ID: 1139871782

View in Genome Browser
Species Human (GRCh38)
Location 16:70114121-70114143
Sequence GAGGGTGGCAAAGAGGCCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 2, 1: 0, 2: 3, 3: 21, 4: 290}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139871774_1139871782 9 Left 1139871774 16:70114089-70114111 CCTAAGAGTCAAGGCTTCCACAG 0: 2
1: 0
2: 1
3: 19
4: 170
Right 1139871782 16:70114121-70114143 GAGGGTGGCAAAGAGGCCGCGGG 0: 2
1: 0
2: 3
3: 21
4: 290
1139871769_1139871782 27 Left 1139871769 16:70114071-70114093 CCCCGGTTCTAAAACGGCCCTAA 0: 1
1: 1
2: 0
3: 1
4: 22
Right 1139871782 16:70114121-70114143 GAGGGTGGCAAAGAGGCCGCGGG 0: 2
1: 0
2: 3
3: 21
4: 290
1139871770_1139871782 26 Left 1139871770 16:70114072-70114094 CCCGGTTCTAAAACGGCCCTAAG 0: 2
1: 0
2: 1
3: 4
4: 43
Right 1139871782 16:70114121-70114143 GAGGGTGGCAAAGAGGCCGCGGG 0: 2
1: 0
2: 3
3: 21
4: 290
1139871777_1139871782 -8 Left 1139871777 16:70114106-70114128 CCACAGCTCGCCTCTGAGGGTGG 0: 2
1: 0
2: 5
3: 20
4: 159
Right 1139871782 16:70114121-70114143 GAGGGTGGCAAAGAGGCCGCGGG 0: 2
1: 0
2: 3
3: 21
4: 290
1139871773_1139871782 10 Left 1139871773 16:70114088-70114110 CCCTAAGAGTCAAGGCTTCCACA 0: 2
1: 0
2: 1
3: 13
4: 132
Right 1139871782 16:70114121-70114143 GAGGGTGGCAAAGAGGCCGCGGG 0: 2
1: 0
2: 3
3: 21
4: 290
1139871771_1139871782 25 Left 1139871771 16:70114073-70114095 CCGGTTCTAAAACGGCCCTAAGA 0: 1
1: 0
2: 0
3: 5
4: 33
Right 1139871782 16:70114121-70114143 GAGGGTGGCAAAGAGGCCGCGGG 0: 2
1: 0
2: 3
3: 21
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139871782 Original CRISPR GAGGGTGGCAAAGAGGCCGC GGG Exonic
900087225 1:904399-904421 GCGGGGTCCAAAGAGGCCGCCGG + Intergenic
900378513 1:2372330-2372352 GAGCCTGGCAGAGAGGTCGCAGG - Intronic
900643154 1:3696883-3696905 GAGGGTGGCAGGGGGGCCGGAGG - Intronic
900852710 1:5156694-5156716 GAGGGAGGGAAAGAGGGAGCAGG + Intergenic
901158262 1:7155118-7155140 GATGGTGGCAGAGAGGTCCCTGG + Intronic
902403188 1:16169089-16169111 AAGGGTGGGAATGAGACCGCAGG + Intergenic
902730672 1:18366718-18366740 GAGGCAGGCAAAGAGGACACTGG + Intronic
903216804 1:21847895-21847917 GAGGGTGGCAGAGAGGTCCCCGG - Intronic
904253209 1:29238709-29238731 GAGGGAGGCAAAGTTGCCGCAGG - Intronic
904290525 1:29482846-29482868 CTGGGTGGAAAAGAGGCTGCTGG - Intergenic
904773988 1:32895666-32895688 GATGGAGGCCAAGAGGCCGAGGG + Exonic
905168366 1:36096789-36096811 GAGGGCAGCACAGAGGCCCCTGG - Exonic
905259204 1:36705735-36705757 GAGGGTGGAACAGAGGCAGCTGG + Intergenic
905405256 1:37728214-37728236 GAGAGTGGCAAATAGGAAGCTGG + Intronic
906782117 1:48581933-48581955 GAGAGAGGCCAAGAGGCCACCGG + Intronic
906804014 1:48762171-48762193 GGGAGTGGGAAAGAGGCCTCTGG + Intronic
911091979 1:94024498-94024520 TAGGGTGGGAAAGAGGCAGCGGG - Intronic
913388945 1:118289457-118289479 GTGGAAGGCAAAGAGGCAGCAGG + Intergenic
915581186 1:156814275-156814297 CAGGGAGGCAGAGAGGCTGCTGG - Exonic
