ID: 1139850744

View in Genome Browser
Species Human (GRCh38)
Location 16:69950630-69950652
Sequence CCACGTGACTACAGGCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 2, 1: 1, 2: 0, 3: 9, 4: 105}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139850744_1139850756 -3 Left 1139850744 16:69950630-69950652 CCCCCTGGCCTGTAGTCACGTGG 0: 2
1: 1
2: 0
3: 9
4: 105
Right 1139850756 16:69950650-69950672 TGGGTGAGGGTGGTGGGCACCGG 0: 3
1: 1
2: 4
3: 90
4: 769
1139850744_1139850760 4 Left 1139850744 16:69950630-69950652 CCCCCTGGCCTGTAGTCACGTGG 0: 2
1: 1
2: 0
3: 9
4: 105
Right 1139850760 16:69950657-69950679 GGGTGGTGGGCACCGGGGCTGGG 0: 3
1: 0
2: 4
3: 64
4: 551
1139850744_1139850759 3 Left 1139850744 16:69950630-69950652 CCCCCTGGCCTGTAGTCACGTGG 0: 2
1: 1
2: 0
3: 9
4: 105
Right 1139850759 16:69950656-69950678 AGGGTGGTGGGCACCGGGGCTGG 0: 3
1: 0
2: 2
3: 62
4: 561
1139850744_1139850755 -9 Left 1139850744 16:69950630-69950652 CCCCCTGGCCTGTAGTCACGTGG 0: 2
1: 1
2: 0
3: 9
4: 105
Right 1139850755 16:69950644-69950666 GTCACGTGGGTGAGGGTGGTGGG 0: 2
1: 1
2: 3
3: 28
4: 184
1139850744_1139850758 -1 Left 1139850744 16:69950630-69950652 CCCCCTGGCCTGTAGTCACGTGG 0: 2
1: 1
2: 0
3: 9
4: 105
Right 1139850758 16:69950652-69950674 GGTGAGGGTGGTGGGCACCGGGG 0: 3
1: 0
2: 3
3: 43
4: 611
1139850744_1139850754 -10 Left 1139850744 16:69950630-69950652 CCCCCTGGCCTGTAGTCACGTGG 0: 2
1: 1
2: 0
3: 9
4: 105
Right 1139850754 16:69950643-69950665 AGTCACGTGGGTGAGGGTGGTGG 0: 2
1: 1
2: 2
3: 31
4: 429
1139850744_1139850757 -2 Left 1139850744 16:69950630-69950652 CCCCCTGGCCTGTAGTCACGTGG 0: 2
1: 1
2: 0
3: 9
4: 105
Right 1139850757 16:69950651-69950673 GGGTGAGGGTGGTGGGCACCGGG 0: 2
1: 2
2: 11
3: 81
4: 724

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139850744 Original CRISPR CCACGTGACTACAGGCCAGG GGG (reversed) Intergenic
900398364 1:2462504-2462526 CCACCTGACAGCAGGCCATGGGG - Intronic
900755585 1:4432315-4432337 CCACACGACCACAGGCCAGCAGG - Intergenic
902032112 1:13430613-13430635 CCAGGTGGGTACAGGCTAGGTGG + Intergenic
902436771 1:16403146-16403168 CCACGTGTCTCCAGGGCAGGTGG - Intronic
903230244 1:21917669-21917691 CCACATGACTAAAGGCCTAGAGG - Intronic
907130996 1:52096837-52096859 CCACTGCACTACAGCCCAGGTGG + Intergenic
913459492 1:119068935-119068957 GCACATGACTAGAGGCCAGTGGG + Intronic
915129827 1:153688529-153688551 CCAAGAGCCTACAGGGCAGGAGG - Intronic
920031444 1:203039747-203039769 ACACGGGACTACAGGACAGCTGG - Intronic
922894247 1:229088256-229088278 CCACCTGACTACTGTGCAGGCGG + Intergenic
1070586882 10:77773065-77773087 TCACGTGATTACAGGATAGGCGG + Intergenic
1072236987 10:93461958-93461980 CCAGTTGACCACAGACCAGGTGG + Intronic
1079144665 11:17840062-17840084 CCAGGTGACCACATGTCAGGTGG - Intronic
1083199257 11:61109945-61109967 CCCCGAGACTCCAGACCAGGAGG - Intronic
1090355574 11:126138326-126138348 CCAAGAGACCACAGCCCAGGAGG - Intergenic
1092833655 12:12468116-12468138 TCACCAGACCACAGGCCAGGCGG - Exonic
1095876365 12:47083283-47083305 CCACCTGACTACAGGACGCGTGG - Intronic
1096964271 12:55612612-55612634 CCACATGACATCAGGCCAAGAGG + Intergenic
1103799873 12:123531320-123531342 CCATGTGACTTCAGACCTGGTGG + Intronic
1106715919 13:32387840-32387862 TCACGTGATTACAGGATAGGGGG - Intronic
1111108464 13:83675671-83675693 TCACGTGATCACAGGACAGGGGG + Intergenic
