ID: 1139851003

View in Genome Browser
Species Human (GRCh38)
Location 16:69951621-69951643
Sequence CACCGCCCCCGGGCTGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 3, 1: 1, 2: 4, 3: 47, 4: 374}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139851003_1139851010 -8 Left 1139851003 16:69951621-69951643 CCTGGGACAGCCCGGGGGCGGTG 0: 3
1: 1
2: 4
3: 47
4: 374
Right 1139851010 16:69951636-69951658 GGGCGGTGAGGGGTGGATGCTGG 0: 3
1: 0
2: 1
3: 57
4: 590
1139851003_1139851014 2 Left 1139851003 16:69951621-69951643 CCTGGGACAGCCCGGGGGCGGTG 0: 3
1: 1
2: 4
3: 47
4: 374
Right 1139851014 16:69951646-69951668 GGGTGGATGCTGGACTGGGGAGG 0: 3
1: 0
2: 2
3: 51
4: 522
1139851003_1139851019 19 Left 1139851003 16:69951621-69951643 CCTGGGACAGCCCGGGGGCGGTG 0: 3
1: 1
2: 4
3: 47
4: 374
Right 1139851019 16:69951663-69951685 GGGAGGAAGGAGGAGGAAGGAGG 0: 5
1: 45
2: 235
3: 1373
4: 5879
1139851003_1139851017 12 Left 1139851003 16:69951621-69951643 CCTGGGACAGCCCGGGGGCGGTG 0: 3
1: 1
2: 4
3: 47
4: 374
Right 1139851017 16:69951656-69951678 TGGACTGGGGAGGAAGGAGGAGG 0: 3
1: 1
2: 10
3: 160
4: 1582
1139851003_1139851012 -2 Left 1139851003 16:69951621-69951643 CCTGGGACAGCCCGGGGGCGGTG 0: 3
1: 1
2: 4
3: 47
4: 374
Right 1139851012 16:69951642-69951664 TGAGGGGTGGATGCTGGACTGGG 0: 3
1: 0
2: 3
3: 25
4: 294
1139851003_1139851022 30 Left 1139851003 16:69951621-69951643 CCTGGGACAGCCCGGGGGCGGTG 0: 3
1: 1
2: 4
3: 47
4: 374
Right 1139851022 16:69951674-69951696 GGAGGAAGGAGGACCAGGGCTGG 0: 3
1: 1
2: 15
3: 146
4: 1118
1139851003_1139851015 6 Left 1139851003 16:69951621-69951643 CCTGGGACAGCCCGGGGGCGGTG 0: 3
1: 1
2: 4
3: 47
4: 374
Right 1139851015 16:69951650-69951672 GGATGCTGGACTGGGGAGGAAGG 0: 3
1: 0
2: 2
3: 72
4: 686
1139851003_1139851021 26 Left 1139851003 16:69951621-69951643 CCTGGGACAGCCCGGGGGCGGTG 0: 3
1: 1
2: 4
3: 47
4: 374
Right 1139851021 16:69951670-69951692 AGGAGGAGGAAGGAGGACCAGGG 0: 3
1: 1
2: 37
3: 317
4: 1725
1139851003_1139851011 -3 Left 1139851003 16:69951621-69951643 CCTGGGACAGCCCGGGGGCGGTG 0: 3
1: 1
2: 4
3: 47
4: 374
Right 1139851011 16:69951641-69951663 GTGAGGGGTGGATGCTGGACTGG 0: 3
1: 0
2: 1
3: 41
4: 338
1139851003_1139851016 9 Left 1139851003 16:69951621-69951643 CCTGGGACAGCCCGGGGGCGGTG 0: 3
1: 1
2: 4
3: 47
4: 374
Right 1139851016 16:69951653-69951675 TGCTGGACTGGGGAGGAAGGAGG 0: 3
1: 0
2: 6
3: 77
4: 693
1139851003_1139851013 -1 Left 1139851003 16:69951621-69951643 CCTGGGACAGCCCGGGGGCGGTG 0: 3
1: 1
2: 4
3: 47
4: 374
Right 1139851013 16:69951643-69951665 GAGGGGTGGATGCTGGACTGGGG 0: 3
1: 0
2: 1
3: 20
4: 450
1139851003_1139851018 16 Left 1139851003 16:69951621-69951643 CCTGGGACAGCCCGGGGGCGGTG 0: 3
1: 1
2: 4
3: 47
4: 374
Right 1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG 0: 3
1: 0
2: 45
3: 416
4: 2798
1139851003_1139851020 25 Left 1139851003 16:69951621-69951643 CCTGGGACAGCCCGGGGGCGGTG 0: 3
1: 1
2: 4
3: 47
4: 374
Right 1139851020 16:69951669-69951691 AAGGAGGAGGAAGGAGGACCAGG 0: 4
1: 0
2: 29
3: 282
4: 1936

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139851003 Original CRISPR CACCGCCCCCGGGCTGTCCC AGG (reversed) Intronic
900143189 1:1147052-1147074 CACCGCCCCAGGGCTGTCCTTGG - Intergenic
900401209 1:2473702-2473724 CCCTGCCCCAGGGATGTCCCGGG + Intronic
900435424 1:2628698-2628720 CCCCCGCCCCCGGCTGTCCCGGG - Intronic
900804785 1:4760541-4760563 CCCCGCCCCTGGGATGGCCCAGG + Intronic
900892946 1:5462807-5462829 CACTGCCCCCCTGCAGTCCCAGG + Intergenic
901525970 1:9823700-9823722 CCCCGCTCCCGCGCTGGCCCCGG - Exonic
902618077 1:17634769-17634791 CCCTGCCCCAGGGCTGGCCCAGG - Intronic
902703468 1:18189001-18189023 CACTGCCCCTGGGCTCACCCTGG + Intronic
902769326 1:18636625-18636647 CCCCGCAGCCGGGCTCTCCCGGG - Intronic
902865412 1:19274439-19274461 GCCCGCCCCGGAGCTGTCCCAGG + Intergenic
903105896 1:21079861-21079883 CACCGCACCCGGGCCATGCCTGG - Intronic
903398333 1:23019739-23019761 CACCGCCCCCGGCCCGACCTCGG - Exonic
903799768 1:25957922-25957944 CACCGCGCCCGGCCTGTCTTGGG - Intergenic
903834684 1:26195788-26195810 CACCGCGCCCGGCCTATGCCAGG + Intronic