916563038 1:165949561-165949583 GAGGATGGCACAGTGGCCTCTGG + Intergenic
916922668 1:169485629-169485651 GAGGCTGGCGAAGAAGCCGTAGG + Exonic
917485291 1:175449914-175449936 GAAGGTGGCTGAGAGGCTGCAGG - Intronic
920283336 1:204860404-204860426 GAGGGTGGCACAGGGGACACTGG - Intronic
920538790 1:206761447-206761469 CAGGGTGCCAAGGAGGCCTCTGG + Intergenic
920672918 1:208018247-208018269 GAGGGGAGCAAAGAGGCTGGAGG - Intergenic
921046993 1:211484859-211484881 GAGGGTGGCACAGAGGTGGCTGG - Intronic
922401914 1:225268103-225268125 GAGGTTAGCAAAGAGGCTTCTGG - Intronic
922613862 1:226949197-226949219 GAGGCTGGAAAGGAGGCCGGGGG + Intronic
922859232 1:228801672-228801694 GAGGTTGGCAAAGAGGGCTGTGG + Intergenic
923126923 1:231040751-231040773 GAGGGTGGCACAGAGGGCGTGGG - Intergenic
923391312 1:233515984-233516006 GAGGGAGGCAAAGGGGGCCCTGG + Intergenic
924486427 1:244487772-244487794 CAGGGAGGCAGAGAGGCAGCAGG + Intronic
924729288 1:246697139-246697161 GAGCGTGGCCCAGCGGCCGCAGG + Intergenic
1062969325 10:1634063-1634085 GAGGGTGGGAGAGGGGCCCCAGG - Intronic
1062974572 10:1674090-1674112 GAGGGCTGCAAGGAGGCCACTGG + Intronic
1063924802 10:10967168-10967190 GAGGGAGGCACAGAGACAGCTGG + Intergenic
1064008107 10:11714095-11714117 GAGGGGGGCAAAGCCCCCGCTGG + Intergenic
1067306080 10:45065273-45065295 GGGGGTGGCCAAGGGGCCGGAGG - Intergenic
1067317467 10:45181531-45181553 GAGGCTGGCCAAGAGCCTGCGGG + Intergenic
1067741076 10:48896629-48896651 GAGGAAGGCAAAGAGGCCGCTGG - Intronic
1069729615 10:70602263-70602285 CAGGGAGGCAAAGAGGCCAGGGG + Intronic
1069875933 10:71562827-71562849 CAGGGTGGCAGAGATGCCACAGG - Intronic
1073132665 10:101200242-101200264 GAGGGTGGCAAAGAATCCTACGG + Intergenic
1074527948 10:114277991-114278013 GAGGGTGCTGAAGAGGCCGTTGG - Exonic
1075674919 10:124289748-124289770 GAGGGAGGCAAGGAGGCACCGGG - Intergenic
1076881700 10:133242543-133242565 GAGAGTGGGAAACAGGCTGCGGG - Intergenic
1077028182 11:450879-450901 GAGAGACGCAAAGCGGCCGCAGG - Intronic
1077050013 11:562375-562397 GTGGGTGTCACAGGGGCCGCAGG - Exonic
1077191828 11:1258906-1258928 GAGGGTGGCACTGAGGGCACTGG - Intronic
1077204546 11:1336341-1336363 GAGGGTGGGAGAGAGGGCGGGGG - Intergenic
1077390078 11:2296776-2296798 GGGGGTGGCCACGAGGCCCCGGG - Intronic
1077676998 11:4204118-4204140 GTGGCTGGCACAGAGGCGGCAGG + Intergenic
1078141882 11:8699119-8699141 GAGCCTGGTAAAGAGGCCGAGGG + Intronic
1078170529 11:8925856-8925878 GATGGTGGCAGAGAGGGCACAGG + Exonic
1082780370 11:57282894-57282916 GAGGAAGGCAAAGGGGGCGCAGG - Intergenic
1082802906 11:57427301-57427323 GAGGGAGGGAAAGACACCGCTGG - Intronic
1083367802 11:62151983-62152005 GAGGCTGCCAAGAAGGCCGCAGG - Exonic
1084321253 11:68374658-68374680 GAGGATGGCAAAGGGGCACCGGG - Intronic
1084441795 11:69178881-69178903 GAGGGAGGCAAAGAGGAAGGAGG + Intergenic
1084576199 11:69989488-69989510 GAGGGAGGGAAAGAGGGAGCAGG + Intergenic
1086078644 11:82880252-82880274 CAAGGTGGCAAAGAGGCTGGGGG - Intronic
