ID: 1139874871

View in Genome Browser
Species Human (GRCh38)
Location 16:70137697-70137719
Sequence CTCTTGAGTGATTTGTAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 2, 1: 0, 2: 0, 3: 20, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139874869_1139874871 16 Left 1139874869 16:70137658-70137680 CCACGATGAAAAGTTTATTTTAA 0: 1
1: 1
2: 3
3: 38
4: 427
Right 1139874871 16:70137697-70137719 CTCTTGAGTGATTTGTAGAATGG 0: 2
1: 0
2: 0
3: 20
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139874871 Original CRISPR CTCTTGAGTGATTTGTAGAA TGG Intronic
905407153 1:37741701-37741723 TTTTTGAGTTATTTTTAGAATGG - Intronic
905615274 1:39392953-39392975 CTCATTAGTGATTTCTAGAATGG - Intronic
908800799 1:67878683-67878705 CTTTGGAGTCATTTGAAGAAGGG + Intergenic
911332528 1:96541809-96541831 CTTTTGAGTCATTTTCAGAAAGG + Intergenic
911461851 1:98201425-98201447 CTCTGAAATGATTTGTAAAAAGG + Intergenic
911853781 1:102852571-102852593 CTCTTTAATGATTTCTACAAAGG + Intergenic
912527197 1:110292153-110292175 CACTTGGGGGATTTGGAGAAAGG - Intergenic
912593053 1:110846740-110846762 CTATTTAGTTATTTGCAGAAAGG - Intergenic
915519574 1:156433966-156433988 CTCTGGAGTCATTTGGACAATGG + Intergenic
916340752 1:163731054-163731076 AGCTTGGGTGATTAGTAGAAGGG + Intergenic
922437240 1:225618594-225618616 CACTTGATAGATTTGTGGAATGG - Intronic
923430004 1:233910861-233910883 GTTTTAAGTCATTTGTAGAATGG + Intronic
924013857 1:239697818-239697840 CTCCAGAGTGGTTTGTAGAGAGG + Intronic
1064314404 10:14241641-14241663 CTCTCCAATGCTTTGTAGAAGGG - Intronic
1064672459 10:17730886-17730908 CCCGTGAGTGCTTTGTAGGAAGG + Intergenic
1068292322 10:55020274-55020296 CTCATCAGCTATTTGTAGAAAGG - Intronic
1068416480 10:56729775-56729797 CTTTTGAGTGATTTTGAGCAAGG + Intergenic
1070025005 10:72623995-72624017 CTCTTGAGCCATTTTTACAATGG - Intronic
1073521230 10:104131632-104131654 CACTCGAGTTATTTGTTGAAAGG + Intronic
1074325392 10:112446418-112446440 CTCCGGAGAGATTTGTGGAAGGG + Intronic
1074486572 10:113889168-113889190 ATTTTGAGTCATTTATAGAAAGG + Intronic
1079889878 11:26038258-26038280 GTCTGAAGTGATTTGAAGAATGG - Intergenic
1079955441 11:26857336-26857358 CTTTTGAATGATTTTAAGAATGG - Intergenic
1080194195 11:29588767-29588789 TTCTTGTGTCATTTGTAAAATGG + Intergenic
1080674622 11:34413423-34413445 CTCTTGAATGATTTTTAGCTGGG + Intergenic
1083077929 11:60060837-60060859 CCCTTGACTGACTTGAAGAAAGG + Intronic
1085354996 11:75828267-75828289 CTCTGGAGTGATTGGTTGACTGG + Intronic
1087219123 11:95526935-95526957 TTCTTCAGTCCTTTGTAGAAGGG - Intergenic
1088136342 11:106560250-106560272 CTCTTGAATGACTAGAAGAATGG + Intergenic
1089368464 11:117935500-117935522 GTGTGGAGTGGTTTGTAGAAGGG + Intergenic
1094049803 12:26206532-26206554 CTCTGCAGTCATTTCTAGAATGG + Intronic