904081964 1:27877852-27877874 CACTGCACCCAGCCTGTCCCAGG - Intronic
904701647 1:32361753-32361775 TACCGCCTCCGGGCTGTCCTGGG + Exonic
905037980 1:34929781-34929803 CCCCGCCCCCGCGCGGACCCAGG + Intergenic
905615426 1:39394331-39394353 CACCGCCCCCAGCCTCTTCCAGG - Intronic
906135776 1:43499782-43499804 CACCGCACCCGGCCAGTACCAGG + Intergenic
906214322 1:44030364-44030386 CCCCGCCCCCGGGCCGGCACCGG + Intronic
906251483 1:44314069-44314091 CACCACCCCCAGCATGTCCCTGG + Intronic
906678494 1:47709658-47709680 CCCCTCCCCCGGCCTGACCCTGG + Intergenic
909180610 1:72419479-72419501 CACCGTCCCAAGGCTGTCACTGG - Intergenic
910128361 1:83871605-83871627 CACCGCGCCCGGCCTATCCCTGG - Intronic
912142451 1:106747920-106747942 CGCCGCCCCCGGGCCATACCTGG + Intergenic
912794604 1:112684554-112684576 CACCGTGCCCGGACAGTCCCTGG + Intronic
914323204 1:146585036-146585058 GACCACCCCTGGGCTGTTCCAGG - Intergenic
914717125 1:150262433-150262455 CACCATCCCCCCGCTGTCCCCGG - Intronic
914824834 1:151133000-151133022 CACCGCCGCCCGGCTGTCCCGGG - Exonic
915516308 1:156414651-156414673 CACCGCCCGGGAGCTGTCCGTGG + Exonic
918180596 1:182083563-182083585 CACCGCCCTCCTGCTGTCTCCGG + Intergenic
918629491 1:186699257-186699279 CACCGCGCCCGGCCGGGCCCAGG - Intergenic
918793170 1:188857768-188857790 CACCGCCCCCAGGCAGTGCGGGG + Intergenic
919826475 1:201506959-201506981 CGCAGCCCCGGGGCTGTCGCAGG - Intronic
921697558 1:218229758-218229780 CACTGCACCTGGACTGTCCCAGG - Intergenic
922315240 1:224435359-224435381 CACAGCTCCCGGGATGGCCCCGG - Intronic
922385105 1:225074285-225074307 CACCGCGCCCGGCCTGTCTTAGG + Intronic
923483858 1:234410643-234410665 CCCAGACCCCGGGCTGTTCCAGG - Intronic
924414952 1:243849770-243849792 CGCCGCCCCCCAGCTTTCCCCGG + Intronic
1063937913 10:11098041-11098063 CACTGAACCAGGGCTGTCCCTGG + Intronic
1065593228 10:27286984-27287006 CACTGCGCCCGGCCTGTCCCAGG - Intergenic
1065657140 10:27963293-27963315 CACTGCACCCGGCCTGTCCCAGG + Intronic
1066465021 10:35642864-35642886 CATCTCACCCGGGCCGTCCCGGG - Intergenic
1067015753 10:42755356-42755378 CACCGCTCAGGCGCTGTCCCAGG + Intergenic
1067065388 10:43101437-43101459 CCCTGCACCCTGGCTGTCCCTGG - Intronic
1067400833 10:45972171-45972193 CACTGTCCCCGGGCCGGCCCCGG + Intergenic
1067449859 10:46375664-46375686 CCTCGCCCCCGGGCTCTGCCTGG - Exonic
1067587391 10:47484099-47484121 CCTCGCCCCCGGGCTCTGCCTGG + Exonic
1067634446 10:47991866-47991888 CCTCGCCCCCGGGCTCTGCCTGG + Intergenic
1067831747 10:49614547-49614569 CTCGGCCCCGGTGCTGTCCCTGG - Intronic
1067869184 10:49941742-49941764 CACTGTCCCCGGGCCGGCCCGGG + Exonic
1069386168 10:67884912-67884934 CGCCGCACCCGGGCAGCCCCTGG - Exonic
1069889187 10:71642686-71642708 CACCGCACCCGGCCTGGGCCCGG + Intronic
1070329710 10:75408603-75408625 CCCCTCCCCCGCGCTCTCCCCGG - Intergenic
1070570734 10:77637990-77638012 CGCCGCCCCCGGGCCCGCCCCGG + Intronic
1071955929 10:90759365-90759387 CACCGCGCCCGGCCTTTCCCTGG - Intronic
1072669349 10:97417821-97417843 CACCGTGCCTGGCCTGTCCCTGG + Intronic
1073175277 10:101552480-101552502 CACCGCACCCGGCCTGTCTCTGG + Intronic
1074151436 10:110763061-110763083 CACAGCCCACAGGCTGTCCCAGG - Intronic
1074865798 10:117543723-117543745 CACTGCCCCCGGCCTGCTCCGGG + Intronic
1076035282 10:127195239-127195261 CCCCGACCCCGGGCTGCCCGCGG + Intronic
1076216771 10:128701380-128701402 CACCTCCACGTGGCTGTCCCTGG - Intergenic
1076368683 10:129937741-129937763 AACCTGTCCCGGGCTGTCCCTGG + Intronic
1076793625 10:132788721-132788743 TACCGCGCCCGGGCTGTCCGGGG + Intergenic
1076902885 10:133348319-133348341 TCCCGGCCCCGGGCTGTCCGGGG + Intronic
1077244157 11:1527906-1527928 CCCCGGCCCCCGGCTCTCCCTGG + Intergenic
1079027657 11:16961536-16961558 CACCCACCCCTGGCTGTGCCTGG + Intronic
1079376371 11:19895698-19895720 CTCCTACCCTGGGCTGTCCCAGG + Intronic
1083258561 11:61510806-61510828 CACCCCCTCGGGGCTGTCCCTGG - Exonic
1083329658 11:61891609-61891631 CCCCGCCCCCGGCCAGGCCCCGG + Intronic
1083762965 11:64828624-64828646 CACCGGCCCCGGCCTGTACCTGG - Intronic
1084063207 11:66688949-66688971 CACTGCCCCAGAGCTGTGCCAGG + Intronic
1084130391 11:67129444-67129466 CACCGCGCCCGGCCTATGCCCGG - Intronic
1084145249 11:67261720-67261742 CACAGTCCCCGCACTGTCCCCGG - Intergenic