1088217634 11:107530537-107530559 GAGGGAGGCAAAGAGACCAGAGG - Intronic
1088725930 11:112634647-112634669 GAGGCCAGCAAAGAGGCCTCTGG - Intergenic
1089515758 11:119030515-119030537 GCGGGCGGCGAAGAGGCGGCGGG + Intronic
1090003971 11:122984259-122984281 GGGGCTGGAAAAGAGGGCGCCGG - Intergenic
1090285516 11:125496037-125496059 GGGGGTGGTAAGGAGGCCCCGGG - Intronic
1090603456 11:128396251-128396273 CAGGGTGGCAATGAGGCTGGGGG - Intergenic
1090667879 11:128926914-128926936 GAATGTGGCTAAGAGGGCGCAGG - Intergenic
1090858737 11:130634348-130634370 GAGAGTGGAACAGAGGCTGCAGG + Intergenic
1091703747 12:2680197-2680219 GAGGCTGGCAAAGGGGCTCCAGG - Intronic
1092263276 12:6963460-6963482 GAAGGTGGCTCAGAGGCGGCGGG + Intergenic
1094499187 12:31007588-31007610 GAGGGTGGCAGAGGGGCCAAGGG - Intergenic
1096181016 12:49550336-49550358 GAGGGTGGGAGAGAGGGCGTGGG + Intronic
1096781567 12:53995038-53995060 GGGCCTGGCAAAGAGGCCTCGGG + Intronic
1097158599 12:57029909-57029931 GGGGGTGGGGAAGAGGCCTCTGG - Intronic
1097238262 12:57554736-57554758 GTGGGAGGCAAAGAGGGAGCAGG + Intronic
1098897875 12:76084151-76084173 GGGGGTGTCCAAGAGGCGGCCGG + Intronic
1100899992 12:99227285-99227307 GAGGGTGTCAAAGCGGGAGCAGG - Intronic
1101422059 12:104558141-104558163 GGGGGAGGCAAAGAGGCAGAGGG - Intronic
1101748015 12:107558922-107558944 GGGGGTGGGCAAGAGGACGCAGG - Intronic
1105273888 13:18903791-18903813 GAGGGTGGCAAGGAGGAGGGGGG - Intergenic
1105806734 13:23955810-23955832 GAGGGTGGCAAGGAGGAGGGGGG + Intergenic
1106120961 13:26859879-26859901 GAGGGTGGCAAAGAGTTGGGTGG - Intergenic
1106382960 13:29257660-29257682 GAGGTTGGCAAAGAGACTGAAGG + Intronic
1107947427 13:45431742-45431764 GAAGGTGTCAAATAGGCCACTGG - Intergenic
1108336306 13:49444770-49444792 GAGGTTGTCAAAGGGGCGGCAGG + Exonic
1108441355 13:50456445-50456467 GAGGGTGGCACAGAGGTGTCAGG + Intronic
1112294767 13:98177035-98177057 GCGGGTGGCACCGAGGCCCCGGG - Exonic
1113048497 13:106182936-106182958 GAAGGTGGCAAAGAGGACCTAGG - Intergenic
1113615528 13:111677875-111677897 GAGGGTTGCTAAGGGGCTGCTGG + Intergenic
1113620996 13:111762777-111762799 GAGGGTTGCTAAGGGGCTGCTGG + Intergenic
1115308089 14:31952368-31952390 GAAAGAGGCAAAGAGGCCACGGG - Intergenic
1115480637 14:33857872-33857894 GTGGGTGGAAATGAGGTCGCAGG - Intergenic
1117327816 14:54684960-54684982 GAGGGTGGCCAGGAAGCTGCAGG + Intronic
1119793765 14:77377228-77377250 GAGGCTGGCGATGAGGCCGCAGG + Exonic
1119860316 14:77931410-77931432 GAGGGCTGCAAAGAAGCCCCAGG - Intronic
1120838809 14:89064845-89064867 GAGGGTGGCACAGAGGACGATGG + Intergenic
1120964596 14:90156291-90156313 GAGAGTGGAGAAGAGGCCCCAGG + Intronic
1121557385 14:94848691-94848713 CAGGCTGGCAAAGGGGCGGCGGG + Intergenic
1122160803 14:99782418-99782440 GAGGGGAGCAAACACGCCGCAGG - Intronic
1122839107 14:104446141-104446163 GAGGGTGTCAAAAAGGCCAGAGG - Intergenic
1123155998 14:106226584-106226606 GTGGAAGGCAAAGAGGCAGCAGG + Intergenic
