ID: 1139851002

View in Genome Browser
Species Human (GRCh38)
Location 16:69951620-69951642
Sequence ACCGCCCCCGGGCTGTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 3, 1: 0, 2: 2, 3: 11, 4: 135}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139851002_1139851017 13 Left 1139851002 16:69951620-69951642 CCCTGGGACAGCCCGGGGGCGGT 0: 3
1: 0
2: 2
3: 11
4: 135
Right 1139851017 16:69951656-69951678 TGGACTGGGGAGGAAGGAGGAGG 0: 3
1: 1
2: 10
3: 160
4: 1582
1139851002_1139851011 -2 Left 1139851002 16:69951620-69951642 CCCTGGGACAGCCCGGGGGCGGT 0: 3
1: 0
2: 2
3: 11
4: 135
Right 1139851011 16:69951641-69951663 GTGAGGGGTGGATGCTGGACTGG 0: 3
1: 0
2: 1
3: 41
4: 338
1139851002_1139851010 -7 Left 1139851002 16:69951620-69951642 CCCTGGGACAGCCCGGGGGCGGT 0: 3
1: 0
2: 2
3: 11
4: 135
Right 1139851010 16:69951636-69951658 GGGCGGTGAGGGGTGGATGCTGG 0: 3
1: 0
2: 1
3: 57
4: 590
1139851002_1139851014 3 Left 1139851002 16:69951620-69951642 CCCTGGGACAGCCCGGGGGCGGT 0: 3
1: 0
2: 2
3: 11
4: 135
Right 1139851014 16:69951646-69951668 GGGTGGATGCTGGACTGGGGAGG 0: 3
1: 0
2: 2
3: 51
4: 522
1139851002_1139851016 10 Left 1139851002 16:69951620-69951642 CCCTGGGACAGCCCGGGGGCGGT 0: 3
1: 0
2: 2
3: 11
4: 135
Right 1139851016 16:69951653-69951675 TGCTGGACTGGGGAGGAAGGAGG 0: 3
1: 0
2: 6
3: 77
4: 693
1139851002_1139851020 26 Left 1139851002 16:69951620-69951642 CCCTGGGACAGCCCGGGGGCGGT 0: 3
1: 0
2: 2
3: 11
4: 135
Right 1139851020 16:69951669-69951691 AAGGAGGAGGAAGGAGGACCAGG 0: 4
1: 0
2: 29
3: 282
4: 1936
1139851002_1139851018 17 Left 1139851002 16:69951620-69951642 CCCTGGGACAGCCCGGGGGCGGT 0: 3
1: 0
2: 2
3: 11
4: 135
Right 1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG 0: 3
1: 0
2: 45
3: 416
4: 2798
1139851002_1139851013 0 Left 1139851002 16:69951620-69951642 CCCTGGGACAGCCCGGGGGCGGT 0: 3
1: 0
2: 2
3: 11
4: 135
Right 1139851013 16:69951643-69951665 GAGGGGTGGATGCTGGACTGGGG 0: 3
1: 0
2: 1
3: 20
4: 450
1139851002_1139851019 20 Left 1139851002 16:69951620-69951642 CCCTGGGACAGCCCGGGGGCGGT 0: 3
1: 0
2: 2
3: 11
4: 135
Right 1139851019 16:69951663-69951685 GGGAGGAAGGAGGAGGAAGGAGG 0: 5
1: 45
2: 235
3: 1373
4: 5879
1139851002_1139851012 -1 Left 1139851002 16:69951620-69951642 CCCTGGGACAGCCCGGGGGCGGT 0: 3
1: 0
2: 2
3: 11
4: 135
Right 1139851012 16:69951642-69951664 TGAGGGGTGGATGCTGGACTGGG 0: 3
1: 0
2: 3
3: 25
4: 294
1139851002_1139851015 7 Left 1139851002 16:69951620-69951642 CCCTGGGACAGCCCGGGGGCGGT 0: 3
1: 0
2: 2
3: 11
4: 135
Right 1139851015 16:69951650-69951672 GGATGCTGGACTGGGGAGGAAGG 0: 3
1: 0
2: 2
3: 72
4: 686
1139851002_1139851021 27 Left 1139851002 16:69951620-69951642 CCCTGGGACAGCCCGGGGGCGGT 0: 3
1: 0
