ID: 1139851009

View in Genome Browser
Species Human (GRCh38)
Location 16:69951632-69951654
Sequence CATCCACCCCTCACCGCCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 3, 1: 0, 2: 1, 3: 28, 4: 337}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139851009_1139851023 20 Left 1139851009 16:69951632-69951654 CCGGGGGCGGTGAGGGGTGGATG 0: 3
1: 0
2: 1
3: 28
4: 337
Right 1139851023 16:69951675-69951697 GAGGAAGGAGGACCAGGGCTGGG 0: 3
1: 1
2: 10
3: 96
4: 833
1139851009_1139851024 21 Left 1139851009 16:69951632-69951654 CCGGGGGCGGTGAGGGGTGGATG 0: 3
1: 0
2: 1
3: 28
4: 337
Right 1139851024 16:69951676-69951698 AGGAAGGAGGACCAGGGCTGGGG 0: 3
1: 0
2: 8
3: 113
4: 766
1139851009_1139851020 14 Left 1139851009 16:69951632-69951654 CCGGGGGCGGTGAGGGGTGGATG 0: 3
1: 0
2: 1
3: 28
4: 337
Right 1139851020 16:69951669-69951691 AAGGAGGAGGAAGGAGGACCAGG 0: 4
1: 0
2: 29
3: 282
4: 1936
1139851009_1139851019 8 Left 1139851009 16:69951632-69951654 CCGGGGGCGGTGAGGGGTGGATG 0: 3
1: 0
2: 1
3: 28
4: 337
Right 1139851019 16:69951663-69951685 GGGAGGAAGGAGGAGGAAGGAGG 0: 5
1: 45
2: 235
3: 1373
4: 5879
1139851009_1139851016 -2 Left 1139851009 16:69951632-69951654 CCGGGGGCGGTGAGGGGTGGATG 0: 3
1: 0
2: 1
3: 28
4: 337
Right 1139851016 16:69951653-69951675 TGCTGGACTGGGGAGGAAGGAGG 0: 3
1: 0
2: 6
3: 77
4: 693
1139851009_1139851017 1 Left 1139851009 16:69951632-69951654 CCGGGGGCGGTGAGGGGTGGATG 0: 3
1: 0
2: 1
3: 28
4: 337
Right 1139851017 16:69951656-69951678 TGGACTGGGGAGGAAGGAGGAGG 0: 3
1: 1
2: 10
3: 160
4: 1582
1139851009_1139851021 15 Left 1139851009 16:69951632-69951654 CCGGGGGCGGTGAGGGGTGGATG 0: 3
1: 0
2: 1
3: 28
4: 337
Right 1139851021 16:69951670-69951692 AGGAGGAGGAAGGAGGACCAGGG 0: 3
1: 1
2: 37
3: 317
4: 1725
1139851009_1139851018 5 Left 1139851009 16:69951632-69951654 CCGGGGGCGGTGAGGGGTGGATG 0: 3
1: 0
2: 1
3: 28
4: 337
Right 1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG 0: 3
1: 0
2: 45
3: 416
4: 2798
1139851009_1139851026 30 Left 1139851009 16:69951632-69951654 CCGGGGGCGGTGAGGGGTGGATG 0: 3
1: 0
2: 1
3: 28
4: 337
Right 1139851026 16:69951685-69951707 GACCAGGGCTGGGGTCAAGGAGG 0: 3
1: 0
2: 2
3: 68
4: 458
1139851009_1139851014 -9 Left 1139851009 16:69951632-69951654 CCGGGGGCGGTGAGGGGTGGATG 0: 3
1: 0
2: 1
3: 28
4: 337
Right 1139851014 16:69951646-69951668 GGGTGGATGCTGGACTGGGGAGG 0: 3
1: 0
2: 2
3: 51
4: 522
1139851009_1139851022 19 Left 1139851009 16:69951632-69951654 CCGGGGGCGGTGAGGGGTGGATG 0: 3
1: 0
2: 1
3: 28
4: 337
Right 1139851022 16:69951674-69951696 GGAGGAAGGAGGACCAGGGCTGG 0: 3
1: 1
2: 15
3: 146
4: 1118
1139851009_1139851025 27 Left 1139851009 16:69951632-69951654 CCGGGGGCGGTGAGGGGTGGATG 0: 3
1: 0
2: 1
3: 28
4: 337
Right 1139851025 16:69951682-69951704 GAGGACCAGGGCTGGGGTCAAGG 0: 3
1: 0
2: 3
3: 167
4: 784
1139851009_1139851015 -5 Left 1139851009 16:69951632-69951654 CCGGGGGCGGTGAGGGGTGGATG 0: 3
1: 0
2: 1
3: 28
4: 337
Right 1139851015 16:69951650-69951672 GGATGCTGGACTGGGGAGGAAGG 0: 3
1: 0
2: 2
3: 72
4: 686

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139851009 Original CRISPR CATCCACCCCTCACCGCCCC CGG (reversed) Intronic
900457858 1:2786108-2786130 CACCCCACCCTCACTGCCCCAGG + Intronic
900573774 1:3373035-3373057 CATCAAACTCTCACCGCCGCAGG + Intronic
901203077 1:7477677-7477699 CCTTCACCCCTCCCCGCCTCTGG + Intronic
901221454 1:7586156-7586178 CATCCATCCCTCAGGGCCCCGGG + Intronic
902372100 1:16013482-16013504 CCCCCACCCCTCACACCCCCAGG - Intergenic
903340757 1:22652965-22652987 CATCCACAGCTCACCCTCCCAGG - Intronic
904142537 1:28365157-28365179 CATCCACCGCGCACACCCCCAGG - Intergenic