1084978252 11:72814873-72814895 CTCCCCACCCGGGCAGTCCCCGG + Intronic
1086388811 11:86339334-86339356 CACCGCGCCCAGCCTGTACCAGG + Intronic
1089123366 11:116158471-116158493 CACCACCCCCAGGCTGTAACTGG - Intergenic
1089227155 11:116934789-116934811 CACCGCGCCCGGCCTATGCCTGG - Intronic
1089299996 11:117492784-117492806 CTCCGCCCCCAGCCTTTCCCAGG - Intronic
1090665285 11:128911170-128911192 CCCCACCCCGGGGCTCTCCCAGG - Intronic
1091225922 11:133956498-133956520 CACGGCCCCCAGGCCCTCCCCGG + Intronic
1091445587 12:542760-542782 CACTGCCCCGAGGCTGTCCCAGG + Intronic
1092166199 12:6343766-6343788 CACCGTCCCCTGGCTCTTCCTGG + Intergenic
1094618411 12:32057178-32057200 CACCGCGCCCGGCCAATCCCAGG + Intergenic
1096116783 12:49059837-49059859 CGCCGCCCTGGGGCTGTCCATGG - Intergenic
1101911567 12:108863916-108863938 CACCACCCCCTGACTGGCCCCGG + Intronic
1102959145 12:117080771-117080793 CCCCACACCCGGGCTGACCCTGG + Intronic
1104045868 12:125162476-125162498 CACCGCCGCCCTGCTGTCCCTGG + Intergenic
1104127124 12:125858384-125858406 CACCGCACCCGGCCAGTCTCAGG + Intergenic
1105369267 13:19788443-19788465 CACCGCACCCAGCCTGTCCTAGG - Intergenic
1105937738 13:25117602-25117624 CCCCGCCCCAGTGCTGCCCCCGG + Intergenic
1106526230 13:30543414-30543436 CACTGCACCCGGCCTGTTCCAGG + Intronic
1109284817 13:60397512-60397534 GTCCGCCCCCGGCCTCTCCCCGG + Intronic
1111720947 13:91944382-91944404 CACCGCGCCCGGCCTGTGGCAGG + Intronic
1112656109 13:101453895-101453917 CGCCGCCTGCAGGCTGTCCCGGG + Exonic
1113377959 13:109782369-109782391 CCAAGCCCCCGGGCTGACCCGGG + Exonic
1113735001 13:112672282-112672304 CACCACGCACTGGCTGTCCCAGG + Intronic
1113923786 13:113929272-113929294 CACCTCCTCAGGGCTGGCCCAGG + Intergenic
1115288825 14:31747423-31747445 CACCGCATCCGGCCTGTCCTGGG + Intronic
1115664960 14:35535358-35535380 ATCCGCCCCGGAGCTGTCCCTGG - Exonic
1117668768 14:58084102-58084124 CACCTCCCCAGGACTGTCCTGGG - Intronic
1117680678 14:58200066-58200088 CGCCGGGCCCGGGCTGTCCCAGG - Intronic
1117843217 14:59882098-59882120 CACCGCCCCCAGCCTCTCCCTGG + Intergenic
1119875320 14:78054413-78054435 CACCGCGCCCGGCCTGTTCCAGG + Intergenic
1122029090 14:98899599-98899621 CACTGCCCTCAGGCTGTCACAGG - Intergenic
1122623837 14:103074267-103074289 TACCGCCCCAGTGCTGTCCTGGG + Intergenic
1122637672 14:103138070-103138092 CCCCAGCTCCGGGCTGTCCCAGG - Intergenic
1122719901 14:103716101-103716123 CCCCGCCCCCGCTCTCTCCCAGG + Intronic
1123019928 14:105392926-105392948 GACAGCCCCCGGGCTGGCCTCGG + Intronic
1124082595 15:26515799-26515821 CACCGCGCCCGGCCTGTGCTGGG - Intergenic
1124251288 15:28107671-28107693 CGCCTGCCCCGGGCTATCCCGGG + Intergenic
1124423573 15:29542729-29542751 CACTGCTCCCCTGCTGTCCCTGG + Intronic
1124644576 15:31428516-31428538 CACCGCCCGCGGCCGGTCCTTGG - Intronic
1128634504 15:69294395-69294417 CACCGCACCCGGCCTGGCCATGG - Intergenic
1130551790 15:84894081-84894103 CACCGCGCCCGGCCTCTCCCTGG - Intronic
1131113074 15:89777175-89777197 CGCCACCCCAAGGCTGTCCCTGG + Exonic
1132498836 16:275873-275895 CGCCGCCCCCCGGCCGCCCCCGG - Exonic
1132643380 16:988052-988074 CTCTGCCCCTGGGCTGCCCCGGG + Intergenic
1132728706 16:1350119-1350141 CACCTCCTCCGGGCTGCCGCAGG + Exonic
1132853289 16:2034318-2034340 CACGGCCCCCAGGCTGGCCTGGG - Intronic
1132853315 16:2034391-2034413 CACGGCCCCCAGGCTGGCCTGGG - Intronic
1132853341 16:2034464-2034486 CACGGCCCCCAGGCTGGCCTGGG - Intronic
1132853367 16:2034537-2034559 CACGGCCCCCAGGCTGGCCTGGG - Intronic
1132853394 16:2034610-2034632 CACGGCCCCCAGGCTGGCCTGGG - Intronic
1132853420 16:2034683-2034705 CACGGCCCCCAGGCTGGCCTGGG - Intronic
1132853447 16:2034756-2034778 CACAGCCCCCAGGCTGGCCTGGG - Intronic
1132853470 16:2034829-2034851 CACGGCCCCCAGGCTGGCCTGGG - Intronic
1133315860 16:4883641-4883663 CACAGGCCGCGAGCTGTCCCCGG - Exonic
1135434543 16:22417563-22417585 CACTGCACCCGGCCAGTCCCAGG - Intronic
1136141665 16:28292611-28292633 CCCGGCCCCCGGCCTGGCCCGGG - Exonic
1136228072 16:28872203-28872225 CACCGCCCTCTGGCTCCCCCTGG - Exonic
1137609083 16:49807141-49807163 CACCGCCCCCGGCCTGGCTTGGG - Intronic
1138105419 16:54285070-54285092 CACCGAGCCTGAGCTGTCCCTGG - Exonic