1094057700 12:26283566-26283588 CTCTTGAGTGCTGTGTTGAGAGG + Intronic
1094386372 12:29898277-29898299 CTCTTGAATGATTTGGAGTGGGG + Intergenic
1096551214 12:52373061-52373083 CTCTTGCCTCATTTGTAAAATGG - Intergenic
1097856218 12:64465334-64465356 CTCTAGACTGTTTTCTAGAATGG - Intronic
1099158178 12:79206380-79206402 CCTTTGAGTGATTTGTTGACTGG + Intronic
1099722468 12:86382137-86382159 CTCCTGAGAGACTTGTTGAATGG + Intronic
1100260098 12:92925033-92925055 CTCTTGAATGAGTTCTAGGAAGG - Intronic
1101481932 12:105106975-105106997 CTCTTCAGTGATTCGTAGTATGG + Intergenic
1103214639 12:119192266-119192288 CTGTTTAGTGATCTGTAGAATGG + Intronic
1106420759 13:29583636-29583658 TTCTTGGGTGATTTGGAGTAGGG - Intronic
1106942702 13:34795342-34795364 CTCTCTAGAGATTTGTTGAATGG + Intergenic
1107522332 13:41195348-41195370 CTGTTAATTGATTTGTGGAACGG - Intergenic
1107731454 13:43353083-43353105 TTCTTGAGTGATTGGAAGGATGG + Intronic
1110044252 13:70809308-70809330 CTCTTGAGAGACTTGTTGAATGG + Intergenic
1111579528 13:90205619-90205641 CTCTTTAGTAAATTGGAGAAAGG - Intergenic
1113012362 13:105784153-105784175 CTCAAGAGTCAATTGTAGAATGG + Intergenic
1113268078 13:108641694-108641716 CTCATGAGTGCTGTGTGGAAGGG - Intronic
1117957226 14:61131946-61131968 CTCTTGAGTGGATTGTGGAGGGG - Intergenic
1118453354 14:65924087-65924109 CTCCTAAGTGATTCGTAGGAGGG - Intergenic
1120671632 14:87368833-87368855 GTCTTCTGTGAGTTGTAGAAAGG - Intergenic
1123147701 14:106150038-106150060 CTCTCTAGAGATTTGTTGAATGG + Intergenic
1124050927 15:26197124-26197146 CTCTTCAGTGAAGGGTAGAAGGG + Intergenic
1126973303 15:54144512-54144534 CTCTTAAGTGCTTTGTGGATTGG - Intronic
1133443343 16:5838860-5838882 CTCTTTCCTGATTTGTAAAATGG - Intergenic
1133668932 16:7998608-7998630 CTATTGTGTGATAAGTAGAAGGG + Intergenic
1134515807 16:14885972-14885994 CCCTTGTGTGTTATGTAGAAAGG + Intronic
1136254475 16:29029097-29029119 CTCTTGTCTGTTTTGTAGATGGG - Intergenic
1136691045 16:32029401-32029423 CTCTCTAGAGATTTGTTGAATGG - Intergenic
1136791634 16:32972961-32972983 CTCTCTAGAGATTTGTTGAATGG - Intergenic
1136878182 16:33880969-33880991 CTCTCTAGAGATTTGTTGAATGG + Intergenic
1138618554 16:58192871-58192893 GTCTTGGTTGATTTGTAAAAAGG + Intronic
1139874871 16:70137697-70137719 CTCTTGAGTGATTTGTAGAATGG + Intronic
1140360915 16:74343445-74343467 CTCTTGAGTGATTTGTAGAATGG - Intergenic
1140567477 16:76060967-76060989 GTCTTGATTGAATAGTAGAAGGG + Intergenic
1203093843 16_KI270728v1_random:1234422-1234444 CTCTCTAGAGATTTGTTGAATGG - Intergenic
1143091816 17:4453338-4453360 CTCTTTACTGATCTGTAAAATGG - Intronic
1149298235 17:55280672-55280694 CTCTTGAGTGATGTGGAGGCAGG + Intronic
1151004490 17:70418178-70418200 CTCATGGCTTATTTGTAGAAAGG - Intergenic