904918151 1:33985240-33985262 CATCCACCCCACCCCTCCCTGGG + Intronic
905452438 1:38065315-38065337 CATCCAGCCCTCCCCACCCTGGG + Intergenic
905551612 1:38845463-38845485 CACCCACCCCTGACAGGCCCTGG - Intronic
905775669 1:40665725-40665747 CATCCACGCGGCCCCGCCCCCGG - Intergenic
905869600 1:41395491-41395513 CAGCCACCCCTCCCAGCCCCAGG + Intergenic
906164533 1:43675995-43676017 CCTCCGCCCCCCACCACCCCAGG - Intronic
906881325 1:49594520-49594542 CATCCACCACTGACAGTCCCTGG + Intronic
907922633 1:58927960-58927982 CCTCCACCCCACCCCACCCCAGG + Intergenic
909282663 1:73774940-73774962 CATGCACCCATCACCACGCCCGG + Intergenic
909632268 1:77779745-77779767 TCTCCACCCCACCCCGCCCCTGG - Intronic
910929183 1:92425683-92425705 CATCCTCACCTCATCTCCCCAGG - Intergenic
912420088 1:109536785-109536807 CATCCACCCTTTTCTGCCCCAGG - Intergenic
912557650 1:110527894-110527916 CATCCTCCCTTCACCCTCCCAGG + Intergenic
914761813 1:150605204-150605226 CAGGCACCCGTCACCGCGCCTGG + Intronic
918765304 1:188474385-188474407 CAGGCACCCACCACCGCCCCCGG - Intergenic
920079756 1:203364293-203364315 CCTCCAGCTCACACCGCCCCTGG - Intergenic
920418194 1:205812769-205812791 CACCACCCCCTCCCCGCCCCAGG + Intronic
921434945 1:215107985-215108007 CATCCTCCCCTGACCGCCATTGG - Intronic
921736433 1:218633679-218633701 TTTCCACCCTTCCCCGCCCCAGG + Intergenic
921966282 1:221094039-221094061 CATCCAGCCCTGATCACCCCCGG + Intergenic
922167221 1:223126333-223126355 CATCCTCCCCTCCCAGCCCCTGG - Intronic
922235214 1:223717566-223717588 CATCCACCCATCAGGGCCCAGGG + Intronic
922488860 1:225999421-225999443 CGTTCACCCCTCCCCTCCCCTGG + Intergenic
922606010 1:226890418-226890440 CAGCCACCCCTCAGCTCTCCAGG + Intronic
922648025 1:227310827-227310849 CAGGCACCCGTCACCGCGCCCGG + Intronic
922821445 1:228488015-228488037 CCCCCTCCCCTCACCGCCACGGG + Intronic
923858390 1:237868544-237868566 CTTCCACCCCTGACAGGCCCAGG - Intergenic
924505696 1:244681486-244681508 CATCCTCCCTCCCCCGCCCCAGG - Intronic
1062956417 10:1543106-1543128 AAGCCACCCCACACCGCCCCAGG - Intronic
1064219601 10:13429174-13429196 CATCCCCCACTCCCAGCCCCTGG - Intergenic
1067772246 10:49135146-49135168 CATCCTCCCCTCACGGGCTCTGG + Intergenic
1067826720 10:49579396-49579418 CCTCCACCCCGCCCCACCCCCGG - Intergenic
1068961796 10:62874051-62874073 CACACACCCCTCACAGCCTCTGG + Intronic
1072690620 10:97570496-97570518 CAACCAGCCCCCACCACCCCAGG + Exonic
1073243032 10:102070567-102070589 GATCCTCCCCTCACCTTCCCAGG - Intergenic
1073248570 10:102108033-102108055 GCCCCACCCCTCACAGCCCCAGG - Exonic
1077010289 11:376550-376572 CGCCGACCCCTCCCCGCCCCCGG + Exonic
1077302797 11:1854930-1854952 CAACCCCCCCTCCCCGCTCCTGG - Intronic
1077409126 11:2395344-2395366 CCCCCACCCCGCCCCGCCCCAGG - Intronic
1077473473 11:2775660-2775682 CTTCCACCCCCCACCACCCCAGG - Intronic
1078466175 11:11552243-11552265 CACCCACCCCTCACCTGCCATGG + Intronic
1081831573 11:46120298-46120320 CATCCCCCCCACCCCACCCCGGG - Intronic
1083616508 11:64029044-64029066 CATCCCCACCTCCCCGCCCCAGG + Intronic
1083636636 11:64124366-64124388 CATCCATCCATCACCGCCGGTGG + Intronic
1083697531 11:64452745-64452767 CAGACACCCCTCACGGCCCTCGG - Intergenic
1083866335 11:65455520-65455542 CTTCCACCCCACACTGACCCAGG - Intergenic
1083897769 11:65628749-65628771 CCACCACCCCCCACTGCCCCAGG - Intronic
1084204536 11:67584046-67584068 CTGCCCCCCCTCCCCGCCCCCGG - Intronic
1085095877 11:73760506-73760528 CAGCGTCCCCGCACCGCCCCCGG - Intronic
1085405203 11:76257478-76257500 CTCCAACCCCTCACTGCCCCCGG + Intergenic
1085463530 11:76709426-76709448 CATGCTCCCCTCACTGCGCCAGG + Intergenic