1112649263 13:101374761-101374783 CCACGTGTTTTCAGACCAGGAGG - Intronic
1116400743 14:44504502-44504524 CAACCTGACTACAGTTCAGGAGG + Exonic
1118226311 14:63902781-63902803 CCACCTCACTTGAGGCCAGGAGG - Intronic
1119425775 14:74533919-74533941 GCACCTGCCTCCAGGCCAGGCGG + Intronic
1127752186 15:62056879-62056901 TCACGTGTCCACAGGACAGGGGG - Intronic
1136112881 16:28075855-28075877 CCATGTGACTAGGGGTCAGGTGG - Intergenic
1137760555 16:50936627-50936649 CCAGGTGACCACGGGCCATGAGG + Intergenic
1139850744 16:69950630-69950652 CCACGTGACTACAGGCCAGGGGG - Intergenic
1139879729 16:70173542-70173564 CAACGTGACTACAGGCCAGGGGG - Intronic
1140372796 16:74422006-74422028 CCACGTGACTACAGGCCAGGGGG + Intergenic
1142218987 16:88843758-88843780 ACACGTTACCACAGGCCAGGTGG - Intronic
1142711629 17:1726798-1726820 CCAGGAGACCACAGGCCGGGAGG + Exonic
1143383019 17:6508121-6508143 CCAGGTGCCAAGAGGCCAGGAGG + Intronic
1143459392 17:7091572-7091594 TCACGTGATCACAGGACAGGGGG + Intergenic
1143499955 17:7332816-7332838 TCACGTGATCACAGGACAGGGGG + Intergenic
1147870617 17:43584729-43584751 CATTGTGATTACAGGCCAGGAGG - Intergenic
1148212107 17:45814820-45814842 CGAGGTGACTGCGGGCCAGGCGG - Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1153966843 18:10190129-10190151 TGACATCACTACAGGCCAGGTGG + Intergenic
1156405753 18:36781224-36781246 CCATGTGACCCCAGGCCAAGGGG - Intronic
1160629176 18:80233415-80233437 CAAGGTGACTGCAGGCCATGGGG + Intronic
1160698498 19:495701-495723 CCAGGAGACTTCAGTCCAGGGGG + Intronic
1161446880 19:4323550-4323572 CCAGGTGACGACAGGCCTGCAGG + Exonic
1163328812 19:16622826-16622848 CCAGGTGACTCCAGTCCAGCGGG - Intronic
1164821613 19:31255419-31255441 CAACGTCACTAAAGGCCTGGGGG + Intergenic
1168548261 19:57271825-57271847 CCACATGTCTACAATCCAGGTGG + Intergenic
928917102 2:36483997-36484019 CTACATGTCTACAGGCCAGTTGG + Intronic
935648947 2:105365803-105365825 CCACTGTACTACAGCCCAGGTGG + Intronic
946249442 2:218403577-218403599 CCATATGGCTACAGGGCAGGTGG - Intronic
947722909 2:232380246-232380268 CCAGATGACTACAGCCAAGGTGG + Exonic
947727259 2:232408327-232408349 CCAGATGACTACAGCCAAGGTGG + Exonic
947974387 2:234352454-234352476 TCACGTGATTACAGGACAGGAGG - Intergenic
948446019 2:238033487-238033509 CCACATGACACCTGGCCAGGAGG - Intronic
948462739 2:238138245-238138267 CCACGTGACAACAGAACAAGAGG + Intergenic
1168882199 20:1216706-1216728 TCACGTGATTACAGGATAGGGGG - Intergenic
1173193868 20:40897533-40897555 TCAGGTGCCTGCAGGCCAGGTGG - Intergenic
1175024611 20:55888796-55888818 CCATGTGCCTACAGACTAGGAGG - Intergenic
1175220491 20:57413987-57414009 CCACGTTCCTACAGGACCGGCGG + Intergenic
1175997693 20:62818829-62818851 CCAGGTGACCTCAGGCCTGGGGG - Intronic
1176154985 20:63614825-63614847 TCACGTGCCCACTGGCCAGGGGG - Intronic
1177772468 21:25531735-25531757 TCACGTGATCACAGGACAGGGGG + Intergenic
1179275951 21:39891730-39891752 TCACGTGATTACAGGATAGGGGG + Intronic
1179518143 21:41923881-41923903 CCAGGTGTGTACTGGCCAGGAGG + Intronic
1183217526 22:36490461-36490483 CCACGAGGCTCCAGGGCAGGGGG + Intronic
1185112416 22:48907906-48907928 TCACGTGATTACAGGATAGGGGG + Intergenic
1185376472 22:50484745-50484767 CCTCCTGACTACAGGGCATGAGG - Exonic
950415774 3:12868459-12868481 CCACGTGTCCACTGGACAGGGGG - Intronic
950689826 3:14646835-14646857 CCACGTGAAGACAGGGCTGGAGG + Intergenic