2: 2
3: 11
4: 135
Right 1139851021 16:69951670-69951692 AGGAGGAGGAAGGAGGACCAGGG 0: 3
1: 1
2: 37
3: 317
4: 1725

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139851002 Original CRISPR ACCGCCCCCGGGCTGTCCCA GGG (reversed) Intronic
900601879 1:3506225-3506247 GCTGCCCCCAGGCTGCCCCAAGG - Exonic
900804787 1:4760542-4760564 CCCGCCCCTGGGATGGCCCAGGG + Intronic
902348204 1:15834914-15834936 GGCGCGCCCGGGCTGTCCCTCGG - Intergenic
902618075 1:17634768-17634790 CCTGCCCCAGGGCTGGCCCAGGG - Intronic
902843211 1:19088679-19088701 CCAACCCCAGGGCTGTCCCATGG + Intronic
904568305 1:31441852-31441874 CCTGCCCCCAGGCTTTCCCATGG - Intergenic
905615425 1:39394330-39394352 ACCGCCCCCAGCCTCTTCCAGGG - Intronic
918480785 1:184974544-184974566 ACAGCCCCCGGGCCGGCCCACGG - Exonic
923483856 1:234410642-234410664 CCAGACCCCGGGCTGTTCCAGGG - Intronic
1063658346 10:8013931-8013953 ACTGACCCAGGGCTGTCCTAGGG + Intronic
1070790465 10:79186206-79186228 CCCTCCCCTGGTCTGTCCCATGG + Intronic
1072543310 10:96414683-96414705 ACCTCCCCTGGGCTGTCCTATGG + Intronic
1075470936 10:122688631-122688653 ACCTCCCCTGGTCTGTCCCCTGG - Intergenic
1076156774 10:128210878-128210900 ACAGCGCCCCTGCTGTCCCACGG + Intergenic
1076793626 10:132788722-132788744 ACCGCGCCCGGGCTGTCCGGGGG + Intergenic
1076903806 10:133352457-133352479 ACTGCCCCCGCCCTGTCCCAAGG + Exonic
1077532986 11:3105993-3106015 CCCGCCCCTCGGCTGTCCCGAGG + Intronic
1080887156 11:36377320-36377342 TCCGCAGCCGGGCCGTCCCAGGG - Intronic
1085212210 11:74791446-74791468 ACAGTGCCCGGGCTGTGCCATGG + Intronic
1089270225 11:117296844-117296866 ACTTCCCCCGGGCTCTCCCCAGG + Intronic
1089299995 11:117492783-117492805 TCCGCCCCCAGCCTTTCCCAGGG - Intronic
1091179961 11:133595742-133595764 ACTGCCTCCGGGCAGACCCATGG + Intergenic
1096682863 12:53268486-53268508 AGCGGCCCGGGGCAGTCCCAAGG - Intronic
1103653322 12:122450479-122450501 ACCGCGCCCGGCCTCTCTCATGG + Intergenic
1104203694 12:126616611-126616633 CCTGCCCCCGGGCTGGTCCAGGG - Intergenic
1104266317 12:127235997-127236019 ACTGGCCGAGGGCTGTCCCAAGG - Intergenic
1104636058 12:130438408-130438430 ACGCCCACCGGGCTGTCCAATGG - Exonic
1105004771 12:132714715-132714737 GCCTCCCCAGGGCTGTGCCAAGG + Intronic
1105927186 13:25018641-25018663 GCCGCGGCCGGGCTGGCCCAGGG + Intergenic
1107559017 13:41544051-41544073 ACCCCACCCTGGCTATCCCAAGG + Intergenic
1108773537 13:53734722-53734744 ACCGCCCCTGGCCTATCCAAAGG - Intergenic
1109284818 13:60397513-60397535 TCCGCCCCCGGCCTCTCCCCGGG + Intronic
1113735002 13:112672283-112672305 ACCACGCACTGGCTGTCCCAGGG + Intronic
1119513118 14:75227302-75227324 ACTGCCCCTGTCCTGTCCCATGG + Intergenic
1122029089 14:98899598-98899620 ACTGCCCTCAGGCTGTCACAGGG - Intergenic