1138583521 16:57956581-57956603 CACAGGCCTCAGGCTGTCCCAGG - Intronic
1139643879 16:68313111-68313133 CACCGTGCCTGGGCTGTTCCAGG + Intronic
1139750317 16:69106081-69106103 CCCCGACCCCGCGCGGTCCCAGG - Intronic
1139754098 16:69129140-69129162 CACCGCACCCGGCCTCTGCCTGG - Intronic
1139851003 16:69951621-69951643 CACCGCCCCCGGGCTGTCCCAGG - Intronic
1139879985 16:70174533-70174555 CACCGCCCCCGGGCTGTCCCAGG - Intronic
1139890626 16:70251393-70251415 CACCGCCGCCGCGCTCGCCCTGG - Exonic
1139890690 16:70251675-70251697 CGCCGCCCTCGGCCTGTCGCGGG + Exonic
1140010357 16:71125814-71125836 GACCACCCCTGGGCTGTTCCAGG + Intronic
1140372529 16:74420994-74421016 CACCGCCCCCGGGCTGTCCCAGG + Intronic
1141518066 16:84559580-84559602 CTCTGCCCCAGGGCTGGCCCTGG - Intergenic
1141556105 16:84837703-84837725 CACCGCCCCCGGCCAGCCACAGG + Intronic
1141972257 16:87492270-87492292 GGCCGCCCCCGCGCGGTCCCCGG - Intergenic
1142262942 16:89051068-89051090 CTCCGCCCCCGGGATGTCTCAGG + Intergenic
1142297547 16:89235868-89235890 CACCGCCCCCGGCCTGGGCTTGG - Exonic
1142497497 17:314166-314188 CACAGGCCCTGGACTGTCCCAGG + Intronic
1142666639 17:1467439-1467461 CGCCACCCCCGCCCTGTCCCCGG + Intronic
1143512876 17:7405589-7405611 CACGGCCCCAGGGCTGAGCCAGG + Intronic
1143521248 17:7445480-7445502 CCCCGCCCCCAGCCTGTCCCTGG - Intronic
1143628093 17:8122324-8122346 CCCCACCCCCGCGCTGTACCCGG + Exonic
1143658227 17:8309872-8309894 CACCTCGCCCGGCCTGTCCACGG + Intergenic
1144067320 17:11636290-11636312 CACCGCGCCTGGCCTGTTCCAGG + Intronic
1144096307 17:11903620-11903642 CACCGCGCCCGGGCCCTCCCTGG - Intronic
1144586577 17:16491433-16491455 CCCCGCCCACCGACTGTCCCCGG + Intronic
1144626345 17:16846183-16846205 CACCGTCCCCAGGCCCTCCCAGG + Intergenic
1144833360 17:18143865-18143887 CACAGGCCTCGGGCTGGCCCAGG + Exonic
1144880087 17:18426536-18426558 CACCGTCCCCAGGCCCTCCCAGG - Intergenic
1145152146 17:20517848-20517870 CACCGTCCCCAGGCCCTCCCAGG + Intergenic
1146163505 17:30572066-30572088 CACCGTCCCCAGGCCTTCCCAGG + Intergenic
1146646417 17:34579951-34579973 CGCCGCCCCCACCCTGTCCCCGG - Intergenic
1147580491 17:41624881-41624903 CACCGTCCCCAGGCCCTCCCAGG + Intergenic
1148196074 17:45714021-45714043 CCCCGCCCCTGGCCAGTCCCTGG - Intergenic
1149430200 17:56591614-56591636 CACCGTGCCCGGCCTGTACCAGG + Intergenic
1149614437 17:57987270-57987292 CACCGCTCCCCGCCTGCCCCGGG + Intronic
1150690998 17:67366674-67366696 CCCCACCCCCAGGCTGTCCGCGG - Intergenic
1151938860 17:77280923-77280945 CTCCGACCCCCGGCTGTGCCCGG + Intronic
1151974424 17:77476273-77476295 CACAGCCCCAGGGCTGACCCTGG - Intronic
1152689919 17:81713258-81713280 CAACGCCCCTTGGCTGTCCCTGG - Intronic
1152695949 17:81795567-81795589 CACCGCACCCGGCCTTTCCTAGG - Intergenic
1152725009 17:81940902-81940924 CACCACCAGCTGGCTGTCCCAGG + Exonic
1152782654 17:82233015-82233037 GACAGCCCCAGGGTTGTCCCTGG + Intronic
1153202911 18:2664001-2664023 CACCGCGCCCGGCCTATTCCAGG + Intronic
1153820084 18:8825230-8825252 CACCTCCCCCAGGCACTCCCGGG + Exonic
1155932792 18:31724457-31724479 CCCCACCCCCGGGCAGACCCGGG + Intergenic
1157294496 18:46433096-46433118 CACCAGCCCCAGGCTGCCCCGGG + Intronic
1157532197 18:48430424-48430446 CACAGGCCCAGGGCTGGCCCTGG + Intergenic
1160014837 18:75132765-75132787 TACCTCTCCCGGGCTGGCCCTGG + Intergenic
1160408590 18:78659778-78659800 CACCATCCCCCAGCTGTCCCTGG + Intergenic
1160724142 19:610207-610229 CACCGCCCCCGGCCTGCAGCGGG - Intronic
1160836542 19:1127253-1127275 CACCGCACCCGGGGAGTCCCTGG - Intronic
1161048653 19:2150752-2150774 CCCCGCCCCCGGACCCTCCCCGG - Intronic
1161051148 19:2164517-2164539 TGCCCCCGCCGGGCTGTCCCGGG + Intronic
1161063516 19:2226838-2226860 CAGCGGCCCCGGCCTGGCCCCGG + Exonic
1161142052 19:2653850-2653872 CACCACCCAGGCGCTGTCCCTGG + Intronic
1161175976 19:2842136-2842158 CACCGCTCCCGGGCTGTCCCGGG - Intronic
1161365263 19:3875575-3875597 CACCGCGCCCGGCCTCTCCTTGG + Intergenic
1161532939 19:4800987-4801009 CACCGCCCCTGTGCTGGGCCAGG + Exonic
1162060305 19:8090770-8090792 CACCGCCCCTGGCCTGCCCTGGG + Intronic
1162515035 19:11142664-11142686 CACCGGCCTCAGGCTGTCCTGGG + Intronic
