ID: 1139851008

View in Genome Browser
Species Human (GRCh38)
Location 16:69951631-69951653
Sequence ATCCACCCCTCACCGCCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 3, 1: 0, 2: 1, 3: 34, 4: 282}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139851008_1139851021 16 Left 1139851008 16:69951631-69951653 CCCGGGGGCGGTGAGGGGTGGAT 0: 3
1: 0
2: 1
3: 34
4: 282
Right 1139851021 16:69951670-69951692 AGGAGGAGGAAGGAGGACCAGGG 0: 3
1: 1
2: 37
3: 317
4: 1725
1139851008_1139851024 22 Left 1139851008 16:69951631-69951653 CCCGGGGGCGGTGAGGGGTGGAT 0: 3
1: 0
2: 1
3: 34
4: 282
Right 1139851024 16:69951676-69951698 AGGAAGGAGGACCAGGGCTGGGG 0: 3
1: 0
2: 8
3: 113
4: 766
1139851008_1139851015 -4 Left 1139851008 16:69951631-69951653 CCCGGGGGCGGTGAGGGGTGGAT 0: 3
1: 0
2: 1
3: 34
4: 282
Right 1139851015 16:69951650-69951672 GGATGCTGGACTGGGGAGGAAGG 0: 3
1: 0
2: 2
3: 72
4: 686
1139851008_1139851016 -1 Left 1139851008 16:69951631-69951653 CCCGGGGGCGGTGAGGGGTGGAT 0: 3
1: 0
2: 1
3: 34
4: 282
Right 1139851016 16:69951653-69951675 TGCTGGACTGGGGAGGAAGGAGG 0: 3
1: 0
2: 6
3: 77
4: 693
1139851008_1139851025 28 Left 1139851008 16:69951631-69951653 CCCGGGGGCGGTGAGGGGTGGAT 0: 3
1: 0
2: 1
3: 34
4: 282
Right 1139851025 16:69951682-69951704 GAGGACCAGGGCTGGGGTCAAGG 0: 3
1: 0
2: 3
3: 167
4: 784
1139851008_1139851018 6 Left 1139851008 16:69951631-69951653 CCCGGGGGCGGTGAGGGGTGGAT 0: 3
1: 0
2: 1
3: 34
4: 282
Right 1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG 0: 3
1: 0
2: 45
3: 416
4: 2798
1139851008_1139851017 2 Left 1139851008 16:69951631-69951653 CCCGGGGGCGGTGAGGGGTGGAT 0: 3
1: 0
2: 1
3: 34
4: 282
Right 1139851017 16:69951656-69951678 TGGACTGGGGAGGAAGGAGGAGG 0: 3
1: 1
2: 10
3: 160
4: 1582
1139851008_1139851022 20 Left 1139851008 16:69951631-69951653 CCCGGGGGCGGTGAGGGGTGGAT 0: 3
1: 0
2: 1
3: 34
4: 282
Right 1139851022 16:69951674-69951696 GGAGGAAGGAGGACCAGGGCTGG 0: 3
1: 1
2: 15
3: 146
4: 1118
1139851008_1139851014 -8 Left 1139851008 16:69951631-69951653 CCCGGGGGCGGTGAGGGGTGGAT 0: 3
1: 0
2: 1
3: 34
4: 282
Right 1139851014 16:69951646-69951668 GGGTGGATGCTGGACTGGGGAGG 0: 3
1: 0
2: 2
3: 51
4: 522
1139851008_1139851019 9 Left 1139851008 16:69951631-69951653 CCCGGGGGCGGTGAGGGGTGGAT 0: 3
1: 0
2: 1
3: 34
4: 282
Right 1139851019 16:69951663-69951685 GGGAGGAAGGAGGAGGAAGGAGG 0: 5
1: 45
2: 235
3: 1373
4: 5879
1139851008_1139851020 15 Left 1139851008 16:69951631-69951653 CCCGGGGGCGGTGAGGGGTGGAT 0: 3
1: 0
2: 1
3: 34
4: 282
Right 1139851020 16:69951669-69951691 AAGGAGGAGGAAGGAGGACCAGG 0: 4
1: 0
2: 29
3: 282
4: 1936
1139851008_1139851023 21 Left 1139851008 16:69951631-69951653 CCCGGGGGCGGTGAGGGGTGGAT 0: 3
1: 0
2: 1
3: 34
4: 282
Right 1139851023 16:69951675-69951697 GAGGAAGGAGGACCAGGGCTGGG 0: 3
1: 1
2: 10
3: 96
4: 833

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139851008 Original CRISPR ATCCACCCCTCACCGCCCCC GGG (reversed) Intronic
900147478 1:1164738-1164760 ATCCAACCCTCCCCGACCGCGGG - Intergenic
900339496 1:2181279-2181301 CTCCAGCCCTCACCTCCCCCAGG + Intronic
901191125 1:7410353-7410375 TCCCACCCCTCACCGTCACCTGG + Intronic