1202939836 14_KI270725v1_random:136465-136487 GAAGGTGGCGCAGGGGCCGCGGG - Intergenic
1123679162 15:22745262-22745284 GTGGGTGGCAGACAGGCCGGCGG + Intergenic
1124331381 15:28819712-28819734 GTGGGTGGCAGACAGGCCGGCGG + Intergenic
1126418036 15:48439382-48439404 TTGGGTGGCAGAGATGCCGCAGG - Intronic
1126634084 15:50765273-50765295 GAGGGTGGAAAAGAGGAGGGTGG + Intronic
1128361499 15:66964888-66964910 GAGGGTTGGAGAGAGGCCTCGGG + Intergenic
1128367077 15:67012113-67012135 GAGGGTGGTAGAGAGGCTGGTGG - Intergenic
1129325686 15:74799111-74799133 GAGGGTGGCAAAGAAGGGACAGG + Intronic
1129766902 15:78175450-78175472 GAGGGAGGCACAGGGGCTGCAGG + Intronic
1130046615 15:80450740-80450762 GATGATGGCAGAGCGGCCGCAGG + Intronic
1131188441 15:90294421-90294443 GAAGGTGGCAAAGTGGGGGCAGG - Intronic
1131999497 15:98164434-98164456 GTGGGTGGGAAAGATGCCCCTGG - Intergenic
1132720427 16:1312977-1312999 GAGGGTGGCATTGAGGCTGCTGG + Intronic
1132722190 16:1321857-1321879 GAGGGTGGCACAGAGGCCCCAGG + Intronic
1132804857 16:1770788-1770810 GAGCGTGGGAAAGAGACCTCCGG + Intronic
1133283817 16:4681408-4681430 GAGGGTGGCCAAGAGCTCCCTGG - Intronic
1136384151 16:29912183-29912205 GAGAGTGGCAGAGAGGCTGGCGG - Intronic
1139441653 16:66971026-66971048 CAGGGAGGCAGAGAGGCAGCTGG + Intronic
1139871782 16:70114121-70114143 GAGGGTGGCAAAGAGGCCGCGGG + Exonic
1140364150 16:74368362-74368384 GAGGGTGGCAAAGAGGCCGCGGG - Intergenic
1141687289 16:85577637-85577659 GAGTGTGGCACAGAGGTCGAGGG + Intergenic
1142103017 16:88285579-88285601 GAGGGTGCCAAATGGGCCACAGG - Intergenic
1142124534 16:88403595-88403617 GAGGGTGGCAGAGCAGCTGCTGG + Intergenic
1142231932 16:88904014-88904036 GAGGGTGGCCAGGAGACCGCTGG + Intronic
1143096014 17:4478777-4478799 GAGAGTGTCAGAGAGGCCTCTGG - Intronic
1143243734 17:5465934-5465956 GAGGAAGGCTAAGAGGCTGCAGG - Intronic
1143411584 17:6712699-6712721 GAGAGTGGCAAAGACAGCGCAGG + Intronic
1143503735 17:7352838-7352860 GAGGGGGGCGAAGAGGGCACAGG - Exonic
1143785760 17:9254358-9254380 TAGGGGGGCAAAGAGGGCACAGG - Intronic
1144090199 17:11849471-11849493 GAGGATGGCTGAGAGGCAGCTGG - Intronic
1144479902 17:15620660-15620682 GAGGGTGGCAAAGAGAAGGGAGG + Intronic
1144686796 17:17231421-17231443 GAGGGAGGCAGACAGGCAGCGGG + Intronic
1144686894 17:17232030-17232052 GAGGGAGGCAGACAGGCAGCGGG + Intronic
1144835660 17:18155383-18155405 AAGGGTGGCCAGGAGGCCGGCGG + Exonic
1144918397 17:18743070-18743092 GAGGGTGGCAAAGAGAAGGGAGG - Intergenic
1145239483 17:21231796-21231818 GAGAGTGGCAAGGAGGCATCAGG + Intergenic
1146060993 17:29607371-29607393 TGGGGTGGCAAAGAGGCTGTTGG - Intronic
1146637481 17:34517217-34517239 GAGGGTGGCAATGAGGTGACTGG + Intergenic
1148217008 17:45838827-45838849 GAGGGCAGCAAGGAGGCCTCAGG + Intergenic
1149470685 17:56913307-56913329 GAGTGTGGCAGAGAGGCCCCCGG + Intronic
1149869766 17:60170908-60170930 TAGGGTGGTAAAGAAGCAGCTGG + Intergenic
1150917563 17:69451951-69451973 GTGGGTGGCAAGGAGGCTGTTGG + Intronic