1162535795 19:11262333-11262355 CACCGCCCCGGGGCGGAGCCGGG + Intronic
1162772255 19:12956307-12956329 CACCGCCCCCGGCCTGGGACAGG + Intronic
1162962500 19:14136301-14136323 CCCCACCCCCGGGCCGACCCCGG - Intronic
1163403814 19:17110385-17110407 CACAGCCCCTGGGCTGTCGACGG - Intronic
1163629926 19:18413063-18413085 CACTGTCCCCCAGCTGTCCCAGG - Intergenic
1165712870 19:38024537-38024559 CACTGCCCCCCAGCTGGCCCTGG + Intronic
1165991023 19:39813854-39813876 CACCGCACCAGCTCTGTCCCTGG - Intergenic
1166080198 19:40439365-40439387 CACCGCGCCTGGCCTGTACCTGG + Intergenic
1166109545 19:40613824-40613846 CACCGCCCCTCGGCTCTCCTAGG - Intronic
1166361316 19:42254028-42254050 CGCCGCCCCCGGGCTCGCGCGGG - Intronic
1166705259 19:44904892-44904914 CACCTCCCCCTGGCTGCCACAGG - Intergenic
1167217635 19:48175426-48175448 CTCGGCCCATGGGCTGTCCCTGG - Intronic
1167633768 19:50641455-50641477 CACCGCGCCCGGCCTAGCCCAGG + Intronic
1167641872 19:50686839-50686861 CCCCGCCCCCGGGGGCTCCCTGG - Intronic
1167767856 19:51496179-51496201 CACCGCGCCCAGGCTTTCCATGG - Intronic
1168073020 19:53963115-53963137 CACGGCCCCCCGGCTGCCCGTGG + Exonic
1168115787 19:54220882-54220904 CACCTCCCCAGGCCTCTCCCTGG + Intronic
1168118771 19:54240628-54240650 CACCTCCCCAGGCCTCTCCCTGG + Intronic
1168187670 19:54710033-54710055 CACCTCCCCAGGCCTCTCCCTGG - Intergenic
1168229135 19:55017780-55017802 CACCGCGCCCGGCATATCCCAGG - Intronic
1168710480 19:58497276-58497298 CACCGCCCCTGGACTCTCCCCGG - Intronic
925959759 2:9003746-9003768 CACCGCCCCCGGCCCCTCCCCGG - Exonic
926742744 2:16125964-16125986 CTGCTCCCCGGGGCTGTCCCTGG + Intergenic
927658439 2:24971695-24971717 CTCCGCCCCCGAGCAGGCCCGGG - Intronic
929742722 2:44620978-44621000 CACCGCACCCGGCCTGCTCCAGG - Intronic
929848869 2:45562518-45562540 CACCGCGCCCGGCCTGTCACTGG + Intronic
930762331 2:55050105-55050127 GCCCGCCGCCGGGCTGTCCGCGG - Exonic
932015091 2:68017809-68017831 CACCACCCCCGGACAGGCCCTGG - Intergenic
932593608 2:73081122-73081144 CTCCTCCCCCAGGCTCTCCCTGG + Intronic
932835022 2:75028069-75028091 CAGAGCCCCCTGGCTGCCCCAGG - Intergenic
933087072 2:78067531-78067553 CACTGGCCACGGGCTGTCCCAGG + Intergenic
933270838 2:80231273-80231295 CACCACACCCGGCCTGTTCCTGG + Intronic
933852861 2:86385148-86385170 CACACTCCCCTGGCTGTCCCAGG + Intergenic
936370752 2:111899802-111899824 CACCGCGCCCGGCTTGTTCCAGG + Intronic
936547369 2:113404267-113404289 CACCGCGCCCGGCCATTCCCAGG - Intergenic
936629719 2:114189095-114189117 CACCGCACCCGGCCGATCCCTGG + Intergenic
936659069 2:114522270-114522292 CACCGCGCCCGGCCTATCCAAGG + Intronic
937694055 2:124788129-124788151 CACCTCCCCTGGGTTCTCCCAGG + Intronic
937887184 2:126907930-126907952 CACCTCCCACGGGCTGCCCTGGG - Intergenic
938020296 2:127900931-127900953 CACCGCGCCCGGCCTGTCCAGGG + Intergenic
938397892 2:130964113-130964135 CAGCAGCGCCGGGCTGTCCCCGG + Intronic
940960131 2:159776139-159776161 CACTGCGCCCGGCCTGTGCCTGG + Intronic
941955694 2:171202165-171202187 CACCGCGCCCGGCCTGAGCCGGG - Intronic
942151064 2:173076156-173076178 CGCCGCCGCCGGGCGGGCCCTGG - Intronic
942599928 2:177630357-177630379 CACCGCTCCTGGGTTGCCCCTGG + Intronic
945099422 2:206250657-206250679 CACCGCGCCCGGCCTGTCTTGGG + Intergenic
946196130 2:218033892-218033914 CCCAGCCCCCGGGGAGTCCCTGG - Intergenic
946327881 2:218993989-218994011 CCGCGCCCCCGGGGTGTCCTCGG + Intergenic
947714951 2:232334744-232334766 GCCCGCCCCCGGGCTCTCCCAGG - Intronic
947734026 2:232445695-232445717 GCCCGCCCCCGGGCTCTCCCAGG - Intergenic
947854817 2:233315986-233316008 CACCGCGCCCGGGCTGCTGCTGG + Intronic
947913527 2:233817930-233817952 CACTGCCCCTGGGCAGCCCCAGG + Intronic
948612368 2:239178106-239178128 CACTTCCCCCGGGCTGGCCCAGG - Intronic
948650093 2:239437472-239437494 CACCAGCCTGGGGCTGTCCCAGG + Intergenic
948827069 2:240578008-240578030 CCCCTCCCCTGGGCTCTCCCAGG + Exonic
1168753758 20:301378-301400 CTCCAGCCCCTGGCTGTCCCTGG - Intergenic
1169321776 20:4639033-4639055 CACCGCGCCTGGGCAGACCCTGG - Intergenic
1170150409 20:13221430-13221452 CCCGGGTCCCGGGCTGTCCCGGG + Intergenic
1171222064 20:23407537-23407559 CACTGCCACCTGGCTGGCCCAGG + Intronic
1171980837 20:31627503-31627525 CACCACGCCCGGCCTGTACCTGG + Intergenic