901932138 1:12602596-12602618 ATCCACCGCCCCCCACCCCCAGG + Intronic
904941117 1:34165314-34165336 ATTCACCCCCTCCCGCCCCCCGG - Intronic
905633447 1:39531968-39531990 ATCCACCCCTACCTGCCCCCTGG + Intergenic
905874317 1:41422506-41422528 CTCCACACCTCCACGCCCCCAGG - Intergenic
906119874 1:43382298-43382320 ACCCCCCTCTCACCTCCCCCAGG - Intergenic
906141020 1:43533481-43533503 GTCCCCTCCTCCCCGCCCCCAGG - Intronic
906545522 1:46616886-46616908 CTCCGCCCCTCCCCGCCCCGTGG - Intronic
907273604 1:53304854-53304876 AGCAAACCCTCACCGCCCACTGG + Intronic
915382677 1:155456874-155456896 ATCCACCCCCCACCGCCAAAAGG + Intronic
915942039 1:160124361-160124383 CTCCACCCTTCACCTCCACCAGG - Exonic
915980064 1:160415020-160415042 TTCCACCCCTCACCCTCACCTGG + Intronic
916208924 1:162342738-162342760 ATCCACCTCCCACCCACCCCAGG - Intronic
916472472 1:165137623-165137645 AACCACCCCTCACCATTCCCTGG - Intergenic
918910113 1:190556443-190556465 ATCAACCCCTCACCTACCTCAGG - Intergenic
919742344 1:200988655-200988677 AACCACCCCTAACCCCCACCAGG - Intronic
920600592 1:207320855-207320877 TCCCACCCCACACCGCCCCGAGG + Intergenic
920641523 1:207756086-207756108 ATCCACCCATCATCTCCTCCAGG - Intronic
921966283 1:221094040-221094062 ATCCAGCCCTGATCACCCCCGGG + Intergenic
922196731 1:223365041-223365063 ACCCCCGCCTCCCCGCCCCCGGG - Intergenic
922336668 1:224623836-224623858 GTCCACCCGTCCCCACCCCCTGG + Intronic
922534185 1:226367810-226367832 TTCCACCTCTCAACTCCCCCAGG - Intronic
924362295 1:243254785-243254807 ATCCCCCACCCGCCGCCCCCCGG - Intronic
1062956416 10:1543105-1543127 AGCCACCCCACACCGCCCCAGGG - Intronic
1065327224 10:24559900-24559922 TTGCACCCCCCACCACCCCCAGG + Intergenic
1065732617 10:28722989-28723011 CGCCACCCCCCACCTCCCCCAGG - Intergenic
1065800195 10:29344808-29344830 ATGCACCCCCCACCTCCCCCAGG - Intergenic
1067541843 10:47160569-47160591 ATCCTGTCCTCACCTCCCCCAGG - Intergenic
1067697944 10:48548942-48548964 TTCCACCGCTCACCGGCCCTCGG + Intronic
1067710595 10:48648542-48648564 ATCCACCCCTCAACTCACCCAGG + Intronic
1069761770 10:70816148-70816170 TCCCGACCCTCACCGCCCCCCGG - Intronic
1070128313 10:73639513-73639535 ATGCACCCCTGCCCACCCCCAGG + Intronic
1072141591 10:92593316-92593338 CTCCGCCCCTCACAGCGCCCAGG + Exonic
1073214525 10:101829270-101829292 TTCACCCCCTCCCCGCCCCCCGG + Intronic
1073243031 10:102070566-102070588 ATCCTCCCCTCACCTTCCCAGGG - Intergenic
1073248568 10:102108032-102108054 CCCCACCCCTCACAGCCCCAGGG - Exonic
1075031914 10:119029660-119029682 GCCCACTCCTCCCCGCCCCCCGG - Intergenic
1075088641 10:119430564-119430586 CTCCCACCCTCACTGCCCCCGGG - Intronic
1075263498 10:120981926-120981948 ATCCACCAACCCCCGCCCCCAGG + Intergenic
1076059774 10:127404569-127404591 GTCAACCCCTCTCTGCCCCCCGG - Intronic
1076351837 10:129821164-129821186 ATCCTCCCCTCCCCAGCCCCTGG + Intergenic
1076749479 10:132535484-132535506 ATGCACCCCTCACCCACCACAGG - Intergenic
1076777206 10:132704504-132704526 AGCCACCCCTCGCAGCCCGCCGG + Intronic
1077010290 11:376551-376573 GCCGACCCCTCCCCGCCCCCGGG + Exonic
1077140387 11:1021757-1021779 TTCCAGTCCTCACCTCCCCCTGG + Intronic
1077343798 11:2037354-2037376 CTCCCGCCCCCACCGCCCCCAGG - Intergenic
1077516455 11:3004704-3004726 CTGCACCCCACAACGCCCCCAGG - Intronic