1088706288 11:112467197-112467219 CATCCACCCATCATCAGCCCAGG - Intergenic
1088939174 11:114436452-114436474 CAACCACCACTCCCAGCCCCTGG - Intronic
1088971601 11:114779346-114779368 CAAGCCCCCCACACCGCCCCAGG - Intergenic
1089272994 11:117314889-117314911 CCCCCACCCCACACCTCCCCAGG - Intronic
1091458708 12:628000-628022 CATCCTCCCCGCCCTGCCCCCGG + Intronic
1091543031 12:1479938-1479960 CATCCACACCTCTAAGCCCCTGG + Intronic
1091837393 12:3595346-3595368 CCACCACCCCTCCCTGCCCCTGG + Intergenic
1092287237 12:7135736-7135758 CATCCTCCCCTCCCTGCCCTGGG + Intronic
1095097402 12:38155837-38155859 CGACCACCCCCCCCCGCCCCCGG - Intergenic
1097193230 12:57230210-57230232 CTTCCAGCCCTCACTGCCGCCGG - Intronic
1100407309 12:94282911-94282933 CGTGCACCCCTCACCGCCCTCGG - Intronic
1100617630 12:96243286-96243308 CTTCCACCCCTCTCAGCCCTAGG + Intronic
1101512267 12:105404130-105404152 CCTCCACCCCTGACAGGCCCTGG + Intergenic
1102428223 12:112861351-112861373 CATCTACCTCTCACTGCCCGAGG - Intronic
1103705143 12:122867334-122867356 CATCCCCCCCCCACCACCCCCGG - Exonic
1103894145 12:124262074-124262096 CACACACCCCTCACCGGGCCCGG + Intronic
1103988889 12:124785174-124785196 CTTCCACCCCTCCCAGCCCGGGG + Intronic
1104293928 12:127494816-127494838 CAGTCACCCCTCCCTGCCCCAGG - Intergenic
1104775149 12:131386371-131386393 CAGCCACCCCTCACCCCACAAGG - Intergenic
1104943070 12:132403914-132403936 CATGCCCCCCTCGCCTCCCCAGG - Intergenic
1105987584 13:25583568-25583590 CATCCACACCGCCCGGCCCCTGG + Intronic
1106250628 13:27979191-27979213 CACCCATCCCCCACCGGCCCGGG + Intronic
1106476333 13:30101644-30101666 CCTCCACCCCCCACCACCTCCGG + Intergenic
1113900281 13:113793111-113793133 CATCCCCCCTCCACCTCCCCAGG - Intronic
1113921535 13:113915851-113915873 CATCCACCCCCGATGGCCCCAGG - Intergenic
1117395516 14:55305439-55305461 CAGCCACCACGCACCGCACCCGG - Intronic
1118206432 14:63727854-63727876 CTTCCACCCCGCACAGCCGCTGG + Exonic
1118761995 14:68885636-68885658 CGCCCACCCCTCAGGGCCCCAGG + Intronic
1119428532 14:74551252-74551274 CCTCCACCCCGCCCCGCACCTGG + Exonic
1120358814 14:83468620-83468642 CCTCCACCCCTCAACGTCCTTGG - Intergenic
1121125537 14:91404316-91404338 GATTCACGTCTCACCGCCCCAGG - Intronic
1125626042 15:41109950-41109972 CAGCCACCCATCACCACGCCTGG - Intronic
1129189148 15:73927455-73927477 CATCTACCCCTACCAGCCCCGGG + Exonic
1129440630 15:75578774-75578796 CATCCCCCCGCCACCGCCGCCGG + Exonic
1130531241 15:84748853-84748875 CCGCCACCCCACCCCGCCCCCGG + Intronic
1130557877 15:84935564-84935586 CAGCCACTCCTCAGGGCCCCTGG + Intronic
1131830518 15:96352076-96352098 CCTCCACGCCCCACCCCCCCGGG - Intergenic
1132333865 15:101030642-101030664 CACCCACTCCTCACCCCACCTGG + Intronic
1132527066 16:422390-422412 CACGCACCCGCCACCGCCCCCGG + Intergenic
1132552266 16:558417-558439 CCTCCACCCCTCACCACCGATGG - Intergenic
1132553594 16:563554-563576 CACCCACCCCAGACCGCCCTGGG + Exonic
1132723806 16:1330210-1330232 CATCCAAGCCTCACCGCAGCAGG + Intergenic
1132987810 16:2777179-2777201 CAGCCGCCCCCCGCCGCCCCCGG + Intronic
1132989593 16:2785973-2785995 CAGCCAACCCTCACCGCCCCTGG - Intronic
1134656059 16:15949459-15949481 CAGCCACCTCTCGGCGCCCCGGG - Intergenic
1135159696 16:20082828-20082850 CATCCACCTCTGACTGCCCTGGG - Intergenic
1136110728 16:28062655-28062677 CACCCACCCCGGAACGCCCCTGG - Intronic
1138510397 16:57505376-57505398 CATCCAGACCTCAGGGCCCCGGG + Intergenic
1138534628 16:57653348-57653370 CTGCCTCCCCTCACAGCCCCAGG - Intronic
1138581006 16:57940328-57940350 TATCCTCCCCACCCCGCCCCGGG - Intronic
1138971622 16:62151245-62151267 CAGCCCCCACTCCCCGCCCCCGG + Intergenic
1139580957 16:67873335-67873357 CAACCCCCGCTCACCGCCCGCGG - Exonic
