ID: 1139851018

View in Genome Browser
Species Human (GRCh38)
Location 16:69951660-69951682
Sequence CTGGGGAGGAAGGAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3262
Summary {0: 3, 1: 0, 2: 45, 3: 416, 4: 2798}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139851002_1139851018 17 Left 1139851002 16:69951620-69951642 CCCTGGGACAGCCCGGGGGCGGT 0: 3
1: 0
2: 2
3: 11
4: 135
Right 1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG 0: 3
1: 0
2: 45
3: 416
4: 2798
1139851008_1139851018 6 Left 1139851008 16:69951631-69951653 CCCGGGGGCGGTGAGGGGTGGAT 0: 3
1: 0
2: 1
3: 34
4: 282
Right 1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG 0: 3
1: 0
2: 45
3: 416
4: 2798
1139851003_1139851018 16 Left 1139851003 16:69951621-69951643 CCTGGGACAGCCCGGGGGCGGTG 0: 3
1: 1
2: 4
3: 47
4: 374
Right 1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG 0: 3
1: 0
2: 45
3: 416
4: 2798
1139851009_1139851018 5 Left 1139851009 16:69951632-69951654 CCGGGGGCGGTGAGGGGTGGATG 0: 3
1: 0
2: 1
3: 28
4: 337
Right 1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG 0: 3
1: 0
2: 45
3: 416
4: 2798

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139851018 Original CRISPR CTGGGGAGGAAGGAGGAGGA AGG Intronic
Too many off-targets to display for this crispr