1077600679 11:3572464-3572486 AACCACCCCCCAATGCCCCCTGG + Intergenic
1079037792 11:17036069-17036091 TGCCACCCCTCCCCGACCCCTGG + Intergenic
1079087092 11:17454321-17454343 AGCCAGCCCTCACTGCTCCCTGG + Intronic
1079133882 11:17765112-17765134 ATCCAACCCTCACTGCACCCAGG + Intronic
1080766788 11:35304523-35304545 TTCCACCTCTCACCTCCCACTGG + Intronic
1082936452 11:58661722-58661744 ATCAACCCCTCTCCCACCCCCGG + Intronic
1083051374 11:59779762-59779784 ACCCACCCCTCACCCCAGCCAGG - Intronic
1083235195 11:61346579-61346601 TTCCAACCCTCACCTTCCCCCGG + Exonic
1083616509 11:64029045-64029067 ATCCCCACCTCCCCGCCCCAGGG + Intronic
1084005264 11:66319308-66319330 CCCCACCCCACACCGCCCCCTGG + Intergenic
1084204535 11:67584045-67584067 TGCCCCCCCTCCCCGCCCCCGGG - Intronic
1084256593 11:67947063-67947085 AACCACCCCCCAATGCCCCCTGG + Intergenic
1084889380 11:72229150-72229172 CTCCACCCCTCACAGCTTCCAGG - Exonic
1086581464 11:88404448-88404470 ATACACCCCTCGCCACCCTCAGG - Intergenic
1088827518 11:113508122-113508144 GTCCACCCCCCACCCCACCCAGG - Intergenic
1088892949 11:114059214-114059236 GTCCCCCCCTCCCCGCACCCCGG - Intergenic
1089500005 11:118926101-118926123 AAACCCCCCTCCCCGCCCCCGGG - Intronic
1089938902 11:122394948-122394970 ATTCAGGCCTCACCACCCCCTGG + Intergenic
1090213311 11:124938332-124938354 ATGAACCTCTCACCGCCCCCAGG - Intergenic
1090412835 11:126520796-126520818 CTCCACCCCTCATTGCTCCCTGG - Intronic
1090704832 11:129326701-129326723 AACCATCCCCCACCACCCCCTGG - Intergenic
1090845758 11:130528456-130528478 ACCCACCCCTCCCTGCCCCCAGG - Intergenic
1090941118 11:131389230-131389252 AGCCACCCCTTACCTGCCCCAGG + Intronic
1202826784 11_KI270721v1_random:92543-92565 CTCCCGCCCCCACCGCCCCCAGG - Intergenic
1091450319 12:568876-568898 ACCCCCCCCCCCCCGCCCCCCGG + Intronic
1092426808 12:8381763-8381785 AACCACCCCCCAATGCCCCCTGG + Intergenic
1095097401 12:38155836-38155858 GACCACCCCCCCCCGCCCCCGGG - Intergenic
1096514436 12:52148310-52148332 ATCCAGGCCTCACTGCCCCCAGG + Intergenic
1097193229 12:57230209-57230231 TTCCAGCCCTCACTGCCGCCGGG - Intronic
1098898804 12:76091727-76091749 ATACACCCCTCCACTCCCCCCGG - Intergenic
1099207337 12:79743723-79743745 CTCCACCTCTCACCTCCCTCAGG + Intergenic
1100980694 12:100160038-100160060 ACCCACCACCCCCCGCCCCCAGG + Intergenic
1101115268 12:101525384-101525406 ATCCTCCCCTCATTGCCCTCAGG - Intergenic
1101259860 12:103018110-103018132 ATCCTCCTCTCACAGCCCTCAGG - Intergenic
1102212734 12:111138861-111138883 ATTCACCCCACACAGCTCCCAGG + Intronic
1102719796 12:115006182-115006204 ATCCAACCGTCACTGCCTCCAGG - Intergenic
1103720094 12:122969170-122969192 TTCCACCCCCCCCCCCCCCCCGG + Intronic
1103894146 12:124262075-124262097 ACACACCCCTCACCGGGCCCGGG + Intronic
1104029118 12:125051548-125051570 TTCCTCCCCTCTCCACCCCCAGG - Intergenic
1105410386 13:20166991-20167013 ATCCACTCCTCACCACCCCTAGG + Intergenic
1106476334 13:30101645-30101667 CTCCACCCCCCACCACCTCCGGG + Intergenic
1108355445 13:49625450-49625472 ATCCACCCCTGACTGCCAGCCGG + Intergenic
1109381079 13:61559753-61559775 TTCCTCCCCTCCCCACCCCCCGG - Intergenic
1109538743 13:63745530-63745552 GCCAACCCCTCTCCGCCCCCCGG - Intergenic
