACGCCTGGAGG + Intronic
1151657260 17:75501882-75501904 CGGCACTGGAGGCTGCATGGCGG + Exonic
1152609815 17:81310009-81310031 GGGCCCTGGGGGCTGCCTGGAGG - Intergenic
1153401498 18:4688119-4688141 CTACACTGGGAACTGCCTGCTGG - Intergenic
1153709278 18:7781612-7781634 AGACAATGGGGACTGCTTGGGGG - Intronic
1154484455 18:14862613-14862635 CCCCAGTGGGGACTGTGTGGAGG - Intergenic
1156267818 18:35504139-35504161 TGCCACTCGGCACTGCCAGGAGG - Intergenic
1156975757 18:43219993-43220015 CCCCATTGGGTAATGCCTGGGGG - Intergenic
1157484929 18:48080065-48080087 CGCCTTTGGGGCCCGCCTGGTGG + Intronic
1157549343 18:48570564-48570586 GGGCACTGGGGAGTCCCTGGGGG + Intronic
1159573149 18:70143577-70143599 GGACACTGGGGCCTGCCTGAGGG + Intronic
1160996226 19:1883290-1883312 CACCACTGGGGACTGGGTGGAGG + Intronic
1161382045 19:3970755-3970777 AGCCACTGGGGTCTGCCTAGGGG - Intronic
1161733760 19:5978028-5978050 CGCCGTTGGGGACCGGCTGGCGG - Intronic
1162028233 19:7906072-7906094 CTCCACTTTGGACTCCCTGGAGG + Intronic
1162682728 19:12358851-12358873 TGCCACTGGCATCTGCCTGGTGG - Intronic
1163020900 19:14480271-14480293 CGCCACTGGGGAGGTCCAGGGGG + Intronic
1163698673 19:18776446-18776468 GGCCAGTGAGGACTGCCAGGGGG - Intronic
1167263579 19:48472417-48472439 AGCCATCGGGGACTACCTGGGGG + Exonic
924974187 2:157872-157894 CTACACTGGGAACTGCCTGCTGG + Intergenic
925141968 2:1557162-1557184 CCCCACTGGGGATGGCCTCGCGG - Intergenic
925781931 2:7389320-7389342 CCCTACTGGGCACTGCCTAGTGG - Intergenic
925874779 2:8302498-8302520 CGCCACTTAGGATTGGCTGGGGG - Intergenic
926159069 2:10475305-10475327 CCCCTCTGGGGAGTGCCTAGAGG + Intergenic
928476407 2:31631818-31631840 CTACACTGGGAACTGCCTGCTGG - Intergenic
928677005 2:33660245-33660267 CTACACTGGGAACTGCCTGCTGG - Intergenic
928895332 2:36255669-36255691 AGACACTGGGGACTGCTTGGAGG - Intergenic
930544152 2:52745869-52745891 TCCCACTGGGCACTGCCTAGTGG + Intergenic
930619017 2:53625163-53625185 CTCCACTGGAGACAGGCTGGAGG + Intronic
932489757 2:72113286-72113308 AGCCACTGGGGAGTGTCTGATGG - Intergenic
933008221 2:77022908-77022930 CCCTACTGGGGACTGCCTAGTGG - Intronic
933102850 2:78282300-78282322 CCCCACTGGGCACTGCCTAGTGG + Intergenic
933175304 2:79167066-79167088 CTACACTGGGAACTGCCTGCTGG + Intergenic
934672112 2:96220854-96220876 CTACACTGGGAACTGCCTGCTGG + Intergenic
935748648 2:106211428-106211450 CTACACTGGGAACTGCCTGCTGG - Intergenic
936685482 2:114822039-114822061 CCCCACTGGGCACTGCCTGGTGG - Intronic
939023545 2:136985688-136985710 CTCAACAGGGTACTGCCTGGTGG + Intronic
939493693 2:142904359-142904381 CTACACTGGGAACTGCCTGCTGG + Intronic
939562312 2:143747062-143747084 CACCACTGGGGCCTGTCAGGGGG + Intronic
940547138 2:155102276-155102298 CCCCACTGGGCACTGCCTAGTGG - Intergenic
940691632 2:156926311-156926333 CCCCACTGGGCACTGCCTAGTGG - Intergenic