1139842431 16:69892348-69892370 CACCCACCCCTGACAGGCCCCGG + Intronic
1139851009 16:69951632-69951654 CATCCACCCCTCACCGCCCCCGG - Intronic
1139879991 16:70174544-70174566 CATCCACCCCTCACCGCCCCCGG - Intronic
1140030855 16:71338123-71338145 CCCCCACCCCTCAACGCTCCTGG - Intergenic
1140372523 16:74420983-74421005 CATCCACCCCTCACCGCCCCCGG + Intronic
1140626079 16:76796019-76796041 CCCCAACCCCCCACCGCCCCCGG + Intergenic
1140728240 16:77833341-77833363 ATTCCACCCCTCACCTCCTCTGG - Intronic
1141296419 16:82773924-82773946 CAGCCACCCACCACCACCCCTGG + Intronic
1141393207 16:83681612-83681634 CCTCCACCCCTCTCCTCTCCTGG + Intronic
1141407542 16:83807589-83807611 GACCCACCCCTACCCGCCCCGGG - Intergenic
1142223201 16:88865247-88865269 CCTCCACCCCACACCCCCGCTGG + Intronic
1142378091 16:89717113-89717135 CTTCCACCCCCCACTGACCCCGG + Intronic
1142709196 17:1714517-1714539 TGTCCGCCCCTCACAGCCCCGGG - Intergenic
1142719472 17:1766751-1766773 CGACCACCCCTCACCCCTCCAGG - Intronic
1143317576 17:6044173-6044195 CAGGCACCCGTCACCACCCCTGG + Intronic
1143402763 17:6656846-6656868 CCTCCACCCCACCCCGCCCGAGG - Intergenic
1143791086 17:9296045-9296067 CAGGCACCCGCCACCGCCCCCGG - Intronic
1144588297 17:16502420-16502442 CATTCACCCCCAACCACCCCAGG + Intergenic
1144738149 17:17566389-17566411 CATCCATGCCTCACAGCACCAGG + Intronic
1144782235 17:17814018-17814040 CATCCACCCCCCTCCTCCCAGGG + Intronic
1145374919 17:22338303-22338325 CATCCACCCCTCTCCCCACCAGG - Intergenic
1145759208 17:27416374-27416396 CCTCCACCCCATCCCGCCCCAGG - Intergenic
1146942760 17:36855220-36855242 CATTAACCCCTCAACCCCCCAGG - Intergenic
1147596739 17:41722812-41722834 GATCCCCCCCTCCCTGCCCCTGG - Exonic
1147752524 17:42744947-42744969 CCTCCTCCCCTCGCCGCCCTGGG - Intronic
1148360879 17:47010909-47010931 AATCCACCCCACACTGCCTCAGG - Intronic
1151311711 17:73296836-73296858 CAGGCCCCCCTCACCGCGCCTGG - Intronic
1151322574 17:73360606-73360628 CTCCCACCCCTCATCCCCCCAGG - Intronic
1151939090 17:77281567-77281589 CACCGACCCCTCCCCACCCCGGG - Intronic
1152174967 17:78781769-78781791 CCTCCACCCCTCGGCCCCCCGGG + Intronic
1152695324 17:81741169-81741191 CAGGCTCCCCTCACAGCCCCGGG + Intergenic
1152720848 17:81923261-81923283 CACCCCCCCCCCCCCGCCCCCGG + Intronic
1152736921 17:82001580-82001602 CATCCACCCCCTACCCCCCGGGG - Intronic
1152942929 17:83181955-83181977 CATCCCCCCTGCACCCCCCCAGG - Intergenic
1153574811 18:6509762-6509784 CATACACCCCACACCCCACCCGG - Intergenic
1157207165 18:45710467-45710489 ACTCCACCCCTCACCAGCCCTGG + Intergenic
1157260923 18:46174660-46174682 CAGCCTCCCCTCAGCACCCCCGG - Intronic
1157270517 18:46272244-46272266 CATCCCCACCTCACTGCCCAAGG - Intergenic
1160029760 18:75249010-75249032 CATCCAAGCCTCTCCACCCCAGG - Intronic
1160895329 19:1399696-1399718 CCTCCACCTCTGACAGCCCCAGG + Intronic
1160930137 19:1566570-1566592 CCGCCACCCCTCCCCGCTCCTGG - Intronic
1161118167 19:2511068-2511090 CACCCTCCCTTCACCGGCCCAGG - Intergenic
1161224459 19:3136602-3136624 CACCCACCGCCCACCGACCCTGG - Intronic
1161776332 19:6264240-6264262 CCTCCACCCCTCCCCACCCCAGG + Intronic
1161982618 19:7637694-7637716 CGTCCAGGCCTCACCGGCCCCGG + Intronic
1162300674 19:9843133-9843155 CAGCCACCCCTCACATGCCCAGG + Intronic
1162504213 19:11073297-11073319 GAGCCACCACTCACCACCCCCGG - Intergenic
1163158194 19:15450063-15450085 CCCCCCCCCCTCGCCGCCCCGGG + Intergenic
1163862614 19:19750123-19750145 CATCCACCCTACACAGCCCCAGG + Intergenic
1164727521 19:30476211-30476233 CATCCACTCCCCAGCGCACCTGG + Intronic
1165106314 19:33471582-33471604 CAACCACCCCACACATCCCCTGG - Intronic
1165595402 19:37008207-37008229 CATCCCCCCCCGCCCGCCCCAGG - Intronic