1122266470 14:100549168-100549190 ACCTCGCCCGGGCTGTTCCCTGG + Intronic
1122814545 14:104306073-104306095 AAGGCCCCCGGGCTTCCCCAGGG - Intergenic
1122918995 14:104871912-104871934 GCCACCCACGTGCTGTCCCACGG + Intronic
1123019929 14:105392927-105392949 ACAGCCCCCGGGCTGGCCTCGGG + Intronic
1123033529 14:105462279-105462301 ACTGCGCCCGGGCTGTGGCATGG - Intronic
1124268413 15:28258178-28258200 ACTGCGCCCGGCCTGACCCATGG - Intronic
1125513251 15:40303923-40303945 ACAGCCCCCTGGCTGCACCAAGG - Intronic
1129082119 15:73051519-73051541 ACTGGCCCCGGGGAGTCCCAGGG + Intergenic
1130082692 15:80748081-80748103 ACCACACCTGGGCTGTGCCATGG - Intronic
1130996074 15:88905035-88905057 ACCTCGCCCAGGCTGTCCCCTGG + Intronic
1132397962 15:101488734-101488756 CCCGGCCCTGCGCTGTCCCAAGG + Intronic
1136118905 16:28116170-28116192 ACCGCGCCCGGCCTGGCCAAAGG - Intronic
1138583520 16:57956580-57956602 ACAGGCCTCAGGCTGTCCCAGGG - Intronic
1139750315 16:69106080-69106102 CCCGACCCCGCGCGGTCCCAGGG - Intronic
1139851002 16:69951620-69951642 ACCGCCCCCGGGCTGTCCCAGGG - Intronic
1139879984 16:70174532-70174554 ACCGCCCCCGGGCTGTCCCAGGG - Intronic
1140372530 16:74420995-74421017 ACCGCCCCCGGGCTGTCCCAGGG + Intronic
1142497498 17:314167-314189 ACAGGCCCTGGACTGTCCCAGGG + Intronic
1142690827 17:1605382-1605404 CCCGCGCCCGCACTGTCCCAGGG - Intronic
1142960341 17:3548533-3548555 AGAGACCCCGGGCTTTCCCAAGG + Intronic
1144003167 17:11074360-11074382 ACCTCCCCTGGACAGTCCCAAGG + Intergenic
1144772819 17:17769362-17769384 ATCCGACCCGGGCTGTCCCAAGG - Intronic
1144847251 17:18226352-18226374 CGGGCCCCAGGGCTGTCCCAAGG - Intronic
1147653011 17:42072678-42072700 CCCGCCCCCGGGCGGCCCGACGG + Intergenic
1151499889 17:74481863-74481885 GCGGCCCCTGGGCTGTGCCAGGG + Intronic
1152244292 17:79177166-79177188 ACCTCCCCAGAGCTGGCCCAAGG + Intronic
1152317513 17:79589625-79589647 ACAGCCCCCAGGGCGTCCCAGGG - Intergenic
1152689918 17:81713257-81713279 AACGCCCCTTGGCTGTCCCTGGG - Intronic
1152695948 17:81795566-81795588 ACCGCACCCGGCCTTTCCTAGGG - Intergenic
1152725010 17:81940903-81940925 ACCACCAGCTGGCTGTCCCAGGG + Exonic
1156484394 18:37455798-37455820 TGGGCCCCCGGGCTCTCCCAGGG + Intronic
1157038096 18:44001607-44001629 ACCGCGCCCAGCCTGTCACATGG - Intergenic
1160014838 18:75132766-75132788 ACCTCTCCCGGGCTGGCCCTGGG + Intergenic
1162772256 19:12956308-12956330 ACCGCCCCCGGCCTGGGACAGGG + Intronic
1163282379 19:16325546-16325568 TGCGCCCCCGGGCTGACCCGTGG + Exonic
1166852269 19:45766566-45766588 CCCACCCCCGGGGTATCCCACGG - Exonic
1168229134 19:55017779-55017801 ACCGCGCCCGGCATATCCCAGGG - Intronic
928220504 2:29399334-29399356 AGGGTCCCCTGGCTGTCCCAAGG - Intronic
929568781 2:43006740-43006762 CCCTCCCCAGGGGTGTCCCAGGG - Intergenic