1175997032 20:62816598-62816620 CACCCTCCCCGGGGTGTTCCTGG + Intronic
1176058250 20:63160342-63160364 CAAGGCCCCAGGGCTGGCCCTGG + Intergenic
1176286112 21:5020480-5020502 CACCGCCCCCGGGCGGCACTGGG + Intergenic
1178143159 21:29707150-29707172 CACCGCGCCCGGGCTATTCCAGG + Intronic
1178662542 21:34519683-34519705 CACCGCGCCCGGCCTGTGCTTGG + Intronic
1179782974 21:43714345-43714367 CACCGCGCCCGGCCAGTCCCAGG + Intergenic
1179840911 21:44072750-44072772 CACCGCGCCCGGCCTCTCCTAGG + Intronic
1179871069 21:44242995-44243017 CACCGCCCCCGGGCGGCACTGGG - Intergenic
1179891949 21:44339663-44339685 CACAGCCCCAGGGCTGCCCTGGG - Intergenic
1179932665 21:44580461-44580483 CACCGCCCCCTGCCTGACCCTGG - Exonic
1181381502 22:22508383-22508405 CCCCACCCCCGGGCTGGGCCCGG - Intronic
1181781748 22:25198725-25198747 CACCGCGCCCGGCCTGTAACTGG + Intergenic
1183189574 22:36313173-36313195 CACCGCGCCTGGCCTGTCTCTGG - Intronic
1183315513 22:37135011-37135033 CAGGGCCCCGGGGCTCTCCCTGG + Intronic
1183684388 22:39353148-39353170 CACCGCACCCGGCCTGGACCTGG + Intronic
1183684806 22:39355554-39355576 GGCCGCCCCTGGGCTGTCCCTGG - Intronic
1183959376 22:41402125-41402147 CACTGCCCCGTGGCTGTGCCAGG + Intergenic
1184233161 22:43169244-43169266 CGCCACCCTCTGGCTGTCCCAGG + Intronic
1184674822 22:46035996-46036018 CCCCGCCCCCCGGCTGCACCAGG + Intergenic
1184943185 22:47783424-47783446 CACCACGCCCGGCCTCTCCCAGG + Intergenic
1185008460 22:48299610-48299632 CACCACACCCGGCATGTCCCAGG + Intergenic
1185076866 22:48687810-48687832 CACCTTCCCTGGGCTGCCCCAGG + Intronic
1185295150 22:50049542-50049564 CACCTCCCCAGGGCTGTGACAGG + Intronic
1185372094 22:50465657-50465679 CCCCACCCCCAGGCTGGCCCCGG - Intronic
949355862 3:3179779-3179801 CAGCGCCCCCTGGCGGCCCCAGG + Intergenic
949552099 3:5120017-5120039 CACCGCGCCCGGCCTATCCTAGG + Intergenic
949571101 3:5294066-5294088 CACCGTGCCCGGCCAGTCCCAGG - Intergenic
950398503 3:12752508-12752530 CACCGCGCCCGGCCGGTCCTGGG - Intronic
951428259 3:22575411-22575433 CACTGCGCCCGGCCTGTCCCTGG - Intergenic
951554362 3:23905868-23905890 CACTGCACCCGGCCTCTCCCTGG - Intronic
951981870 3:28575564-28575586 CCCCGCCTCCGCGCTGGCCCTGG - Intergenic
954219144 3:49142178-49142200 CACAGCCCCAGGGGTCTCCCAGG + Intergenic
955023409 3:55143511-55143533 AACGGCCCCAGGGCTGTCCCTGG - Intergenic
956148155 3:66213109-66213131 CACCGCGCCTGGGCTGCGCCAGG - Intronic
957040419 3:75331788-75331810 CAGTGCCCTCGTGCTGTCCCAGG + Intergenic
960416426 3:117390362-117390384 CACCACCCCCTGGCTTTCCTGGG - Intergenic
961013417 3:123449856-123449878 CTCCGCCCCCGGCCTGGCCATGG + Intergenic
961045203 3:123703350-123703372 CAGTGCCCTCGTGCTGTCCCAGG + Intronic
961263338 3:125620194-125620216 CACCGCACCCAGCCAGTCCCTGG - Intergenic
961551804 3:127673714-127673736 CACCTCCCCTGGGCTGGCGCCGG + Intronic
961824294 3:129590805-129590827 CACGCCCCCAGGGCTGACCCAGG + Intronic
962168714 3:133077920-133077942 GAATGCCCCCGGGCTGTCCTGGG - Intronic
963349845 3:144138833-144138855 CACCTCCCCAGGGCTCTACCTGG + Intergenic
963365567 3:144330131-144330153 CACCGTCCCCGGCCTGTACCTGG - Intergenic
964112900 3:153105563-153105585 CACCGCACCCGGACATTCCCTGG + Intergenic
965674410 3:171179736-171179758 CACCGTGCCCGGCCTGTACCTGG + Intronic
966832054 3:184018040-184018062 CACCGCCCCCGGGATGTCACCGG - Intergenic
966874894 3:184315977-184315999 CAGGGCCCCTGGGCTGTCCCCGG + Intronic
967005955 3:185382714-185382736 CACCGCGCCCGGCCGGTACCAGG - Intronic
967417835 3:189238883-189238905 CACCTTCCCTGGGATGTCCCTGG + Exonic
967811008 3:193761120-193761142 CACCGCGCCCGGCCTGCGCCAGG - Intergenic
967846238 3:194045305-194045327 CACCTCTCCCGGGCTCTCCCTGG + Intergenic
967930251 3:194685956-194685978 CTCCGCTCCCGGGCTCTCCACGG - Intergenic
968603319 4:1520577-1520599 CACCAGCCCCGGCCTGTCCAGGG + Intergenic
968634046 4:1668612-1668634 CCCCTCCCCCGTGCTGTCACAGG - Intronic
968726375 4:2249748-2249770 AACAGCCCCTGGGCTGTGCCTGG - Exonic
968727622 4:2255641-2255663 CAGCACCCCACGGCTGTCCCTGG + Intronic
968815883 4:2821444-2821466 CACTGCCCCAGCCCTGTCCCAGG - Intronic
969032817 4:4227435-4227457 CACCCCCCTCGGGCTGGCTCCGG - Intergenic