1165782124 19:38441011-38441033 CCTCCACCCCTCCCCACCTCAGG - Intronic
1167295449 19:48646573-48646595 CAGCCCCCCTTCCCCGCCCCAGG + Intergenic
1167614311 19:50523533-50523555 CAGGCACCCCCCACCACCCCCGG - Intronic
1167674567 19:50876450-50876472 CATCCACCCCCTTCCTCCCCAGG + Exonic
1167713545 19:51126289-51126311 CATCCTCCCATCACCTCCCTTGG + Intronic
1167774233 19:51544432-51544454 CATCCTCCCCTCACTCCCCTTGG - Intergenic
1167928768 19:52846340-52846362 CAGCCACCCACCACCGCACCTGG + Intronic
1167978868 19:53255562-53255584 CTTCCACCCCCCACCGCCCAGGG - Intergenic
1168417254 19:56176576-56176598 CATCCACCCCTCTGCCCTCCTGG - Intronic
1168651733 19:58096489-58096511 CAGCCACCCCTCACCCACCGTGG - Intronic
926143888 2:10385203-10385225 CATCAGCCCCTCCCAGCCCCTGG + Intronic
926231630 2:11008493-11008515 CACCCACCTCTCACCCCACCTGG - Intergenic
929571225 2:43024334-43024356 CACACCCCCCTCACCCCCCCAGG - Intergenic
929830990 2:45346021-45346043 CACACACCCCACACAGCCCCTGG - Intergenic
930065522 2:47324653-47324675 CCTCCTCCCCTCACTGCCCAGGG + Intergenic
930286623 2:49437022-49437044 CCTCCACCCCTGACAGACCCTGG - Intergenic
930794122 2:55369695-55369717 GATCCACCCACCACCACCCCTGG + Intronic
931595059 2:63932494-63932516 CCTCCACCCTTCACAGGCCCTGG - Intronic
931763576 2:65436104-65436126 AATCACCCCCTCCCCGCCCCTGG - Intergenic
932608023 2:73177276-73177298 CACCCATCCTTTACCGCCCCCGG + Intergenic
932986497 2:76731900-76731922 CCTCCAACCCTCACTGTCCCAGG - Intergenic
935757171 2:106285134-106285156 CATACTCCCCTCCCCGTCCCGGG - Intergenic
937952597 2:127400388-127400410 CATCCTCCCCTCTTGGCCCCTGG - Intergenic
939380340 2:141427028-141427050 CCTCCACCCCTGACAGGCCCTGG + Intronic
944159063 2:196639794-196639816 CGACCACCCCTCACCAGCCCGGG - Intronic
946042504 2:216794473-216794495 CATGCACCCACCACCGCACCTGG - Intergenic
946112193 2:217429762-217429784 CCTCCACCCCTCACTCCCCTGGG + Intronic
946177352 2:217929692-217929714 CCTCCACCCCCCACCCGCCCCGG + Intronic
946191598 2:218010536-218010558 CATCCGCCCCGCAGCGCGCCCGG - Intergenic
947389561 2:229625257-229625279 CTGCCACCCCTCCCAGCCCCCGG - Intronic
948147793 2:235721148-235721170 CAGGCACCCCCCACCGCGCCCGG + Intronic
948189591 2:236047382-236047404 CCTCCACCCTCCACAGCCCCAGG + Intronic
948794631 2:240396037-240396059 AAGCCACCCCTGCCCGCCCCCGG + Intergenic
948931119 2:241133139-241133161 CGACCACCTCTCACCACCCCAGG + Intronic
1169823634 20:9742087-9742109 TATCCAACCCTCACCACCCAAGG + Intronic
1172096376 20:32462484-32462506 CACCCACCCCTCACTGCACCTGG + Intronic
1172621223 20:36319823-36319845 CCTCCTCCCCTCACCACCCCAGG + Intronic
1173495603 20:43515151-43515173 CCTCCTCCCCTTACCGCTCCTGG - Exonic
1174343257 20:49911242-49911264 TGTCCACCCCTCACCCTCCCTGG + Intronic
1175496342 20:59417069-59417091 CATCTACCCCTCACCCCACCAGG - Intergenic
1175919643 20:62444708-62444730 CATCCACCTCTCCCATCCCCTGG - Intergenic
1176924665 21:14733424-14733446 CAGGCACCCGCCACCGCCCCTGG + Intergenic
1177800879 21:25827432-25827454 CATCCACCATTCTCTGCCCCAGG - Intergenic
1177805214 21:25868546-25868568 CATCCTCCCCTCTCCACTCCTGG - Intergenic
1179885942 21:44314332-44314354 CAACCACCTCCCACCGCCCCAGG - Intronic
1179955724 21:44737170-44737192 CCTCCACCCCACCCCTCCCCTGG - Intergenic
1180713979 22:17859055-17859077 CTTCCTCCCCTCAGCCCCCCAGG - Intronic
1181829902 22:25551909-25551931 CACCCACCCCTGACAGGCCCTGG + Intergenic
1182096849 22:27631171-27631193 CACCCACCTCCCACCACCCCAGG + Intergenic
1184042334 22:41951543-41951565 CATCTACCCCACAGCACCCCTGG - Intergenic
1184337554 22:43862625-43862647 CGTCCTCCCCGCCCCGCCCCCGG + Intergenic