1112718293 13:102212422-102212444 CTCCACCCTTCACCTCCCACAGG + Intronic
1113032531 13:106010189-106010211 ATTCACCCTCCACCGACCCCAGG + Intergenic
1114010655 14:18363670-18363692 AGCCACCCCCCACCCCCACCCGG + Intergenic
1114062925 14:19037206-19037228 ATCCACGCCCCAGCGCGCCCTGG - Intergenic
1114099335 14:19362791-19362813 ATCCACGCCCCAGCGCGCCCTGG + Intergenic
1119424575 14:74527416-74527438 CTTCTCCCCTCACCGCCACCTGG + Intronic
1122082127 14:99273570-99273592 ACCCACCCCACTCCGCCCCCAGG + Intergenic
1122084110 14:99287625-99287647 CTACACACCACACCGCCCCCCGG + Intergenic
1122084256 14:99288988-99289010 AGCCACCCCTCATGGCCTCCAGG + Intergenic
1122242035 14:100375613-100375635 AGCCACCCCTCACCCCCCGCTGG + Intronic
1122295539 14:100703681-100703703 ATCAACCCCTCCCCGACACCTGG - Intergenic
1122419105 14:101564198-101564220 ATCCACCATTCACCTCTCCCTGG - Intergenic
1122643691 14:103177515-103177537 TTCCACCCCTCCCTGCACCCAGG + Intergenic
1123047755 14:105526930-105526952 AACCACCCCTCGGAGCCCCCGGG - Intronic
1124217149 15:27816874-27816896 CACCACCCCTCACTGCCCTCCGG + Intronic
1127867614 15:63044373-63044395 ATCCACCCACCTCCACCCCCAGG - Intronic
1128389441 15:67173249-67173271 CTGCCCCCCTCCCCGCCCCCAGG - Intronic
1129440631 15:75578775-75578797 ATCCCCCCGCCACCGCCGCCGGG + Exonic
1130546257 15:84859102-84859124 ACCTACCACTCACAGCCCCCCGG - Intronic
1130990495 15:88873037-88873059 ATCCTCCCCTGACCCCTCCCAGG - Intronic
1202958462 15_KI270727v1_random:97299-97321 ATCCATGCCCCACCGCGCCCTGG + Intergenic
1132994731 16:2817184-2817206 TCCCACCCCGCCCCGCCCCCAGG + Intronic
1133654749 16:7850065-7850087 AGCCACCCCTGACAGCCACCTGG + Intergenic
1136395822 16:29991863-29991885 ACCCACCCTTCCCCTCCCCCAGG - Intronic
1139580956 16:67873334-67873356 AACCCCCGCTCACCGCCCGCGGG - Exonic
1139614181 16:68079138-68079160 ATCCACCCCTGGGCGGCCCCTGG - Exonic
1139851008 16:69951631-69951653 ATCCACCCCTCACCGCCCCCGGG - Intronic
1139879990 16:70174543-70174565 ATCCACCCCTCACCGCCCCCGGG - Intronic
1140372524 16:74420984-74421006 ATCCACCCCTCACCGCCCCCGGG + Intronic
1140389735 16:74575005-74575027 ATCCGCCCCCCCCCCCCCCCCGG - Intronic
1141647309 16:85374680-85374702 ATCCACCCCCTACCCCCTCCAGG - Intergenic
1142315955 16:89345244-89345266 AGCCCCCCCTCCCCACCCCCCGG + Intronic
1142378092 16:89717114-89717136 TTCCACCCCCCACTGACCCCGGG + Intronic
1142393267 16:89816399-89816421 GCCCACCCCGCACAGCCCCCCGG + Intronic
1142408198 16:89902776-89902798 CCTCACCCCTCACCGCCCCTCGG - Intronic
1142709195 17:1714516-1714538 GTCCGCCCCTCACAGCCCCGGGG - Intergenic
1142961387 17:3554433-3554455 AGCCATCCCTCACCTCCCTCAGG + Intronic
1143172486 17:4938253-4938275 ACCCCCGCCTCACCTCCCCCAGG - Exonic
1143203327 17:5127020-5127042 ACCCACCCCTCCCCCCACCCTGG - Intronic
1144304489 17:13955667-13955689 ATCCTTCCCTCACAGCCCTCAGG + Intergenic
1144874494 17:18390345-18390367 ACCCACCCCTCCCCCCACCCTGG - Intergenic
1145272773 17:21413508-21413530 GCCCACCCCTCCCCGCCCACAGG - Intronic
1145310981 17:21700971-21700993 GCCCACCCCTCCCCGCCCACAGG - Intronic
1145809298 17:27755135-27755157 ATCAACCCTTCACCCCCTCCTGG + Intergenic
1146489090 17:33267222-33267244 ATGCACCCCTTACCCCCCCCAGG + Intronic