1152746588 17:82043175-82043197 CATGGTGGCAAAGAGGACCCTGG + Intergenic
1153983863 18:10335798-10335820 GTGGGTGGGGAAGAGGCCCCTGG - Intergenic
1157221704 18:45832847-45832869 GAGGGTGGGAAAGACTCAGCAGG - Intronic
1160403629 18:78629429-78629451 GAGGGTGGCAAACAGGAGACAGG + Intergenic
1160875454 19:1294491-1294513 GAGGGAGACCAGGAGGCCGCCGG + Intronic
1161459073 19:4385813-4385835 GAGGCTGGCTCGGAGGCCGCTGG - Intronic
1162046097 19:8001389-8001411 GATGGTGGCAGAGAGGTGGCAGG - Intronic
1162451255 19:10756577-10756599 GAGGATGACAAAGAGCCCGAGGG - Intronic
1162687735 19:12401206-12401228 GTGGGTGGAGAAGACGCCGCGGG + Exonic
1163468455 19:17483376-17483398 GAGGGAGGCAATGAGGCTGCTGG + Intronic
1163569108 19:18069781-18069803 GAGGGTGGGAGAGAGGCTGCAGG - Intronic
1163761997 19:19142308-19142330 GAGGGTGGCGAAGATGACGTAGG + Intergenic
1164866930 19:31612352-31612374 CTTGGTGGCAAAGAGGCTGCAGG - Intergenic
1164953062 19:32355163-32355185 GAGGCTGTCAAGGAGGCAGCAGG - Intronic
1165137238 19:33677372-33677394 GATGGTAGAAAAGAGGCTGCAGG + Intronic
1165803227 19:38565550-38565572 GAGGGTGCCAGCGAGGGCGCTGG + Exonic
1166390860 19:42408075-42408097 GTCGATGGCAAAGCGGCCGCTGG + Exonic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166688675 19:44810339-44810361 GAGGGGGGCCAAGAGGCGGCTGG + Intronic
1166873419 19:45883973-45883995 GTGGGTGGCAAAGGGGCAGAGGG + Exonic
1167461162 19:49625412-49625434 GAGGGTGGCACACCGGCCTCTGG - Intronic
1168063172 19:53905579-53905601 GAGGGTGGTACAGAGACCCCAGG - Intronic
926862180 2:17321149-17321171 GAGGGAGGGAAAGAGACCCCAGG + Intergenic
927846692 2:26475977-26475999 GTCGGCGGCAAAGAGGCTGCGGG + Exonic
928266802 2:29818914-29818936 GAGGGTGGCACATAGGCAGAAGG + Intronic
929604531 2:43226087-43226109 GAGGGCGGCAAGGAGGGCGCCGG - Intronic
932341506 2:70965200-70965222 GAGGGCGGCGCAGAAGCCGCTGG - Exonic
932704065 2:74009888-74009910 AAGGGTGGCATAGGGGCCTCAGG + Intronic
934480774 2:94641316-94641338 GAGGATTGGAAAGAGGCCCCAGG + Intergenic
934979733 2:98829850-98829872 GAGGGGTGAAAAGAAGCCGCTGG + Intronic
935601372 2:104925493-104925515 GAGGGTGGGGAGGAGGCCACTGG + Intergenic
935695484 2:105767482-105767504 GAGGTTGGCAAAGTGGCCCATGG + Intronic
935925026 2:108058715-108058737 CAGGGAGGCAAAGAGGCTGGAGG + Intergenic
938073970 2:128322359-128322381 CTGGGCGGCAAAGGGGCCGCGGG - Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
946278482 2:218648762-218648784 GAAGGTGGCAAAGGGGCAGAAGG + Exonic
946330320 2:219005397-219005419 GAAGGTGGCAATGAGGGCCCAGG + Intronic
947588368 2:231370672-231370694 GAGGGTGAGAGAGAGGCCCCAGG - Intronic
948467145 2:238158114-238158136 GAAGGTGGCAGAGAGGCCTCTGG - Intergenic
948602775 2:239116734-239116756 CAGGGTGGCAGGGAGGCTGCAGG - Intronic
948606526 2:239139284-239139306 GAGGGTGGCTGAGAGGCCGTGGG - Intronic
948725381 2:239930813-239930835 GAGGGAGGTCAGGAGGCCGCAGG + Intronic