969392823 4:6902274-6902296 CCCCACCCCCCGGCTGCCCCTGG - Intergenic
969474371 4:7412833-7412855 CCCCACCCCTGGGCTCTCCCAGG + Intronic
969911781 4:10454182-10454204 CACCACCCCTGGGCTGTCATGGG + Intronic
970195258 4:13545095-13545117 CCCCTCCACTGGGCTGTCCCGGG + Intergenic
974595240 4:64005419-64005441 CACCGCTCCCGGCCTGTATCAGG + Intergenic
975661103 4:76689659-76689681 CGCCGCCCCCGGGCTGCTCGGGG - Intronic
976120675 4:81777737-81777759 CACCTCCCCCGGACAGGCCCAGG + Intronic
976813590 4:89122229-89122251 CACCGCGCCCGGCCAGCCCCTGG - Intergenic
980923928 4:139115420-139115442 CACCGCCTCCGGGACGCCCCCGG + Intronic
982289617 4:153766513-153766535 TACCCTCCCCAGGCTGTCCCAGG + Intergenic
982988595 4:162242607-162242629 CACCGCGCCCGGCCTGTGACTGG - Intergenic
983235252 4:165171949-165171971 CACCGCGCCCAGCCTTTCCCAGG - Intronic
987132474 5:14872035-14872057 CGCCGCCCCCGGGCCGGCCGAGG - Intergenic
989178729 5:38556246-38556268 CACCCCGCCCGGGCCGCCCCTGG + Intronic
989188471 5:38646920-38646942 CATCGGCCCCAGGCTGCCCCAGG + Intergenic
989459695 5:41683363-41683385 CAGCCCACCCGGGCTGTGCCTGG + Intergenic
989630493 5:43477298-43477320 CACCGCCCCCGGCCTGTGTCTGG - Intronic
991676596 5:69094423-69094445 CGCCGACCCCGGGACGTCCCGGG - Intronic
991691635 5:69231086-69231108 CACCACACCCGGCCTGGCCCTGG - Intergenic
992269772 5:75052989-75053011 CGCCGGCGCCGGGCTTTCCCGGG - Intergenic
993716476 5:91280016-91280038 CACCGCGCCCGGCCTGTCTCAGG + Intergenic
996269630 5:121587655-121587677 CACCGCGCCCGGCCTGTCACAGG - Intergenic
996862739 5:128083990-128084012 CCCCGACCCCGGCCAGTCCCGGG - Exonic
997302090 5:132813656-132813678 CACCGCCGCCTGGCTCACCCCGG - Exonic
997694153 5:135848304-135848326 CACTCTCCCAGGGCTGTCCCTGG - Intronic
998018728 5:138753070-138753092 CTCCGCCCGCGGGCTGTTCCAGG + Intronic
999767971 5:154755409-154755431 CCCCGCCCCCGGGGCGGCCCGGG - Intronic
999770284 5:154770461-154770483 TACCTCTCCCGGCCTGTCCCTGG + Intronic
1001166781 5:169375713-169375735 CACCGCACCCGGCCAGCCCCAGG - Intergenic
1001251995 5:170153586-170153608 CACTGCTCCAGGGCTGTGCCTGG + Intergenic
1002382918 5:178843087-178843109 CACCGCGCCCAGCCTATCCCAGG - Intergenic
1002660847 5:180790379-180790401 CCCATCCCCTGGGCTGTCCCTGG + Intergenic
1002720209 5:181254661-181254683 CACCGCGCCCGGCCTGTATCAGG + Intronic
1002763294 6:218231-218253 GTCTGCCCCCTGGCTGTCCCCGG - Intergenic
1004708238 6:18144665-18144687 CACCACACCCGGGCTTTTCCTGG + Intronic
1006044603 6:31283929-31283951 CACCGCACCCGGCCTCTCCTTGG + Intronic
1006904399 6:37523256-37523278 CACCACCCCCGGCCTCTGCCCGG - Intergenic
1007596466 6:43053889-43053911 CTCCGCCCCGGCGCTCTCCCAGG - Exonic
1007701781 6:43770120-43770142 CCCCGCCCCCGGCCCGCCCCGGG - Intergenic
1007719151 6:43875199-43875221 CACCTCCCCCAGGCTGGCCACGG - Intergenic
1008348163 6:50455109-50455131 CACCGCCACCCTGCTGGCCCAGG + Intergenic
1010973593 6:82288930-82288952 CCCCACCCCCTGACTGTCCCTGG - Intergenic
1012801441 6:103834093-103834115 CCCCACCCCCTGGCAGTCCCTGG - Intergenic
1012939588 6:105402894-105402916 CGCTGCCCCCTGCCTGTCCCCGG - Exonic
1013217885 6:108046631-108046653 CACCGCGCCCGGCCTGTCTCTGG + Intronic
1018852246 6:167649143-167649165 CACCGTGCCCGGCCTATCCCGGG - Intergenic
1019716839 7:2543082-2543104 CACGGCCGCCTGACTGTCCCTGG + Intronic
1021998396 7:26201802-26201824 CACCGCCTCCGAGCTGCTCCGGG - Intronic
1022810010 7:33859547-33859569 CACCGCGCCCGGCCTGAGCCTGG + Intergenic
1023810403 7:43906745-43906767 CACCCCGCCCCAGCTGTCCCCGG - Exonic
1024920276 7:54546713-54546735 CGCCGTCCCCGCGCTTTCCCCGG - Intronic
1024920293 7:54546766-54546788 CACCGCCCCCACGCTGTCCCTGG - Intronic
1025063902 7:55836448-55836470 CACTGCGCCCGGTCTGTCCATGG - Intronic
1026839041 7:73658604-73658626 CACCGCCCCCGGCCAGTGACTGG - Intergenic
1027052751 7:75030084-75030106 CTCGGCCACCAGGCTGTCCCTGG - Intronic
1027540574 7:79458951-79458973 CACAGACCCAGTGCTGTCCCTGG - Intergenic
1029270533 7:99374644-99374666 CCCCGCCCCCGGGCCCTACCGGG + Intronic
1030215725 7:107042568-107042590 CACCGGCCCCGGGCAGTCAGGGG - Intergenic
1030676769 7:112392778-112392800 CACCGCGCGCGGCCTGTGCCAGG - Intergenic