1157344192 18:46809095-46809117 GTCTTGAGGAATTTGAAGAAAGG - Exonic
1157486684 18:48092627-48092649 CTCTTCTGTGGTTTCTAGAATGG - Intronic
1158763850 18:60423435-60423457 CTCTTCAATGATTTGTTTAATGG + Intergenic
1159269129 18:66126304-66126326 CTCCTCAGGGATTTGTGGAATGG - Intergenic
1159881333 18:73861156-73861178 CTCTTGAGTGAATTCCGGAAGGG + Intergenic
1159890870 18:73952013-73952035 CACTTGATTGGTTTGTATAAAGG + Intergenic
1162425728 19:10594261-10594283 CTCTTTAGTGGTGTGGAGAAGGG - Intergenic
1162622959 19:11859217-11859239 CCCTTGCGTGATATGTAAAAAGG + Intronic
1162645447 19:12046548-12046570 CTGTTGAGTGATTTGGAATATGG - Intronic
1163124166 19:15235614-15235636 CACTTTAGACATTTGTAGAAGGG - Exonic
1164215533 19:23142319-23142341 ATCTCAAGTGACTTGTAGAAAGG + Intronic
1164779186 19:30878995-30879017 CCCTTGAGTAATTTACAGAATGG - Intergenic
1166021287 19:40032354-40032376 CTCTTTAGTGTATTGTAGCATGG - Exonic
1167853999 19:52223511-52223533 GTCTTGCCTGATTTGTAGACAGG - Intronic
925290995 2:2748697-2748719 CCCTTGAGGGATTTGCTGAAAGG - Intergenic
926938178 2:18107099-18107121 CTGTTAAGTGATTTGCATAAAGG + Intronic
934605437 2:95691716-95691738 ATCTTGAATGATTTGTACAGAGG + Intergenic
935839300 2:107091684-107091706 ATGATGAGTCATTTGTAGAATGG - Intergenic
936538899 2:113334261-113334283 ATCTTGAATGATTTGTACAGAGG + Intergenic
936908176 2:117561725-117561747 TTCTTGAGTGATTAGATGAATGG + Intergenic
937004010 2:118495046-118495068 CTCCAGAGGCATTTGTAGAAAGG + Intergenic
938215778 2:129512555-129512577 CTCTTGACTTAGTGGTAGAAGGG - Intergenic
938791414 2:134679694-134679716 CTCTTTGGTCATTTGTAGAATGG - Intronic
938942765 2:136183377-136183399 CTCTTTAGAGATTCATAGAACGG + Intergenic
941557474 2:166999586-166999608 CCCTTGAATGAATTGTAAAAGGG - Intronic
943082632 2:183274519-183274541 CCCTTAATTGTTTTGTAGAAAGG + Intergenic
945964422 2:216170735-216170757 CTCTTGGGTGCTTAGGAGAAAGG + Intronic
946227685 2:218272923-218272945 TTATTGAGTGTTTAGTAGAAAGG + Intronic
948778689 2:240303817-240303839 CTGATCAGTGATTTTTAGAAAGG + Intergenic
1170041796 20:12046618-12046640 ACTTTGAGTGCTTTGTAGAAAGG + Intergenic
1170319366 20:15078328-15078350 CTCTTGAGTTCTTAGGAGAAGGG - Intronic
1174974871 20:55320440-55320462 CTTTTGAGTGATTTGCAAATAGG - Intergenic
1181881904 22:25987964-25987986 CTCTTTAGAGATTTGAAGCATGG - Intronic
951619328 3:24583619-24583641 CTCTACAAAGATTTGTAGAATGG - Intergenic
952400958 3:32963382-32963404 ATTTTGAGTTATTTTTAGAAAGG - Intergenic
952513290 3:34078458-34078480 CCATTGAGTGTTTTATAGAATGG - Intergenic
953804074 3:46052861-46052883 CCCTTGCGTGATATGTAAAAAGG + Intergenic
957172881 3:76761646-76761668 CTCTTAAGAGATTTGCAGAAAGG + Intronic
957436199 3:80180095-80180117 CTCTTAAGTGGTTAGTAGGAAGG + Intergenic
960167251 3:114417119-114417141 CTTTTCAGTGATGTGCAGAATGG + Intronic