948725413 2:239930899-239930921 GAGGGAGGTCAGGAGGCCGCAGG + Intronic
948961694 2:241343991-241344013 GAGGGCGGCAATGAAGCTGCTGG - Intronic
948965128 2:241373533-241373555 GAGGCTGGCTAAGAGACTGCTGG + Intronic
1168870861 20:1127061-1127083 GAGGGTAGCACAGAGGCCAGGGG - Intronic
1169021578 20:2334910-2334932 GCAGGGGGCAAAGAGGCCCCAGG - Intronic
1172502312 20:35436306-35436328 GGGGGAGGCACAGAGGCAGCAGG - Intronic
1172519354 20:35557115-35557137 GATGGGGGCAAAGCGGCCTCTGG + Intronic
1172831208 20:37836578-37836600 GAGGGAGGCAAACAGGACGTGGG - Intronic
1173292422 20:41726593-41726615 GAGAGTAGCAAAGATGCCTCTGG + Intergenic
1173349370 20:42231104-42231126 CAGGCTGGTAAGGAGGCCGCTGG - Intronic
1173386755 20:42595453-42595475 GAGGGTAGCAAAATGGCCCCTGG + Intronic
1173869328 20:46331746-46331768 GAGGGTTGCAGGGAGGCCTCGGG + Intergenic
1175094821 20:56533061-56533083 GAGGGTTGGAAAGAGTCCCCTGG + Intergenic
1176583353 21:8550620-8550642 GAAGGTGGCGCAGGGGCCGCGGG + Intergenic
1178853201 21:36230246-36230268 GTGGGTAGCAAAGAGGAGGCTGG - Intronic
1179891649 21:44338711-44338733 GAGGGCGGCGAAGGAGCCGCGGG - Intronic
1180266163 22:10527550-10527572 GAAGGTGGCGCAGGGGCCGCGGG + Intergenic
1181462599 22:23094432-23094454 CAGGGTGGCCTAGAGGCCTCAGG - Intronic
1181643820 22:24219705-24219727 GAGGGTGGGAGAGTGGCCCCAGG + Exonic
1181868194 22:25876094-25876116 GAGGGTAGCAAAGGGGCTGGAGG - Intronic
1183395857 22:37570424-37570446 GAGGGTGTCAAGGAGGCAGGAGG + Intronic
1183784218 22:40019977-40019999 GACGGTGACAAAGTGGCCACTGG + Exonic
1184671466 22:46014102-46014124 GAGGGAGGGAAGGTGGCCGCGGG - Intergenic
1185130694 22:49037233-49037255 GAGGGTGGGAGAGAGGATGCTGG + Intergenic
1185130710 22:49037286-49037308 GAGGGTGGGAGAGAGGATGCTGG + Intergenic
1185130723 22:49037324-49037346 GAGGGTGGGAGAGAGGATGCTGG + Intergenic
1185130739 22:49037377-49037399 GAGGGTGGGAGAGAGGATGCTGG + Intergenic
1185130752 22:49037415-49037437 GAGGGTGGGAGAGAGGATGCTGG + Intergenic
1185130767 22:49037468-49037490 GAGGGTGGGAGAGAGGATGCTGG + Intergenic
1185130780 22:49037506-49037528 GAGGGTGGGAGAGAGGATGCTGG + Intergenic
949906772 3:8864385-8864407 GAGGGTGGCAGAGGGGCTGGGGG + Intronic
950113025 3:10432670-10432692 GAGGCTGGCAAGGAGGTGGCAGG + Intronic
953904376 3:46861149-46861171 GAGGGGGGCAAGGAGGCAGGAGG - Intronic
953979789 3:47407819-47407841 GAGGGTGGCACAGAGGGAGGTGG + Intronic
954633573 3:52059509-52059531 GGGAGTGGGAAAGAGGCTGCTGG + Intergenic
957200775 3:77133266-77133288 GAGGGTAGCGATGAGGCCACTGG + Intronic
960853485 3:122079501-122079523 GAGAGTGGCAGAGAGGTCCCTGG + Intronic
961386697 3:126526845-126526867 GAGGGAGCCAAGGGGGCCGCAGG - Intronic
961503101 3:127351179-127351201 GAGGGTGGAGAGGAGGCAGCTGG - Intergenic
962309212 3:134313581-134313603 GAGGGTGGCACAGAGCGGGCCGG - Intergenic
962588163 3:136862588-136862610 GGGGCTGACAAGGAGGCCGCGGG - Intronic
963127386 3:141827958-141827980 GAGGGTGCCCAAGAGGGCGAGGG + Intergenic