942133903 2:172906652-172906674 TGCCACTCTGGCCTGCCTGGTGG + Intronic
942580465 2:177411477-177411499 CTACACTGGGAACTGCCTGCTGG + Intronic
943231899 2:185264690-185264712 CCCCACTGGGCACTGCCTAGTGG - Intergenic
945109532 2:206349202-206349224 CCCCACTGGGCACTGCTTAGTGG - Intergenic
945330713 2:208536522-208536544 CCCCACTGGGGACTGCCTAGTGG - Intronic
946229050 2:218280376-218280398 CGCCACTGGGGGTTCACTGGGGG + Intronic
946406583 2:219495289-219495311 CCCCTCTGGGGATTGCCTGGAGG - Intronic
946956076 2:224931326-224931348 GGCCACTGGGGACTGGGAGGAGG - Intronic
948724771 2:239927749-239927771 GGCGACTGGGGACAGCCTGAGGG + Intronic
948888181 2:240894151-240894173 CGGCGCTGGGGCCTGCCTGGAGG - Intronic
948994132 2:241570216-241570238 CGCCCTCGTGGACTGCCTGGGGG + Exonic
949014742 2:241702631-241702653 CGGCACTGGGGACTGCGGCGCGG + Intronic
1169758627 20:9068443-9068465 CTCCTCTGGGGTCTCCCTGGCGG - Intergenic
1170550782 20:17474333-17474355 GGACACTGGGGTGTGCCTGGGGG - Intronic
1171399714 20:24864969-24864991 CTCCAGTGGGGACTCCCTGTGGG - Intergenic
1171490702 20:25515026-25515048 CCCCACTGGGCACTGCCTAGTGG + Intronic
1171749889 20:29038602-29038624 CCCCAGTGGGGACTGTGTGGGGG + Intergenic
1172516062 20:35534382-35534404 ACACACTGGGGCCTGCCTGGTGG - Intergenic
1173201863 20:40960586-40960608 GGCCAAAGGGGACTGCCAGGTGG + Intergenic
1173500393 20:43548782-43548804 AGCCAGTGGGGTCTGGCTGGGGG - Intronic
1174865233 20:54129414-54129436 CGACACTGGGGCCTACCTGAGGG - Intergenic
1175964199 20:62652259-62652281 CTACCCTGAGGACTGCCTGGAGG - Intronic
1175990563 20:62786444-62786466 GGGCACTGGGGCCTGCCTGCTGG - Intergenic
1176112247 20:63415986-63416008 CACCCCGGGGGCCTGCCTGGTGG + Intronic
1176315335 21:5237314-5237336 CCCCAGTGGGGACTGTGTGGGGG - Intergenic
1177263550 21:18757090-18757112 CTACACTGGGAACTGCCTGCTGG + Intergenic
1177734879 21:25076553-25076575 AGACACTGGGGACTGCTTGAAGG + Intergenic
1177896215 21:26858150-26858172 CTACACTGGGAACTGCCTGCTGG - Intergenic
1179271929 21:39858268-39858290 CCTCACAGGGCACTGCCTGGTGG - Intergenic
1180143926 21:45909386-45909408 CGTCACTGGGGGCTTGCTGGTGG - Exonic
1181014522 22:20061551-20061573 CGCTGCTGGAGACTCCCTGGAGG + Exonic
1181165441 22:20980597-20980619 AGGGACTGGGGACAGCCTGGAGG + Intronic
1182085519 22:27558464-27558486 CGCCTCTGTGGACTGGGTGGGGG + Intergenic
1182360383 22:29743077-29743099 AGCCACTGGGCCCAGCCTGGAGG + Intronic
1182937021 22:34233780-34233802 AGACACTGGGGACTGCTTGAGGG + Intergenic
1184045793 22:41971595-41971617 CGCCCCTCGAGACTCCCTGGAGG + Intergenic
1184594280 22:45504397-45504419 AGCCCCTGGGGGCTCCCTGGAGG + Intronic
1184748453 22:46470394-46470416 CAGCACTGGGGCCTTCCTGGGGG + Intronic
1184950722 22:47840751-47840773 CACCACTGGAGTCTGGCTGGAGG - Intergenic