931418104 2:62100393-62100415 ACCTCCCGAGGGCTGTGCCACGG - Intronic
933087073 2:78067532-78067554 ACTGGCCACGGGCTGTCCCAGGG + Intergenic
936547368 2:113404266-113404288 ACCGCGCCCGGCCATTCCCAGGG - Intergenic
937248888 2:120511168-120511190 CCGCCCCCCAGGCTGTCCCAAGG - Intergenic
938020297 2:127900932-127900954 ACCGCGCCCGGCCTGTCCAGGGG + Intergenic
940453869 2:153872430-153872452 AGCGCCCCGGGCCGGTCCCAGGG + Intronic
942471897 2:176269377-176269399 CCCGCCCCCGCGCCGTCCTACGG - Intronic
945032911 2:205682156-205682178 AGCGCCCCCGGGCACCCCCAGGG - Intronic
945705671 2:213228148-213228170 AGCTCCTCCTGGCTGTCCCAGGG + Intergenic
947714949 2:232334743-232334765 CCCGCCCCCGGGCTCTCCCAGGG - Intronic
947733491 2:232443433-232443455 GCTGTCCCAGGGCTGTCCCAGGG + Intergenic
947734024 2:232445694-232445716 CCCGCCCCCGGGCTCTCCCAGGG - Intergenic
947999330 2:234554756-234554778 ACAGCCACCTGGCTGTCCTATGG + Intergenic
948612367 2:239178105-239178127 ACTTCCCCCGGGCTGGCCCAGGG - Intronic
1171995043 20:31724346-31724368 ACCGCGCCCGGCCTGTCCTATGG - Intergenic
1175846941 20:62064603-62064625 ACCCCCACCGGGCTGCCCAAAGG - Exonic
1178263512 21:31121274-31121296 AGATCCCCAGGGCTGTCCCAGGG + Intronic
1178425190 21:32473562-32473584 ACAGTCCCAGGGCGGTCCCATGG + Intronic
1182838077 22:33360793-33360815 ACCGCCACTGGGCTGTACGAAGG + Intronic
1184233162 22:43169245-43169267 GCCACCCTCTGGCTGTCCCAGGG + Intronic
1184656246 22:45943587-45943609 TCCTCCCCGGGGCTGCCCCAGGG + Intronic
1184797136 22:46738822-46738844 GCCGCCCCCGAGCTGGCCCTAGG + Intergenic
1185008461 22:48299611-48299633 ACCACACCCGGCATGTCCCAGGG + Intergenic
1185037347 22:48486388-48486410 ACCACCCCCGGGCAGCCCGAAGG - Intergenic
1185111439 22:48902294-48902316 ACCTCCTCCTGGCAGTCCCAGGG - Intergenic
1185295151 22:50049543-50049565 ACCTCCCCAGGGCTGTGACAGGG + Intronic
949355863 3:3179780-3179802 AGCGCCCCCTGGCGGCCCCAGGG + Intergenic
954756269 3:52842005-52842027 ACTCCCTCCAGGCTGTCCCAGGG + Intronic
955224917 3:57052733-57052755 AGAGCACTCGGGCTGTCCCAAGG + Intronic
964841109 3:160994488-160994510 TGAGCCCCCAGGCTGTCCCATGG - Intronic
966874895 3:184315978-184316000 AGGGCCCCTGGGCTGTCCCCGGG + Intronic
968623377 4:1614671-1614693 ACCTCCCCTGGGCTGCCCCCAGG - Intergenic
968634044 4:1668611-1668633 CCCTCCCCCGTGCTGTCACAGGG - Intronic
969221333 4:5760839-5760861 ACCGCTCCCGGCCTGGCCCAAGG + Intronic
969474373 4:7412834-7412856 CCCACCCCTGGGCTCTCCCAGGG + Intronic
984018494 4:174454988-174455010 ACCGCGCCCGGCCTTTCCCAAGG + Intergenic
984842828 4:184083619-184083641 ACTGGACTCGGGCTGTCCCAGGG + Intergenic
985664936 5:1177200-1177222 ACCGCCCCCGGGGTTGCCCACGG + Intergenic