1184769601 22:46589532-46589554 CAGCCACCCCCCACATCCCCTGG - Intronic
1184875022 22:47268899-47268921 CATAGAACCCTCACCACCCCTGG - Intergenic
1185104234 22:48858196-48858218 CATCCACCTGTCACAGCACCCGG + Intergenic
1185179378 22:49350304-49350326 CCTCCAGCCCTCATCGCCCCGGG - Intergenic
949447058 3:4146189-4146211 CATCCACCCCTCTTTTCCCCAGG - Intronic
949748688 3:7326034-7326056 CTTCTACACCTCCCCGCCCCCGG + Intronic
950451709 3:13069082-13069104 TATCCACCCTTTACAGCCCCAGG - Intronic
952883102 3:37997695-37997717 CACCCACCCCTGCCCACCCCAGG - Intronic
952931101 3:38361646-38361668 CACCCACTGCTCACCTCCCCAGG - Intronic
954024483 3:47771595-47771617 CATGCACCACCCACCGCACCTGG - Intronic
954379821 3:50213481-50213503 CAGCCACCCAGCACCGCCTCAGG + Intronic
955348904 3:58179981-58180003 CCTCCACCTCTCCCTGCCCCTGG + Intergenic
957787202 3:84898669-84898691 CCTCCACCCCTGACTGGCCCTGG + Intergenic
960582751 3:119294696-119294718 GATCCACCCCGCGCCGCTCCGGG - Exonic
961041866 3:123683421-123683443 CGCCCACCCCTCAGAGCCCCAGG - Intronic
961271405 3:125692442-125692464 TCTCCACCCCTCTCCCCCCCTGG + Intergenic
961366176 3:126401168-126401190 CATCCTCCCCTCCCCAGCCCCGG - Intronic
964912025 3:161794638-161794660 CCTCCACTCCTCCCCTCCCCAGG + Intergenic
965093557 3:164193204-164193226 CCTCCAACTCCCACCGCCCCTGG + Intergenic
966724711 3:183099243-183099265 CGTCCTCCCCACACCGACCCTGG + Intronic
966879903 3:184344406-184344428 CATTCACCCCACTCCACCCCTGG - Intronic
968454121 4:688648-688670 CTTCCACGCCTCCCAGCCCCAGG - Intronic
969053400 4:4387542-4387564 CTTCCCCCCCGCCCCGCCCCGGG + Intronic
969125734 4:4946474-4946496 TATCCTCCCCTCACAGCCCTCGG + Intergenic
969474312 4:7412667-7412689 CATCAGCCCCTCCCCACCCCTGG + Intronic
969710423 4:8840185-8840207 CATACCCCCCACCCCGCCCCGGG - Intergenic
970412211 4:15819173-15819195 CACCCACCCCTGACAGGCCCTGG - Intronic
971001891 4:22332653-22332675 AATCCACCCCCCCCCCCCCCCGG - Intergenic
972666744 4:41172212-41172234 CATCCAGCACCCCCCGCCCCAGG + Intronic
972726831 4:41751986-41752008 CATCCCTCCCCCACCACCCCTGG + Intergenic
973887419 4:55337179-55337201 CAGGCACCCGTCACCACCCCTGG - Intergenic
975286875 4:72631571-72631593 CATCCACCCCACTCAGCCTCTGG + Intergenic
977073829 4:92428117-92428139 CAGGCACCCCTCACCACGCCCGG - Intronic
978642965 4:110893096-110893118 CCTCCACCCCTCAACACGCCTGG - Intergenic
979274800 4:118803076-118803098 CTTCCACCCCACCCAGCCCCTGG - Intronic
979316158 4:119266028-119266050 CATACTCCCCACACCACCCCAGG + Intronic
979796564 4:124853942-124853964 CATCCACCCCCCCCCCTCCCCGG + Intergenic
981031692 4:140131807-140131829 CCTTCACCCTTCACAGCCCCTGG - Intronic
982988947 4:162246018-162246040 CCTCCACCCCTGACAGGCCCTGG + Intergenic
984042728 4:174756785-174756807 CAGGCACCCGTCACCTCCCCTGG + Intronic
984663401 4:182398343-182398365 CATGCACCCCACACCTCCACTGG + Intronic
984931469 4:184851261-184851283 CATCCACCCTTCACCAGCACAGG - Intergenic
986337523 5:6766553-6766575 CATCCAGGCCCCACCGCTCCAGG - Intergenic
986488920 5:8269481-8269503 CCCCCACCCCTCACCTCCACAGG - Intergenic
986620123 5:9664130-9664152 CATGCCTCCCTCATCGCCCCAGG + Intronic
989229755 5:39073676-39073698 CATCCTGCCCTCCCCGTCCCCGG - Intronic
990649026 5:57877540-57877562 CAGCCACCCGTCACCACGCCTGG - Intergenic
995039017 5:107567555-107567577 CATCCACCCACCCCTGCCCCAGG + Intronic
996000841 5:118361633-118361655 CAGGCACCCATCACCGCACCTGG - Intergenic
997399503 5:133591537-133591559 CATCCTCCCCTCAGAGCCCCTGG + Intronic
997438526 5:133892375-133892397 CATCCACCCACCCCTGCCCCTGG + Intergenic
999027358 5:148249678-148249700 CATCTACCCCTCACCACCTGGGG + Intergenic