953029749 3:39171137-39171159 CCCCTTGAAAACAGGCCAGGTGG + Intergenic
954435800 3:50495296-50495318 TCAGGAGCCTACAGGCCAGGAGG - Intronic
955719408 3:61865629-61865651 CCACCTGCCGACAGGGCAGGTGG + Intronic
955771127 3:62385686-62385708 CCAGGAGTCCACAGGCCAGGGGG - Intergenic
956055238 3:65291477-65291499 CCACGTGACTCAAGGCCAAAAGG + Intergenic
961091119 3:124113659-124113681 CCTGGAGACTACTGGCCAGGTGG + Intronic
962346563 3:134623367-134623389 CCACTTCACGGCAGGCCAGGTGG + Intronic
963643337 3:147883700-147883722 CCACTGAGCTACAGGCCAGGGGG - Intergenic
966135053 3:176688686-176688708 CCACATGACTAAAGGTCATGTGG + Intergenic
969122712 4:4921650-4921672 CCACGTGACTACAGGGTAATTGG - Intergenic
970530109 4:16973024-16973046 CCAAGTTGCTGCAGGCCAGGTGG + Intergenic
970894435 4:21085957-21085979 CCACATCACTCCAGGCCAGGAGG + Intronic
977336040 4:95700911-95700933 GCAGGTGCCTAAAGGCCAGGAGG + Intergenic
979831743 4:125314233-125314255 CCAGGTGACTAGGGGGCAGGAGG - Intergenic
985553494 5:544768-544790 CCACCTGCTTGCAGGCCAGGGGG + Intergenic
992229698 5:74651948-74651970 CTACCTGACCACAGGCCAGGAGG - Intronic
995564571 5:113420593-113420615 CCACGTGACAGCAGGCCCAGAGG + Intronic
998041120 5:138951599-138951621 CGAGGTGACTAGAGGCCTGGGGG - Intronic
998147002 5:139734687-139734709 CCACATGACTTCAGGGCAAGGGG - Intergenic
1000961361 5:167605152-167605174 CCCCATGACTGCAGGCCATGGGG + Intronic
1001197691 5:169688266-169688288 CAACGTGAGTAAAGGCCACGAGG - Intronic
1001268447 5:170292479-170292501 CCATGAGACTTCAGGCCAGTTGG - Intronic
1002057451 5:176606713-176606735 TCAGGTGGCTACAGGCCAGGAGG - Intronic
1005864949 6:29930219-29930241 TCACGTGATTACAGGATAGGGGG + Intergenic
1006984433 6:38167632-38167654 CCACGTGACAACAGCTCAGGAGG + Intergenic
1017552197 6:155521059-155521081 CTTAGTGACTACAGGGCAGGAGG + Intergenic
1019224657 6:170500127-170500149 TCAAGGGCCTACAGGCCAGGAGG - Intergenic
1023368668 7:39490428-39490450 CCAGGTGGCTGCAGGCCAGAAGG + Intronic
1027263349 7:76480446-76480468 CCCCGGGACTCCAGGCCAGAGGG + Exonic
1027314727 7:76978553-76978575 CCCCGGGACTCCAGGCCAGAGGG + Intergenic
1031544201 7:123032218-123032240 CCACAGTAATACAGGCCAGGTGG + Intergenic
1031896618 7:127357108-127357130 CCACGTACCTCCAGGCCAGTGGG - Intronic
1031974756 7:128086580-128086602 CTACGTTCCCACAGGCCAGGGGG - Intronic
1035691125 8:1560643-1560665 CTCCGTGTCTTCAGGCCAGGTGG - Intronic
1039768948 8:40663196-40663218 CAGCATGACTACAGGCCAGATGG - Intronic
1046067517 8:109214136-109214158 TCACGTGTCTACTGGACAGGGGG - Intergenic
1047662718 8:127055065-127055087 CTATGTGACTGCAGGCAAGGAGG + Intergenic
1049635060 8:143683770-143683792 TCACATGATTACAGGACAGGGGG - Intergenic
1050151717 9:2623471-2623493 GCACGTGACTGCAGGCCGGCAGG - Intronic
1052300763 9:26949984-26950006 TTACGTGACTCCAGGGCAGGAGG + Intronic
1057489553 9:95510822-95510844 CCACGTGACCCCGCGCCAGGAGG + Intronic
1059887805 9:118766592-118766614 ACATGTGACTACAGGCTAGAAGG + Intergenic
1060050928 9:120377602-120377624 CCACGTGACCACAAGCCACGAGG - Intergenic
1062590532 9:137272597-137272619 CCTGGAGCCTACAGGCCAGGTGG + Exonic
1196401651 X:115323392-115323414 CCAGATTACCACAGGCCAGGTGG + Intergenic
1196814145 X:119651735-119651757 CCACATGGCTGCAGGCCTGGTGG - Intronic
1196908327 X:120460656-120460678 TCAGGTGAATACAGGCCAGGTGG + Intronic
1199706060 X:150426414-150426436 CCAGCTGAATACAGACCAGGAGG - Intronic