1146966665 17:37037157-37037179 CACCACCCCTCCCCACCCCCTGG + Intronic
1147364953 17:39953248-39953270 GTCCACCCAGCCCCGCCCCCCGG - Intergenic
1150280968 17:63929475-63929497 CTCCATCCCTCTCCGCCCCCAGG - Exonic
1151581209 17:74979995-74980017 ATCCAACCCCCACCCCCCTCGGG - Intergenic
1151978033 17:77493271-77493293 CTCCACCCCAGACCTCCCCCCGG + Intronic
1151984021 17:77530337-77530359 AACCACCCCCCACCCCACCCGGG - Intergenic
1152235540 17:79136474-79136496 AAGCACCCCCCACCGGCCCCAGG + Intronic
1152242575 17:79168019-79168041 ACCCACCCCTCACCCAGCCCTGG - Intronic
1152643335 17:81458050-81458072 AGCAACCCCTGCCCGCCCCCGGG - Intronic
1152809860 17:82376289-82376311 ACTCACCCCTCACTGCCTCCTGG + Intergenic
1153451746 18:5238024-5238046 GTCCGCCCCTCGCCGCCACCGGG + Intergenic
1154451153 18:14475442-14475464 ATCCACGCCCCAGCGCGCCCTGG + Intergenic
1155136152 18:22994830-22994852 ATCCTCCCATCTCAGCCCCCTGG + Intronic
1158387213 18:57008476-57008498 CTCCACCTCTCCTCGCCCCCTGG + Intronic
1160838852 19:1137280-1137302 AGCCTCCCCCCACCGCACCCCGG - Intronic
1160838865 19:1137307-1137329 AGCCTCCCCCCACCGCACCCCGG - Intronic
1160838878 19:1137334-1137356 AGCCTCCCCCCACCGCACCCCGG - Intronic
1160838901 19:1137388-1137410 AGCCTCCCCTCACCGCACCCCGG - Intronic
1161179179 19:2867817-2867839 GTCCACCCCTCGCCCCTCCCAGG - Intronic
1162504212 19:11073296-11073318 AGCCACCACTCACCACCCCCGGG - Intergenic
1163529872 19:17842866-17842888 ACCCAGCCCTCTCCACCCCCAGG - Intronic
1164577281 19:29412990-29413012 CTCCACCCCTCCCTGCCTCCAGG + Intergenic
1167322278 19:48804655-48804677 ATCCTCCCCCTTCCGCCCCCTGG + Intronic
1167889466 19:52528047-52528069 AGCCACCCCTCGTCGGCCCCTGG + Intronic
925758140 2:7154878-7154900 AATCACCCCACACCGCCACCTGG - Intergenic
925876710 2:8317411-8317433 ATGCACCCCACACAGCACCCCGG - Intergenic
926096571 2:10084976-10084998 ACCCACCACCCCCCGCCCCCCGG - Intronic
927424864 2:22970744-22970766 CACCACCCCTCCCCGACCCCGGG + Intergenic
927496648 2:23555715-23555737 ATACACCCTTCACCGTCTCCTGG + Intronic
928239816 2:29576639-29576661 ACCCACCACTCACCTCCTCCTGG - Intronic
930358070 2:50346220-50346242 ATCTCTCCCTCCCCGCCCCCCGG + Intronic
931763575 2:65436103-65436125 ATCACCCCCTCCCCGCCCCTGGG - Intergenic
932126655 2:69150915-69150937 ATCCACCCATCTCAGCCTCCTGG - Intronic
932168472 2:69531129-69531151 ATCCACTCCTCACCCCAGCCAGG - Intronic
932436549 2:71705320-71705342 ATCCTCACCTCACCCCCGCCAGG - Intergenic
932608024 2:73177277-73177299 ACCCATCCTTTACCGCCCCCGGG + Intergenic
933772949 2:85755271-85755293 CTCCACTCCGCACCGCGCCCAGG - Intronic
934657886 2:96125507-96125529 ATCCACCCCTCTCCTCCAGCAGG + Intronic
936074439 2:109392798-109392820 AGCCACCACGCACGGCCCCCTGG + Intronic
936489341 2:112957043-112957065 ATCCACTCCTCTCCACCTCCAGG + Intergenic
937955562 2:127420112-127420134 ATCTGCCCCTCACCTCACCCAGG - Intronic
938074225 2:128323200-128323222 ATCCACCCCACCCCACCCCCAGG - Intergenic
938480288 2:131657366-131657388 ATCCACGCCCCAGCGCGCCCTGG - Intergenic
940553709 2:155194904-155194926 AACCTCCCCTCCCCGCCGCCAGG - Intergenic
941805478 2:169707883-169707905 ATCCCCCCCTCCCCGCACCTTGG + Intronic
942009230 2:171742277-171742299 ATCCACCCATCTCAGCCCCCAGG + Intronic