951199681 3:19863049-19863071 CCCTACTGGGCACTGCCTAGTGG - Intergenic
951200724 3:19873334-19873356 CTACACTGGGAACTGCCTGCTGG + Intergenic
951837828 3:27002369-27002391 CTACACTGGGAACTGCCTGCTGG - Intergenic
952202636 3:31147372-31147394 TTCCACTGGGCACTGCCTAGTGG - Intergenic
952646453 3:35664746-35664768 CGCCCCTGGTAAGTGCCTGGAGG + Intronic
952922268 3:38293766-38293788 CTACACTGGGAACTGCCTGCTGG + Intronic
954096473 3:48332603-48332625 CTACACTGGGAACTGCCTGCTGG + Intergenic
954608856 3:51933730-51933752 CAGCTCTGGGGACTTCCTGGTGG - Exonic
955673175 3:61423797-61423819 AGACACTGGGGACTGCTTGAGGG + Intergenic
956166939 3:66404313-66404335 CGTCACTGGGGACGGGCTGGGGG + Intronic
958629842 3:96671185-96671207 CTACACTGGGAACTGCCTGCTGG + Intergenic
961406752 3:126685097-126685119 CTCTACGGGGCACTGCCTGGTGG + Intergenic
961525437 3:127494006-127494028 CCCCACTGGGGACTATCTAGTGG - Intergenic
963187909 3:142439339-142439361 CTACACTGGGAACTGCCTGCTGG - Intronic
963572547 3:147015919-147015941 CCCCACTTGGGACTGCCTAGTGG + Intergenic
963815968 3:149831179-149831201 CCCTACTGGGGACTGCCTAGTGG + Intronic
964793036 3:160470706-160470728 CCCCACTGGGCACTGCCTAGTGG + Intronic
964953389 3:162324440-162324462 CTACACTGGGAACTGCCTGCTGG - Intergenic
965054835 3:163698838-163698860 CAGCACTGGGAACTGCCTGCTGG + Intergenic
966353458 3:179055908-179055930 CTACACTGGGAACTGCCTGCTGG - Intronic
966452543 3:180078426-180078448 TCCCACTGGGGCCTGCCTAGTGG - Intergenic
966948337 3:184793769-184793791 AGCCACTGGGCCCAGCCTGGAGG + Intergenic
967073622 3:185983069-185983091 CCTCACTGGGGACTGCTGGGGGG + Intergenic
967835063 3:193955737-193955759 GGCCCCTGGGGAGTGCCTGTGGG + Intergenic
968472787 4:789724-789746 CTCCTCTGGGAACTGCCTAGGGG + Intronic
969134602 4:5019916-5019938 CTCCACTGCGGGCTGCCTGGAGG - Intergenic
969240812 4:5896111-5896133 CGCCACGTGGGGCTGCCTGAGGG - Intergenic
969398451 4:6938244-6938266 CTCTTCTGGGGGCTGCCTGGTGG + Intronic
969960521 4:10940408-10940430 CCCCACTGGGGACTGTGTGGGGG - Intergenic
972765992 4:42152464-42152486 CGCCCGCGGGGTCTGCCTGGCGG + Intronic
974748779 4:66109882-66109904 AGACACTGGGGACTGCTTGAAGG - Intergenic
975229215 4:71911024-71911046 TGCCACTGGGGACAGGCAGGAGG - Intergenic
975313857 4:72930451-72930473 CTACACTGGGAACTGCCTGCTGG + Intergenic
975542864 4:75532526-75532548 CCCTACTGGGCACTGCCTAGTGG - Intronic
975696923 4:77022849-77022871 GGCCACTGGGCCCTTCCTGGTGG - Intronic
975792636 4:77971162-77971184 CACAACTGGGGCCTGTCTGGGGG + Intergenic
976189802 4:82477098-82477120 CTACACTGGGAACTGCCTGCTGG - Intergenic
976464753 4:85354527-85354549 CTACACTGGGAACTGCCTGCTGG + Intergenic
977050158 4:92119465-92119487 CACAACTGGGCACTGCCTAGTGG + Intergenic
977396584 4:96478867-96478889 CCCCAGTGGGGACTGTCTGCAGG - Intergenic