999413949 5:151378725-151378747 CACCCACCTCTCACCCTCCCCGG - Intergenic
999757393 5:154675015-154675037 CATGCACCCACCACCACCCCCGG + Intergenic
1001524925 5:172422135-172422157 CAGGCACCCGTCACCGCACCTGG + Intronic
1001764603 5:174235455-174235477 CATCCGCCCCTCCCACCCCCTGG - Intronic
1001923043 5:175615805-175615827 CCTCCTCCCCTCACAGCCCCTGG - Intergenic
1002026899 5:176401884-176401906 CCTCCTGCCCTCACCGCCCCTGG + Intronic
1002829417 6:805484-805506 CAGGCACCCGTCACCACCCCTGG - Intergenic
1002838671 6:887156-887178 CGTTCTCCCCTCACAGCCCCTGG + Intergenic
1004643997 6:17542098-17542120 CCTGCACCCCTCCCAGCCCCTGG + Intronic
1006012649 6:31055486-31055508 TCTCCAGCCCTCACTGCCCCAGG - Intergenic
1006118944 6:31792378-31792400 CACCCTCGCCTCACCTCCCCTGG + Exonic
1006179897 6:32148502-32148524 CTTCCACCCATCCCAGCCCCTGG - Exonic
1006190040 6:32202031-32202053 CACCCACCCCTCTCCTTCCCTGG + Intronic
1006563288 6:34932326-34932348 CAGGCACCCACCACCGCCCCTGG + Intronic
1007406984 6:41640824-41640846 CACCCACCCCTGAGAGCCCCGGG + Intronic
1007590653 6:43018784-43018806 CCCCCATCCCTCACCGCCTCAGG - Intronic
1007722496 6:43893435-43893457 CTTCCACCCCACTCAGCCCCAGG + Intergenic
1007762446 6:44140955-44140977 CCCCCACCCCTCACATCCCCTGG + Intronic
1008786494 6:55174844-55174866 TATCACCCCCTCTCCGCCCCGGG + Intronic
1009003719 6:57753630-57753652 CAGGCACCCGTCACCGCGCCCGG + Intergenic
1009054364 6:58316988-58317010 CATCAACCTCTCACCTCCCTGGG + Intergenic
1009236774 6:61133591-61133613 CATCAACCTCTCACCTCCCTGGG - Intergenic
1011717833 6:90125698-90125720 CATGCATCCCTCACACCCCCAGG + Intronic
1014974527 6:127862702-127862724 CAGCCACCCCACCCAGCCCCAGG + Intronic
1015700870 6:136034808-136034830 CAACCACCCCTCAGGGACCCTGG + Intronic
1017631353 6:156398964-156398986 CATTCACCCCTGCCTGCCCCTGG + Intergenic
1017646522 6:156544273-156544295 CATCCCCTCCTCCCAGCCCCCGG + Intergenic
1018215105 6:161518766-161518788 CATCCACCTCTAGCAGCCCCTGG + Intronic
1019096303 6:169582835-169582857 CTTCAACCCATCAGCGCCCCAGG - Exonic
1019656785 7:2200196-2200218 CAACCACCCCACACCCGCCCCGG + Intronic
1021475057 7:21051419-21051441 CAGGCACCCATCACCGCACCCGG + Intergenic
1022112385 7:27239638-27239660 CACCCACCCCCCTCCGGCCCGGG + Intergenic
1022282762 7:28927556-28927578 CCTCCTCCCCTCCCGGCCCCCGG - Intergenic
1023868891 7:44252237-44252259 GCTGCACCCCTCACCGCCCCAGG - Intronic
1023871422 7:44264914-44264936 CATGGACCCCTCCCCTCCCCAGG - Intronic
1024970497 7:55065270-55065292 CGTCCACCCCTCTCCTCCCTAGG - Intronic
1025738480 7:64175283-64175305 CATCCCCCCCGCCCCACCCCAGG + Intronic
1026051836 7:66953361-66953383 CATCCACCGCTCACCTTCTCGGG - Exonic
1026735952 7:72948855-72948877 CATCCCCCCCTCCACGACCCTGG + Exonic
1026840731 7:73668730-73668752 CAACCTCCCCTCCCTGCCCCTGG - Intronic
1027107781 7:75416206-75416228 CATCCCCCCCTCCACGACCCTGG - Intergenic
1027189369 7:75988647-75988669 CCTCCACCCCCCACCCCACCTGG - Intronic
1027189523 7:75988971-75988993 CCTCCACCCCCCACCCCACCCGG - Intronic
1027189539 7:75989000-75989022 CCTCCACCCCCCACCCCACCCGG - Intronic
1028906178 7:96156592-96156614 CAGGCACCCGTCACCGCGCCTGG + Intronic
1029109437 7:98204974-98204996 CATTCACCCCACCCCGCCCTCGG - Intronic
1029422207 7:100477560-100477582 CGTCCACCCCCCACCTCTCCTGG - Exonic
1032173380 7:129604365-129604387 CATCCTCCCCTGACAGGCCCCGG - Intergenic
1032322454 7:130897589-130897611 CAGCCACCCCTCAGGGCCCCTGG + Intergenic
1034239925 7:149602519-149602541 CAGCCACTCCTCTCCGCTCCTGG - Intergenic
1034348213 7:150399778-150399800 CTTCCATCCTGCACCGCCCCAGG + Intronic
1034824862 7:154252544-154252566 CCTCCACCCCACACTGCCTCTGG + Intronic