942570418 2:177308556-177308578 ACCCACCCCTCACTCCCCCATGG - Intronic
943034580 2:182726316-182726338 AACAACTCCTCACCGCCCCATGG - Intronic
945305318 2:208254438-208254460 CTCCGCCCCTCCACGCCCCCTGG + Intronic
946191597 2:218010535-218010557 ATCCGCCCCGCAGCGCGCCCGGG - Intergenic
946309115 2:218872979-218873001 TCCTACCCCTCACGGCCCCCAGG - Intronic
947798515 2:232910230-232910252 ATCCACCCCCCTCCCACCCCTGG - Intronic
948794632 2:240396038-240396060 AGCCACCCCTGCCCGCCCCCGGG + Intergenic
948938660 2:241185001-241185023 GTCCACCCCTCCCCGACCCCCGG - Intergenic
1168896187 20:1325377-1325399 AGTCACCCCTAACCGCGCCCGGG - Intronic
1169823635 20:9742088-9742110 ATCCAACCCTCACCACCCAAGGG + Intronic
1172125861 20:32624853-32624875 ACCCACCCCTTACCACCCCCTGG + Intergenic
1172293745 20:33793443-33793465 ATCCACCCATCAAAGCACCCCGG - Intergenic
1172848764 20:37945383-37945405 CTCCACCCCACACACCCCCCAGG - Intergenic
1172967133 20:38844967-38844989 ACCCACCCCACCCCACCCCCTGG + Intronic
1173732495 20:45338489-45338511 TCCCACCCCTCACTGCCCCCAGG + Intronic
1174414776 20:50359401-50359423 ATCCAGACGTCACCTCCCCCAGG - Intergenic
1174445095 20:50585566-50585588 AACCATCCCTCACCACCCCCAGG - Intergenic
1175926515 20:62474161-62474183 AGCCCCGCCTCACAGCCCCCTGG + Intronic
1175960612 20:62634595-62634617 ACCCACCCCTCACAACCCCGTGG - Intergenic
1176445080 21:6815131-6815153 ATCCACGCCCCAGCGCGCCCTGG - Intergenic
1176823247 21:13680164-13680186 ATCCACGCCCCAGCGCGCCCTGG - Intergenic
1179427588 21:41294246-41294268 AGCCAGGCCTCACCTCCCCCTGG + Intergenic
1180435148 22:15294473-15294495 AGCCACCCCCCACCCCCACCCGG + Intergenic
1180789511 22:18567159-18567181 CTCCACCCCACACCCTCCCCTGG - Intergenic
1180944018 22:19679770-19679792 CTGCAGCCCACACCGCCCCCTGG - Intergenic
1181232231 22:21428153-21428175 CTCCACCCCACACCCTCCCCTGG + Intronic
1181246420 22:21506704-21506726 CTCCACCCCACACCCTCCCCTGG - Intergenic
1182425320 22:30268466-30268488 ACCTCCCCCTCACCACCCCCAGG + Intergenic
1184936597 22:47728568-47728590 ATCCTCCCATCACCTCCCTCTGG + Intergenic
1185182714 22:49372512-49372534 ATCACCCCCACCCCGCCCCCAGG + Intergenic
1185340206 22:50287654-50287676 ACCCACCACGCACCTCCCCCTGG + Exonic
949745797 3:7290949-7290971 GTCCACCCCTCCCCACCCCCAGG + Intronic
950010762 3:9722156-9722178 ATCCACCCCCCCCCGCCACCCGG + Intronic
951139754 3:19147063-19147085 ATCCCCCTCTCCCCGCCCCCAGG - Intergenic
951197564 3:19841078-19841100 CTCCACCCCTCAACAGCCCCTGG + Intergenic
953747348 3:45585327-45585349 ATCCCTCCCTCACAACCCCCAGG - Intronic
954424940 3:50438312-50438334 CTCCACCTCTCCCCTCCCCCAGG + Intronic
955264124 3:57424698-57424720 CTCCACCCCCCACCTCCCCCAGG - Intronic
956171453 3:66436757-66436779 ATCCACTCCTCACGTTCCCCTGG - Intronic
957071494 3:75571079-75571101 AACCACCCCCCAATGCCCCCTGG + Intergenic
960582750 3:119294695-119294717 ATCCACCCCGCGCCGCTCCGGGG - Exonic
960619926 3:119627777-119627799 ATCCCCCACTCACCACCCTCAGG + Intronic
960741693 3:120841100-120841122 ATCCACCTCCCCCCGCCCCTTGG + Intergenic
961021387 3:123510152-123510174 ATCTTCCCCTCACCGCCCCCAGG + Intronic
961282633 3:125775662-125775684 AACCACCCCCCAATGCCCCCTGG - Intergenic