978529953 4:109703109-109703131 CGCTACTCGGGACCGCCAGGAGG + Intronic
978909520 4:114047895-114047917 CTACACTGGGAACTGCCTGCCGG - Intergenic
980444179 4:132885229-132885251 CTACACTGGGAACTGCCTGCTGG - Intergenic
981050007 4:140300433-140300455 AGGCACTGGGGAGTACCTGGGGG - Intronic
981402368 4:144328419-144328441 AGACACTGGGGACTGCTTGAGGG + Intergenic
982609124 4:157551407-157551429 CCCCACTGGGCACTGCCTAGTGG + Intergenic
984699789 4:182811496-182811518 CCCCACTGGGCATTGCCTAGAGG - Intergenic
984723711 4:183000473-183000495 CTACACTGGGAACTGCCTGCTGG - Intergenic
985525574 5:399748-399770 CGTCAGGAGGGACTGCCTGGGGG + Intronic
985888993 5:2701126-2701148 CGCCACTGGAAGGTGCCTGGTGG + Intergenic
985956230 5:3268176-3268198 GGCAACTGGGGACAGCCTAGTGG + Intergenic
987503568 5:18743657-18743679 CCACACTGGGAACTGCCTGTTGG + Intergenic
987545887 5:19309762-19309784 CCCCAGTGGGGACTGGGTGGGGG + Intergenic
988457131 5:31396312-31396334 CTACACTGGGAACTGCCTGCTGG + Intergenic
988536033 5:32069706-32069728 CTGCACTGGGGAGTGCCTGTGGG - Intronic
988957215 5:36331774-36331796 CTACACTGGGAACTGCCTGCTGG + Intergenic
989224583 5:39011437-39011459 CCCCACTGGGTACTGCCTAGTGG + Intronic
989393256 5:40924525-40924547 CTCCAGTGGGGACTGTGTGGGGG + Intronic
990892210 5:60661800-60661822 CTACACTGGGAACTGCCTGCTGG - Intronic
991204860 5:64038825-64038847 CCCTACTGGGCACTGCCTAGTGG + Intergenic
993178703 5:84520531-84520553 AGTCACTGGGGACTGGCTGAGGG + Intergenic
994073717 5:95628742-95628764 CCCCACTGGGGACTGCGTGGAGG + Intergenic
994375131 5:99010126-99010148 CCCCACTGGGGACTGCCTAGTGG - Intergenic
994580257 5:101632573-101632595 CCCCACTGGGCACTACCTAGTGG - Intergenic
995120645 5:108532371-108532393 CCCCACTGGGGACTCTGTGGGGG + Intergenic
995365794 5:111358730-111358752 TGCCACTGGGGCCTACCTGGAGG - Intronic
995465606 5:112447132-112447154 CTACACTGGGAACTGCCTGCTGG - Intergenic
996761805 5:126993530-126993552 CAACACTGGTGACTTCCTGGAGG + Intronic
998882824 5:146661124-146661146 TGCCACTGGGCAGTGTCTGGAGG + Intronic
999834707 5:155356802-155356824 AGACACTGGGGACTACCTGAGGG + Intergenic
1000515970 5:162236721-162236743 TTCCACTGGGCACTGCCTAGTGG - Intergenic
1000676934 5:164132643-164132665 CCCCACTGGGTACTGCCTAGTGG + Intergenic
1001836466 5:174836813-174836835 CCCCAGTGGAGACTGCATGGGGG - Intergenic
1002316853 5:178349319-178349341 CCCCACTGAGGACTGGCAGGAGG + Intronic
1002577502 5:180183168-180183190 TGCCACTGTAGACTGCATGGTGG - Intronic
1002705671 5:181159882-181159904 CCCCGCTGAGGACGGCCTGGGGG + Intergenic
1005323704 6:24679623-24679645 CTACACTGGGAACTGCCTGCTGG + Intronic
1005756799 6:28932308-28932330 GGCCACTGGGGGCTGGATGGAGG + Intergenic
1005812698 6:29529254-29529276 TGCCCCTGGGGCCTGGCTGGAGG - Intergenic
1006021655 6:31121144-31121166 GGCCTCTGGGGACGGCATGGTGG + Intronic