991436069 5:66597516-66597538 ACCACCCGCGGGCGATCCCAGGG - Intronic
1001819335 5:174697814-174697836 ACCGCCCCTGTGCTGTACCTCGG - Intergenic
1002436426 5:179234575-179234597 ACTGCCCCTGGGGTGTCACAAGG + Intronic
1002763293 6:218230-218252 TCTGCCCCCTGGCTGTCCCCGGG - Intergenic
1006184964 6:32176230-32176252 CCCGCCCCAGGGCTCTCCCTCGG + Intronic
1007410516 6:41658710-41658732 ACAGCCCCCGGCCCCTCCCAAGG + Intergenic
1007596465 6:43053888-43053910 TCCGCCCCGGCGCTCTCCCAGGG - Exonic
1013538845 6:111087855-111087877 GCCGCCTCGGGGCTGTCCGAGGG - Exonic
1019292329 7:256845-256867 ACCGCAGCCGGGCCGTGCCACGG - Intronic
1019710541 7:2516385-2516407 CCCTCCCCCGGGCTGTTCCTTGG - Intronic
1019745826 7:2699995-2700017 ACCGTCCCCTGGGTGGCCCATGG + Intronic
1029715651 7:102324072-102324094 CCCCCCCCCGGGCTCTCCCAAGG + Intergenic
1033732895 7:144195838-144195860 CCAGGCCGCGGGCTGTCCCAGGG + Intergenic
1033743747 7:144294418-144294440 CCAGGCCGCGGGCTGTCCCAGGG + Intergenic
1033750154 7:144355179-144355201 CCAGGCCGCGGGCTGTCCCAGGG - Intergenic
1034433355 7:151051692-151051714 ACCGTGCCCGGCCTCTCCCAGGG + Intronic
1035191208 7:157170341-157170363 AGCGCCCCCGGACTGTGACAAGG - Exonic
1039144959 8:34437517-34437539 ATGGCTCCTGGGCTGTCCCAGGG - Intergenic
1045305384 8:100952617-100952639 ACTGCCCCAGGGCCGTCCCCGGG + Intronic
1048981155 8:139703876-139703898 ACCGCCACCGCGCCGTCCCCCGG - Intergenic
1049373049 8:142276805-142276827 ACAGACCCAGGGCGGTCCCAGGG + Intronic
1053238106 9:36474022-36474044 ACCGCGCCCGGTCTGTGCTAGGG - Intronic
1060528223 9:124332488-124332510 ACCTGCCCCTGTCTGTCCCATGG + Intronic
1061870654 9:133518574-133518596 ACAGCCCCCTGCCTGTCTCATGG - Intronic
1062008307 9:134252775-134252797 ACCTCCCCTGGGCAGTCCCCAGG - Intergenic
1062028264 9:134350467-134350489 ACCGCCCACGGGCAGCCCCTGGG - Intronic
1062651967 9:137582496-137582518 ACAGCCCCCGGGCTCTACCCTGG - Exonic
1203792150 EBV:157513-157535 ACGGCCCCCGGGAAGTCCCTGGG - Intergenic
1186823725 X:13316842-13316864 CCCGCCCCCGTGCTGCCCCTAGG + Intergenic
1190265722 X:48826462-48826484 ACCGCCGCCGGGGTGCCCCGGGG + Intergenic
1191917204 X:66215776-66215798 ACAGTCCCTTGGCTGTCCCATGG - Intronic
1192755952 X:74047253-74047275 ACCGCGCCCGGCCTGGCCCTTGG - Intergenic
1194505073 X:94724115-94724137 ACAGTTCCCTGGCTGTCCCATGG + Intergenic
1195174647 X:102304055-102304077 ACCACCCCCGGGTTTTCCAAAGG - Intergenic
1195184218 X:102383038-102383060 ACCACCCCCGGGTTTTCCAAAGG + Intronic
1195324029 X:103743592-103743614 ACCGCGCCCGGCCTCACCCAGGG + Intergenic
1200003089 X:153072166-153072188 ACCCCCACCGGGGTGTCCAAAGG - Intergenic
1200004634 X:153077843-153077865 ACCCCCACCGGGGTGTCCAAAGG + Intergenic
1200145781 X:153926047-153926069 AGCGTCCCCGCGCTGGCCCAGGG - Intronic