964941177 3:162158873-162158895 GAGAGTGGAAAAGAGGTGGCAGG + Intergenic
968517682 4:1021723-1021745 GTGGGTCCCAAAGAGGCCCCAGG - Intronic
968725466 4:2245911-2245933 GAGGGTGGGTAGGAGGCTGCAGG + Intergenic
968734110 4:2286298-2286320 GAGGATGCCAAAAAGGCAGCAGG + Intronic
969032611 4:4226770-4226792 GAGGGAGGCGAGCAGGCCGCTGG + Exonic
970824633 4:20255165-20255187 CCCGGGGGCAAAGAGGCCGCGGG - Intronic
971302179 4:25450894-25450916 GAGGGTGGAAAGGGGGCCTCGGG - Intergenic
971309714 4:25514948-25514970 GAGGCTGGAAAAGAGGCCAAAGG + Intergenic
972195086 4:36644796-36644818 GAGGGTTGAAAAGAGTCCTCAGG - Intergenic
972812542 4:42606404-42606426 GAGGGTAGAAAAGACGCCACTGG - Intronic
980189425 4:129504449-129504471 GAGGTAAGCAAAGAGGCTGCAGG + Intergenic
982618575 4:157675025-157675047 GAGGGTGGGAGAGAGCCAGCAGG - Intergenic
984116183 4:175683713-175683735 GTGGGAGGCAAAGAGGGAGCAGG - Intronic
984760229 4:183357108-183357130 GAGGGTGGAGAGGAGCCCGCAGG - Intergenic
984892222 4:184504250-184504272 CAGGGTGGCAGAGAGGCCACCGG + Intergenic
985801911 5:2010088-2010110 GAGGATGGCACAGGGGCTGCTGG + Intergenic
986317694 5:6601571-6601593 GAGGTTGGCAGGGAGGCCGAGGG - Intronic
986733123 5:10649627-10649649 GAGCGTGGGGAAGAGGCGGCTGG + Exonic
989142099 5:38211428-38211450 GAGGCTGGCAAACAGCTCGCTGG + Intergenic
989781155 5:45266036-45266058 GAGGGTGGCAAAGAGGGTTTAGG + Intronic
992483591 5:77174891-77174913 GAAGATGTCAAAGAGGCAGCTGG - Intergenic
993301619 5:86218465-86218487 GTGGGTGGCAGAGAGGTGGCTGG + Intergenic
996295891 5:121915997-121916019 GAAGGTGGCCATTAGGCCGCTGG + Intergenic
997207807 5:132060244-132060266 GTGGGTGGCCAGGAGGCCACTGG - Intergenic
997230245 5:132237286-132237308 GAGGGCAGGAAAGAGGCCACAGG - Intronic
1000368507 5:160512547-160512569 CAAGGTGGCAGAGAGGCCACTGG - Intergenic
1001653109 5:173329174-173329196 GAGGGTGGCAGGGAGGCCCAAGG + Exonic
1002718780 5:181245781-181245803 GAGGGTGGCAGAGCTGCCGGAGG + Intronic
1003970061 6:11290692-11290714 AAGGGTGGGCAAGAGGCCCCTGG + Intronic
1005501341 6:26431462-26431484 GTGGGTGTGAAAGAGGCAGCTGG - Intergenic
1005505909 6:26468669-26468691 GTGGGTGTGAAAGAGGCAGCTGG - Exonic
1017773978 6:157665467-157665489 GCTGGTGGGAAAGAGGCCCCAGG + Intronic
1017908618 6:158773704-158773726 GCGGGAGGCAAAAAGGCAGCGGG + Intronic
1019210140 6:170398063-170398085 GAGGATGGGAAAGAGGCTACGGG + Intronic
1019419794 7:945716-945738 GAGGGAGGGAAAGAGGCTGGCGG - Intronic
1019484697 7:1284177-1284199 GTGGGTGGCCTAGAGGCCGTGGG + Intergenic
1020085562 7:5308344-5308366 GTGGGGGGCACAGAGGCCGAGGG + Intronic
1022702782 7:32777165-32777187 GAGGATGGCAAAGTGGCAGGTGG + Intergenic
1025239107 7:57256760-57256782 GATGGTAGCAAGGCGGCCGCCGG - Intergenic
1025997115 7:66534967-66534989 GTGGGTGGGAAGGAGGCTGCTGG - Intergenic
1027231051 7:76272721-76272743 GAGGGTGGCAGAGAAGGCTCAGG + Intronic
1028269883 7:88775316-88775338 GAGGTTGGCTCAGAGGCCGAGGG + Intronic
1029444721 7:100605555-100605577 GAGGGGGGCCCAGAGGACGCGGG + Intronic