1007995116 6:46299084-46299106 AGACACTGGGGACTGCTTGTGGG + Intronic
1010893462 6:81340450-81340472 CTACACTGGGAACTGCCTGCTGG - Intergenic
1011539900 6:88418081-88418103 CTACACTGGGAACTGCCTGCTGG + Intergenic
1012210242 6:96510098-96510120 CTCCACTGGGCACTGCCTAGTGG + Intergenic
1013022201 6:106231423-106231445 CTACACTGGGAACTGCCTGCTGG - Intronic
1014116089 6:117670147-117670169 TCCCACTGGGCACTGCCTGGTGG + Intergenic
1015043384 6:128748562-128748584 AGACACTGGGGCCTGCTTGGGGG + Intergenic
1015667515 6:135648445-135648467 CCCCACTGGGGACTCTGTGGGGG + Intergenic
1018477686 6:164159417-164159439 CCCCACTGGGCACTGCCTAGTGG - Intergenic
1018687479 6:166315232-166315254 CTGCACTGGGAACTGCCTGCTGG - Intergenic
1018761007 6:166894354-166894376 CTACACTGGGAACTGCCTGCTGG - Intronic
1018923953 6:168193954-168193976 AGCCCCTGGGCAGTGCCTGGTGG - Intergenic
1019482973 7:1274814-1274836 GGCCACTCTGGACGGCCTGGCGG + Intergenic
1019520592 7:1459024-1459046 GGCCACTGAGGACAGCCTCGGGG + Intronic
1020687158 7:11310023-11310045 AGACACTGGGGACTGCTTGAGGG - Intergenic
1020809504 7:12833925-12833947 CCCCACTGGGCACTGCCTAGTGG - Intergenic
1021001830 7:15340838-15340860 CCCCACTGGGCACTGCCTAGTGG + Intronic
1021673940 7:23061678-23061700 AGACACTGGGGTCTGCTTGGGGG + Intergenic
1021882901 7:25111320-25111342 CTCCACTGGGCACTGCTTAGTGG + Intergenic
1023931623 7:44709677-44709699 CTCCACTTGGCACTGGCTGGTGG - Intergenic
1027133987 7:75611597-75611619 CGCCACAGGCCAATGCCTGGGGG + Intronic
1029610993 7:101626547-101626569 TGCCCCTGGGGACTCCCTGCGGG - Intronic
1029914927 7:104199175-104199197 CCCCACTGGGCACTGCCTAGTGG + Intronic
1030843529 7:114382996-114383018 CTACACTGGGAACTGCCTGCTGG + Intronic
1032425008 7:131815531-131815553 CCCCACTGGTGACTCCATGGGGG + Intergenic
1032426129 7:131823524-131823546 CTACACTGGGAACTGCCTGCTGG + Intergenic
1032436844 7:131907730-131907752 CTCCATTGGGTACAGCCTGGGGG - Intergenic
1032440869 7:131941999-131942021 CGCCCTTGGGCCCTGCCTGGTGG + Intergenic
1032725792 7:134589161-134589183 CTACACTGGGAACTGCCTGGTGG - Intergenic
1034249154 7:149674504-149674526 CTACACTGGGAACTGCCTGCTGG - Intergenic
1036201237 8:6773196-6773218 CACCCCTGGGGGCTGCCTGGTGG + Intergenic
1037163908 8:15803720-15803742 CACCACTGGGGCCTGCCAGGGGG - Intergenic
1037263964 8:17037628-17037650 TCCCACTGGGCACTGCCTAGTGG + Intronic
1037323779 8:17668836-17668858 AGACACTGGGGCCTGCCTGAGGG - Intronic
1039027577 8:33274614-33274636 CGCTACTGGGCAGTGACTGGGGG + Intergenic
1039546210 8:38413334-38413356 TGCCACCAGGCACTGCCTGGAGG - Exonic
1040085798 8:43339465-43339487 ACACACTGGGGCCTGCCTGGGGG + Intergenic
1041386691 8:57312059-57312081 CCCCAGTGGGGACTGTGTGGGGG - Intergenic
1042039333 8:64576260-64576282 GCCCACTCGGGGCTGCCTGGTGG - Intergenic