961366351 3:126402200-126402222 TCCCATCCCTCACCACCCCCAGG - Intronic
961451898 3:127005928-127005950 ATCCAGCCCCCTCAGCCCCCAGG - Intronic
961505819 3:127369969-127369991 ACCCACCCCTCATCCCCCACCGG - Intergenic
963730506 3:148966738-148966760 AGCCACCGCCCCCCGCCCCCTGG - Intergenic
966883077 3:184360772-184360794 ATCCAGCCCCCACCCACCCCAGG - Intronic
966910149 3:184555105-184555127 AACCACACCTGGCCGCCCCCTGG - Intronic
967122919 3:186399580-186399602 ATCCCACCCTCCCAGCCCCCAGG - Intergenic
968693446 4:2008554-2008576 CTCCAGTCCTCACCTCCCCCTGG - Intronic
968725044 4:2242826-2242848 ATCCCCCCCCCCCCCCCCCCCGG - Intergenic
968973860 4:3811028-3811050 ACTCACCCCTCACCGCCACGAGG + Intergenic
969015103 4:4098770-4098792 AACCACCCCCCAATGCCCCCTGG + Intergenic
969125735 4:4946475-4946497 ATCCTCCCCTCACAGCCCTCGGG + Intergenic
969240424 4:5893285-5893307 ACCCCCCACTCTCCGCCCCCAGG + Intergenic
970161353 4:13192653-13192675 ATCCTCCCATCACAGCCTCCTGG + Intergenic
970897231 4:21118023-21118045 ATCCTCCTCTCACCCACCCCAGG - Intronic
980865827 4:138552869-138552891 CCCCACCCCTCAACGGCCCCTGG - Intergenic
985334665 4:188878794-188878816 ATCTACTCCTCACTGCCACCAGG - Intergenic
985747384 5:1654967-1654989 CTCCACCCCCACCCGCCCCCTGG + Intergenic
985960842 5:3302295-3302317 GTCCACCCCTCACCACCTGCTGG + Intergenic
994294154 5:98068740-98068762 ATCCCCTGCTCACTGCCCCCTGG - Intergenic
996615893 5:125441019-125441041 ATTCACCCCTCCCCCCACCCCGG - Intergenic
999330280 5:150669206-150669228 ATCCGCCCCCCACCCCCCCTCGG - Intronic
999768512 5:154757281-154757303 CTGCACCCCTTACCTCCCCCCGG - Intronic
999918416 5:156289455-156289477 CTCCACCCCTCACCCCCCACAGG + Intronic
1004036111 6:11925834-11925856 ACCCACCCTTCACCTGCCCCTGG + Intergenic
1005209960 6:23449217-23449239 ATCCTTCCCTCACAGCCCTCAGG + Intergenic
1005851743 6:29828025-29828047 CTCAACCCCTCCTCGCCCCCAGG + Exonic
1006180508 6:32150906-32150928 CTCCTCCACTCACCTCCCCCAGG - Exonic
1006456816 6:34136763-34136785 ATCCACCCCTCAGTCCCACCAGG + Intronic
1006863786 6:37191970-37191992 ATCCCACCCTCACTGGCCCCAGG + Intergenic
1007345327 6:41224490-41224512 ATCTAACCCTCTCCTCCCCCAGG + Intergenic
1013346249 6:109263437-109263459 ATCCTCCCCTCACGGCCCTCAGG + Intergenic
1014010297 6:116467726-116467748 ATCCACCCACCACAGCCTCCAGG - Intergenic
1018848222 6:167570009-167570031 ATACACCCGTCACCTCCACCTGG + Intergenic
1018951599 6:168381890-168381912 ATCCACCACCCACCGCCGGCAGG + Intergenic
1019265936 7:117631-117653 ATCCCCCCGACACAGCCCCCCGG + Intergenic
1019265950 7:117663-117685 ATCCCCCCGACACAGCCCCCCGG + Intergenic
1019265964 7:117695-117717 ATCCCCCCGACACAGCCCCCCGG + Intergenic
1019265978 7:117727-117749 ATCCCCCCGACACAGCCCCCCGG + Intergenic
1019265992 7:117759-117781 ATCCCCCCGACACAGCCCCCCGG + Intergenic
1019277285 7:182419-182441 ATCCCCCCGACACAGCCCCCCGG + Intergenic
1019656786 7:2200197-2200219 AACCACCCCACACCCGCCCCGGG + Intronic
1019975364 7:4577008-4577030 ATCCACCCCCCCCCCCCCCTCGG + Intergenic
1020091768 7:5345859-5345881 GGCCACCCCCCACCGCCCCCTGG + Intronic
1020131127 7:5559142-5559164 AATCATCCCTCACCACCCCCAGG + Intronic
1020892535 7:13897145-13897167 ATCCACCCATCCCCCCACCCCGG - Intronic