1032223158 7:130009339-130009361 GATGGTGGCATGGAGGCCGCTGG + Intergenic
1032702766 7:134396951-134396973 GTGGGAGGCAAAGAGGTCGATGG + Intergenic
1034690902 7:153012961-153012983 GAGGGTGGCACAGAGGCCACTGG - Intergenic
1034882846 7:154775765-154775787 GAAGGTGGTAAAGAGGCAGGTGG - Intronic
1035335155 7:158123296-158123318 GAGGGTGGCAAACAGTGGGCTGG + Intronic
1036591456 8:10172456-10172478 GGGGGAGGCAAAGGGGACGCAGG + Intronic
1036702155 8:11019913-11019935 GAGTGGGGCAGAGAGGCGGCAGG + Intronic
1037839722 8:22235329-22235351 GAGGGTGGGAAAGAGGACTCAGG + Intergenic
1037915172 8:22768689-22768711 GAGGGTGGCAAGGAGGTAGGGGG + Intronic
1038205013 8:25458026-25458048 GAGGGTCGGGAGGAGGCCGCGGG + Intronic
1040299742 8:46181680-46181702 GGGGGTAGCAGCGAGGCCGCAGG - Intergenic
1040886323 8:52267272-52267294 GAGGGTGAGAAAGAGGACCCTGG + Intronic
1041898515 8:62955028-62955050 CACTGTGGCAAAGAGGCAGCAGG - Intronic
1044666905 8:94641093-94641115 GGGGGTGGGAAGGAGGGCGCAGG - Intronic
1045016636 8:98006476-98006498 AACGATGGCAAAGAGGCCGTGGG + Intronic
1047672485 8:127163402-127163424 GAGGGAGGGAGAGAGGCAGCAGG + Intergenic
1049065677 8:140311900-140311922 GAGGGAGGAAAAGAGGACACAGG + Intronic
1049159530 8:141088642-141088664 GAGGGCGGCAGAGAGCGCGCTGG - Intergenic
1049187390 8:141264409-141264431 GCGGGAGGCAGAGAGGCTGCCGG + Intronic
1049657994 8:143807261-143807283 GAGGGTGGCAGGGGGGCCTCGGG - Intronic
1053677063 9:40442650-40442672 GAGGATTGGAAAGAGGCCCCAGG - Intergenic
1053926827 9:43068750-43068772 GAGGATTGGAAAGAGGCCCCAGG - Intergenic
1054286654 9:63182255-63182277 GAGGATTGGAAAGAGGCCCCAGG + Intergenic
1054290134 9:63278179-63278201 GAGGATTGGAAAGAGGCCCCAGG - Intergenic
1054388163 9:64582719-64582741 GAGGATTGGAAAGAGGCCCCAGG - Intergenic
1054507560 9:65933649-65933671 GAGGATTGGAAAGAGGCCCCAGG + Intergenic
1054763498 9:69023872-69023894 GTGGGTGGCAGAGAGGAGGCAGG - Intergenic
1056167865 9:83956392-83956414 GAGGGTGGCAGAGCTGCTGCTGG - Exonic
1059427847 9:114232197-114232219 GAGGGTGGCAGTGAGGGCACAGG + Intronic
1060114178 9:120927956-120927978 GAGGGTGGTATTGAGGCCGGAGG - Exonic
1062211471 9:135366583-135366605 GAGGGTGGCATTCAGGCAGCAGG + Intergenic
1062226603 9:135455866-135455888 GAGGGTGGGAAGGAGGAAGCTGG + Intergenic
1203791526 EBV:154186-154208 GAGGCAGGGAAAGAGGCCGTTGG + Intergenic
1203549237 Un_KI270743v1:154335-154357 GATGGTGGCAAGGATGCTGCTGG + Intergenic
1203613309 Un_KI270749v1:28387-28409 GAGGGTGGCGCAGGGGCCGCGGG + Intergenic
1187843770 X:23515258-23515280 GTGGGTGGCAAAGTGGGCCCTGG - Intergenic
1191273464 X:58510777-58510799 GAAGGTGGCAGAGAGGCTGGTGG + Intergenic
1194350682 X:92822062-92822084 GAGGGTTGCACAGCGGCGGCCGG - Intergenic
1196861676 X:120034505-120034527 GAGGGTGGCACAGAAGCTGGTGG + Intergenic
1200659012 Y:5938742-5938764 GAGGGTTGCACAGCGGCGGCCGG - Intergenic
1201739509 Y:17308399-17308421 GAGGGTGGCAAGAAGGCAGATGG - Intergenic