1042056071 8:64766102-64766124 CTACACTGGGAACTGCTTGGTGG - Intronic
1043297443 8:78683209-78683231 CCCCACTGGGGCATGCCTAGTGG - Intronic
1045182827 8:99804472-99804494 CGCAACTGGGGACTGAATTGGGG + Intronic
1047232522 8:123009524-123009546 AGCCACTGGGGAATTCCTTGGGG + Intergenic
1047808109 8:128379994-128380016 CCACACTGGGAACTGCCTGTTGG + Intergenic
1048071134 8:131022281-131022303 ACACACTGGGGCCTGCCTGGGGG - Intronic
1048259026 8:132930009-132930031 AGACACTGGGGACTACTTGGGGG - Intronic
1048738856 8:137532058-137532080 CCCCACTGGGCACTGCCTAGTGG + Intergenic
1049409214 8:142464975-142464997 CGCCACAGGTGAGTGACTGGCGG + Exonic
1053720968 9:40946298-40946320 CCCCAGTGGGGACTGTGTGGGGG + Intergenic
1054345023 9:63905858-63905880 CCCCAGTGGGGACTGTGTGGGGG - Intergenic
1057291046 9:93807686-93807708 CGCCTGTGGGGAGTGACTGGTGG + Intergenic
1057615429 9:96585369-96585391 ACCCACTGGGGCCTGTCTGGGGG - Intronic
1059039831 9:110800556-110800578 AGCCACCAGGAACTGCCTGGTGG + Exonic
1060810377 9:126608677-126608699 GGCCTCTAGGCACTGCCTGGAGG + Intergenic
1061672006 9:132194134-132194156 TGCCCCTGGGGACTTCCTAGGGG - Intronic
1062235390 9:135505502-135505524 AAACACTGGGGACTGACTGGGGG + Intergenic
1062534886 9:137017017-137017039 CTCCACCGGGGACTGGCTGAAGG + Exonic
1062684443 9:137803030-137803052 CGCCCCCGGAGACTGCGTGGCGG + Intronic
1203454219 Un_GL000219v1:149852-149874 CCCCAGTGGGGACTGTGTGGGGG - Intergenic
1185722762 X:2395324-2395346 GGCCACTGGGGCCAGCCAGGGGG + Intronic
1189160622 X:38805117-38805139 CGGCAGTGGCGGCTGCCTGGAGG + Exonic
1189335530 X:40168657-40168679 CTCCCCGGGGGGCTGCCTGGAGG + Intronic
1189695140 X:43655341-43655363 CTCCACTGGGAACTGGCTAGCGG - Intronic
1191167128 X:57402819-57402841 CTACACTGGGAACTGCCTGGTGG + Intronic
1191840227 X:65508490-65508512 CGCCACTTGGTTCTGACTGGTGG - Intergenic
1193172006 X:78347645-78347667 CTACACTGGGAACTGCCTGCTGG + Intergenic
1194215761 X:91128798-91128820 CCCTACTGGGCACTGCCTAGTGG - Intergenic
1194216420 X:91134965-91134987 CCCTACTGGGCACTGCCTAGTGG + Intergenic
1194259691 X:91677923-91677945 CCCCACGGGGCACTGCCTAGTGG - Intergenic
1194424546 X:93720460-93720482 AGACACTGGGGACTGCTTGAAGG + Intergenic
1194893303 X:99406905-99406927 CCCCAGTGGGCACTGCCTAGTGG + Intergenic
1196516896 X:116624533-116624555 ACACACTGGGGACTGTCTGGGGG + Intergenic
1197984480 X:132253312-132253334 AGACACTGGGGACTGTTTGGTGG + Intergenic
1198974694 X:142323066-142323088 AGACACTGGGGACTACCTGAGGG - Intergenic
1199284288 X:146038885-146038907 CCCCACTGGGCACTGCCTAGTGG + Intergenic
1199423659 X:147676370-147676392 CCCAACGGGGCACTGCCTGGTGG + Intergenic
1200356926 X:155562033-155562055 CCACACTGGGCACTGCCTAGTGG - Intronic
1201905564 Y:19082929-19082951 CTACACTGGGAACTGCCTGCTGG - Intergenic