1034293225 7:149948622-149948644 CACCGTCCCCGGGCAGTTGCTGG + Intergenic
1034433354 7:151051691-151051713 CACCGTGCCCGGCCTCTCCCAGG + Intronic
1034552189 7:151828136-151828158 CCCCGACCCCAGGCTGGCCCTGG + Intronic
1034690328 7:153008543-153008565 CACGGAGCCGGGGCTGTCCCGGG + Intergenic
1034812848 7:154148257-154148279 CACCGTCCCCGGGCGGTTGCTGG - Intronic
1034869951 7:154675194-154675216 CCCCGCCCCCGGACAGGCCCCGG - Intronic
1034980527 7:155473126-155473148 CACCCACCCCTGACTGTCCCTGG + Intergenic
1035167334 7:156999773-156999795 CGCGGCCCCCGGCCTGACCCCGG + Intronic
1035656374 8:1309804-1309826 CACGGCGCCCGGCCTGTCACAGG - Intergenic
1038241079 8:25808477-25808499 CACCGCCCCCGCCCTGACACAGG - Intergenic
1039144960 8:34437518-34437540 CATGGCTCCTGGGCTGTCCCAGG - Intergenic
1039499310 8:38004116-38004138 CACCGCGCCTGGGCTGTGTCAGG - Intergenic
1039977958 8:42383263-42383285 CATCCCCCCTGTGCTGTCCCTGG - Intergenic
1040338604 8:46428626-46428648 GACGCCCCCAGGGCTGTCCCGGG + Intergenic
1043459517 8:80445610-80445632 CACCGCGCCCGGCCTGTTCAGGG - Intergenic
1044698691 8:94948523-94948545 CACCGGCCCCCGCCTGTCCGCGG - Intronic
1045305383 8:100952616-100952638 AACTGCCCCAGGGCCGTCCCCGG + Intronic
1048890690 8:138943787-138943809 CACCGCGCCCGGCCAGTCTCAGG + Intergenic
1049005625 8:139853709-139853731 CACTGCCCCCAGCCTGCCCCTGG - Intronic
1049162171 8:141104677-141104699 CACCTCCCCTGGGCTGGTCCTGG + Intergenic
1049373048 8:142276804-142276826 CACAGACCCAGGGCGGTCCCAGG + Intronic
1049407178 8:142456978-142457000 GACCGGCCCCGGGGTGTGCCTGG + Intronic
1049537356 8:143188577-143188599 CACAGCACCCGTGCTGCCCCCGG - Intergenic
1050348787 9:4719775-4719797 CACTGCGCCCGGCCAGTCCCTGG - Intronic
1053238107 9:36474023-36474045 CACCGCGCCCGGTCTGTGCTAGG - Intronic
1053513111 9:38706338-38706360 CACCGCTCCCGGACACTCCCTGG + Intergenic
1056773748 9:89497538-89497560 CACCGCCCCCTCCCTGGCCCGGG + Intronic
1057182040 9:93035531-93035553 CAGGGCCCCCGGGCTGTCCTGGG - Exonic
1057497779 9:95574368-95574390 CACCACCCTCAGGCTGTCCTCGG + Intergenic
1057497837 9:95574608-95574630 CACCACCCTCAGGCTGTCCTCGG + Intergenic
1057752412 9:97803494-97803516 CCCCGCCCCCGCGCTGGGCCGGG - Intergenic
1058014114 9:100010611-100010633 CACCGTGCCCAGCCTGTCCCTGG - Intronic
1059633944 9:116154357-116154379 CGCCGCCGCCGGGCGGTGCCTGG + Exonic
1060400168 9:123344051-123344073 CACTGGCCACAGGCTGTCCCTGG + Intergenic
1060589677 9:124808865-124808887 CACCACGCCCGGCCTGTTCCAGG - Intronic
1060793717 9:126501540-126501562 CACAGTCCCCAGGCTGACCCGGG - Intronic
1061700637 9:132412321-132412343 GGCTGCCCCCTGGCTGTCCCTGG - Intronic
1062023115 9:134328437-134328459 CACTGCCCCAGGGATCTCCCTGG + Intronic
1062028265 9:134350468-134350490 GACCGCCCACGGGCAGCCCCTGG - Intronic
1062476097 9:136728257-136728279 CAGCGCCCCCCAGCGGTCCCCGG + Intergenic
1062520523 9:136955853-136955875 CTCAGACCCCGAGCTGTCCCAGG + Intronic
1203785629 EBV:126006-126028 CAGGTCCCCCGGTCTGTCCCCGG - Intergenic
1203792151 EBV:157514-157536 CACGGCCCCCGGGAAGTCCCTGG - Intergenic
1203363826 Un_KI270442v1:240431-240453 CACTGTCTCCTGGCTGTCCCTGG - Intergenic
1185477561 X:424544-424566 CACCGCACCCGGCCCCTCCCAGG - Intergenic
1186607986 X:11111434-11111456 GCCCTCCCCCGGGCTGTTCCGGG - Exonic
1188020304 X:25149800-25149822 CACCGCGCCCGGCCTGTTCTTGG + Intergenic
1189411072 X:40771993-40772015 CACCACGCCCGGCCGGTCCCTGG - Intergenic
1189695343 X:43656241-43656263 CTCCGCCCCCGGGCTCCCCGGGG + Exonic
1190265721 X:48826461-48826483 AACCGCCGCCGGGGTGCCCCGGG + Intergenic
1195129482 X:101839407-101839429 CACTGCTCCCTGGCTGGCCCCGG + Intronic
1195176756 X:102320422-102320444 CACTGCTCCCTGGCTGGCCCTGG - Intronic
1195182108 X:102366671-102366693 CACTGCTCCCTGGCTGGCCCTGG + Intronic
1195324028 X:103743591-103743613 CACCGCGCCCGGCCTCACCCAGG + Intergenic
1196079496 X:111616211-111616233 CACCGCGCCCGGCCTGTGCCCGG + Intergenic
1196868638 X:120091803-120091825 CACCGCGCCCGGCCTGTGCAAGG + Intergenic
1198482317 X:137052427-137052449 CACCGCCCGCGGGCCACCCCTGG - Intergenic
1198846906 X:140922434-140922456 CACCGCACCCGGCTTCTCCCAGG - Intergenic
1199736861 X:150693529-150693551 CGCCGCCGCCGGCCTGTCCATGG - Exonic