1022418912 7:30202066-30202088 GTCTTCCCCTCCCCGCCCCCAGG + Intergenic
1024822588 7:53350441-53350463 GTGCACCTCCCACCGCCCCCTGG - Intergenic
1027188923 7:75986943-75986965 ACCCAGCCCTCCCCTCCCCCAGG + Exonic
1029073772 7:97920393-97920415 AACCACCCCCCAATGCCCCCCGG + Intergenic
1029109436 7:98204973-98204995 ATTCACCCCACCCCGCCCTCGGG - Intronic
1029145356 7:98441985-98442007 ATCCTCCCCTCTCCTCCTCCTGG - Intergenic
1029580900 7:101436107-101436129 CACCACCCCGCACCGCCCCCAGG + Intronic
1030022931 7:105293491-105293513 CTCCACCCCCCACCCCGCCCCGG + Intronic
1034424868 7:151009167-151009189 ATTTGCCCCTCCCCGCCCCCAGG + Exonic
1034547282 7:151797232-151797254 CCCCACCCCCCACCGCCGCCTGG + Intronic
1035388018 7:158487668-158487690 AGCCGCCCCCCACCGCACCCTGG + Intronic
1035828330 8:2668300-2668322 CTCCCCCCATCACCGCCCTCTGG - Intergenic
1036668765 8:10765959-10765981 GTTCATCCCTCACCGCACCCAGG + Intronic
1036890355 8:12592639-12592661 AACCACCCCCCAATGCCCCCTGG + Intergenic
1036897923 8:12650556-12650578 AACCACCCCCCAATGCCCCCTGG + Intergenic
1037718111 8:21416978-21417000 ATCCTTCCCTCACCACCCCTGGG - Intergenic
1045107759 8:98909508-98909530 ATCTACCCATCCCCTCCCCCAGG + Intronic
1049446737 8:142634759-142634781 ATCCACGCCTGCCCGGCCCCTGG + Intergenic
1049517471 8:143068925-143068947 ATGCTCCCCGCACCGCCCCAGGG + Intergenic
1050325260 9:4491544-4491566 ATCCACCCCTCACAGATCACTGG + Intronic
1050438050 9:5629637-5629659 ATCCACCCCGGACCGCCGGCTGG - Intronic
1053167146 9:35853024-35853046 ATCCACTCCTGACCTCTCCCTGG + Intronic
1055932639 9:81575272-81575294 ATCCTCCCATCTCAGCCCCCTGG - Intergenic
1056231051 9:84544880-84544902 ATCTACCCCTGTCCGCTCCCTGG + Intergenic
1057131578 9:92657819-92657841 CTCCACCCACCACCACCCCCCGG + Intronic
1057204314 9:93162058-93162080 ATCATCCCCTCACCAGCCCCTGG - Intergenic
1057729636 9:97597411-97597433 AGCCACCCCACCCGGCCCCCTGG - Intronic
1059913502 9:119073292-119073314 ATCCAGCCCTCTCCTCTCCCTGG + Intergenic
1060530163 9:124343225-124343247 TCCGTCCCCTCACCGCCCCCCGG - Intronic
1060555342 9:124504903-124504925 TTCCCCCCCGCACCGCCGCCGGG + Intronic
1061777255 9:132973620-132973642 ATCCAGCTCTCAACGCCTCCAGG - Intronic
1062040028 9:134400300-134400322 CTCCACCCCTCCCCAGCCCCAGG - Intronic
1062544530 9:137055542-137055564 TTCCACCCCTGACCGCCCAGAGG + Intergenic
1062627562 9:137450137-137450159 CTCCAGCCCTCCCCGCGCCCAGG + Intronic
1203524115 Un_GL000213v1:69394-69416 ATCCACGCCCCAGCGCGCCCTGG + Intergenic
1189309970 X:40012278-40012300 GTCGACCCCTGACGGCCCCCAGG + Intergenic
1191659329 X:63634157-63634179 ATCCTCCCACCACCACCCCCAGG - Intergenic
1192772503 X:74207419-74207441 GGCCACCCCTCCCCCCCCCCAGG - Intergenic
1193722715 X:85005390-85005412 ATTCACCCCCCCCCCCCCCCGGG + Intronic
1194426856 X:93749177-93749199 ATCTGCCCCACACCCCCCCCCGG - Intergenic
1195344136 X:103931852-103931874 TTCCACCCCTCTCCCCTCCCTGG - Intronic
1198215533 X:134550920-134550942 CCCCACCCCGCACCGCCCCCGGG - Intergenic
1199781812 X:151068336-151068358 AACCACCTCTCACTGCCTCCAGG - Intergenic
1200055099 X:153456107-153456129 ACCCACCTCTCACCTCCCCGCGG + Intronic
1200110385 X:153737892-153737914 ATCCCACCCCCACCACCCCCAGG - Intronic