1034980527 7:155473126-155473148 CACCCACCCCTGACTGTCCCTGG + Intergenic
1035352983 7:158259436-158259458 CAGACACCCCTCAGAGCCCCTGG + Intronic
1035619059 8:1024155-1024177 CATCCACCACCCACCCTCCCTGG + Intergenic
1036691309 8:10946515-10946537 CATCCACCCCTCCCACCCCTGGG + Intronic
1037718112 8:21416979-21417001 GATCCTTCCCTCACCACCCCTGG - Intergenic
1037922327 8:22816097-22816119 CATCTCCCCCTCACCCCCCAAGG - Intronic
1037988365 8:23303511-23303533 CATCCACTCCTCTCCCCACCCGG - Intronic
1038182271 8:25240461-25240483 CATTCCCTCCTCACAGCCCCAGG + Intronic
1038613210 8:29071995-29072017 CAGCCACCCCCCACCGCCCACGG - Exonic
1038841532 8:31188814-31188836 CATCCCCCCCTCCCCACCCATGG - Intergenic
1039681193 8:39738241-39738263 CAGGCACCCCTCACCACGCCTGG - Intergenic
1040479357 8:47809508-47809530 CATGCACCCTTCACAGCCCAAGG - Intronic
1042161792 8:65904520-65904542 CATCCTCCCATCACAGGCCCAGG + Intergenic
1042314852 8:67414958-67414980 CCTCCTCCCCTCAAAGCCCCTGG + Intergenic
1043837181 8:85061272-85061294 CACCCACCCCTCACCCCTCCTGG - Intergenic
1045264545 8:100608324-100608346 TCTCCACCCCCCACAGCCCCTGG + Intronic
1045459339 8:102412541-102412563 CAGCCGCCCCTCTCCTCCCCCGG - Exonic
1048017105 8:130507211-130507233 CAGGCACCCGCCACCGCCCCCGG - Intergenic
1049103608 8:140597473-140597495 CACCCCCCCCCCCCCGCCCCAGG + Intronic
1049253320 8:141600935-141600957 CATCTACCCCTCACTGCCACCGG + Intergenic
1049517470 8:143068924-143068946 AATGCTCCCCGCACCGCCCCAGG + Intergenic
1049661223 8:143820479-143820501 CACCCACCCGGGACCGCCCCTGG - Intronic
1049718173 8:144103539-144103561 CCGCCCCCACTCACCGCCCCAGG + Exonic
1051056999 9:12999792-12999814 CAAGCACCCCCCACCGCGCCTGG - Intergenic
1051128924 9:13836858-13836880 CACCCACCACTCACCCCCTCAGG + Intergenic
1051444890 9:17129488-17129510 CAGACACCCACCACCGCCCCCGG - Intergenic
1051823505 9:21193794-21193816 CATCCACCCCTCACATCACCAGG + Intergenic
1051825327 9:21212332-21212354 CACCCACCCCTCACATCACCAGG + Intronic
1051827304 9:21234392-21234414 CACCCACCCCTCACATCACCAGG + Intronic
1051855490 9:21559873-21559895 GCTCCGCCCCTCGCCGCCCCCGG + Intergenic
1053353650 9:37429532-37429554 CAGCCAGCCCACACTGCCCCAGG - Intronic
1055455208 9:76465652-76465674 CATCCACCCTCCTCCTCCCCAGG - Intronic
1056356556 9:85805899-85805921 CACCGTCCCCTCACCGCCGCTGG + Intergenic
1056902339 9:90611685-90611707 CATGCAGCCCCCACCCCCCCAGG + Exonic
1057023466 9:91718581-91718603 CAACCCCCCCCCCCCGCCCCAGG - Intronic
1061418691 9:130461817-130461839 TATCCACCCAGCACTGCCCCGGG + Intronic
1062210352 9:135360271-135360293 CATCCACACCCCACGGCCTCAGG + Intergenic
1062424933 9:136501793-136501815 CATGGCCCCCACACCGCCCCAGG - Exonic
1062532960 9:137009740-137009762 CAGCCACCCCCCACCCACCCAGG + Intronic
1203794594 EBV:169765-169787 CATCCACCGCCCGCAGCCCCCGG - Intergenic
1203794795 EBV:170303-170325 CATCCACCGCCCGCAGCCCCCGG - Intergenic
1203794986 EBV:170826-170848 CATCCACCGCCCGCAGCCCCCGG - Intergenic
1203795187 EBV:171364-171386 CATCCACCGCCCGCAGCCCCCGG - Intergenic
1185792334 X:2936928-2936950 CATCCACCAGTCCCAGCCCCAGG + Intronic
1191025477 X:55908754-55908776 CATCCTCTCCTCCCAGCCCCGGG - Intergenic
1192677664 X:73215237-73215259 CATCCACCTCTCCCCTCCCCAGG - Intergenic
1195342444 X:103918787-103918809 CCCCCACCCCTCTCCGCGCCGGG + Intergenic
1195364373 X:104112824-104112846 CCCCCACCCCTCTCCGCGCCGGG - Exonic
1196398246 X:115288826-115288848 CATCCCTCCCTCACCGCACCTGG - Intergenic
1198215535 X:134550921-134550943 TCCCCACCCCGCACCGCCCCCGG - Intergenic
1198417261 X:136433457-136433479 CATCCTTACCTCACCTCCCCAGG + Intergenic
1200072085 X:153534187-153534209 CAGCCTCCCCTCCCCACCCCAGG - Intronic