960641653 3:119830285-119830307 TTCTTGAGTTATTTCTAAAAAGG - Intronic
962430071 3:135311005-135311027 CTCTTCAGAGATGTGGAGAAGGG - Intergenic
963170261 3:142243131-142243153 CTTTTGTGTAATTTGTTGAAAGG + Intergenic
963465053 3:145668964-145668986 GCCTTGATTGATTAGTAGAATGG + Intergenic
963712304 3:148760551-148760573 TTCTTGGGCTATTTGTAGAAAGG - Intergenic
966860284 3:184227963-184227985 CTCTTGGTTCATTTGTAGAAGGG + Intronic
971253526 4:24993061-24993083 CTGTTGATTCATTTGTAAAATGG + Intergenic
971313295 4:25545528-25545550 CTTTTGACTGATTGGTAGCATGG + Intergenic
971386919 4:26149295-26149317 CTCTTCAGTGATTTGTCAAGTGG + Intergenic
973338526 4:48980992-48981014 ATCTTGATTCCTTTGTAGAAGGG + Intergenic
974396027 4:61336512-61336534 CTCTTGACTGCTTTTTAGAGAGG - Intronic
977704536 4:100056371-100056393 CTTATGAGTGATTTGAAGATAGG + Intergenic
978213772 4:106172156-106172178 CTCTTGAGTTAAATGAAGAAAGG + Intronic
978474749 4:109113657-109113679 CACTGGAGTGATTCATAGAATGG - Intronic
978593082 4:110347349-110347371 TTCTTGAATGCTTTATAGAATGG + Intergenic
978863570 4:113480508-113480530 CCCTTGAGTGGTTATTAGAAGGG + Intronic
979070388 4:116196567-116196589 CTCTTTAGTTAATTGTATAATGG - Intergenic
980304587 4:131042052-131042074 GTTTTGAGGGATTGGTAGAAGGG + Intergenic
981558812 4:146024675-146024697 TTCTTCAGTGATTTGTACCATGG + Intergenic
982546138 4:156735580-156735602 CTCTTGAGTGATTTCTGAAAAGG - Intergenic
986894046 5:12344109-12344131 CTCTAGAGTGTTATATAGAAAGG - Intergenic
987592048 5:19942516-19942538 CCCTCCAGGGATTTGTAGAATGG - Intronic
990302908 5:54466560-54466582 CTCTTGAATGATATTTAGCAAGG + Intergenic
992025333 5:72664082-72664104 CTCTTGAATGATTTTTAAACTGG - Intergenic
993892664 5:93491859-93491881 CTCTTGACTGAATTGTACCACGG + Intergenic
996932944 5:128912619-128912641 CTCTTGTGTAATTTGTAAACTGG + Intronic
997492644 5:134291094-134291116 CTCTTGAGCAATTAGAAGAATGG + Intronic
999232699 5:150070901-150070923 CACTTCAGGGATTTGTAGCAGGG - Intronic
1000692975 5:164345699-164345721 CTCTCAAGAGATTTGCAGAATGG - Intergenic
1001320830 5:170680010-170680032 CTCTTGAATCACTTGTAGGAAGG - Intronic
1003692874 6:8372153-8372175 CAGGTGAGTGATTTGTAGGAAGG - Intergenic
1005630705 6:27704989-27705011 CTCTTGGCTGATTTGTAGATGGG + Intergenic
1006388159 6:33743607-33743629 CCCTTGAGTCATTTTTAGAATGG - Intronic
1011470784 6:87705408-87705430 TTCCTGAGTCATTGGTAGAAGGG - Intergenic
1013617630 6:111859480-111859502 ATGTTGAGAGATTTGAAGAAGGG - Intronic
1015437484 6:133206327-133206349 TTCTTGATTAATTTTTAGAAAGG - Intergenic
1015453788 6:133401767-133401789 CTCTAGAGTTATTTGTACAAAGG - Intronic
1015808675 6:137139961-137139983 CTCTTGTACGGTTTGTAGAACGG - Intergenic
1016210994 6:141532890-141532912 CTGTTGAATGATCTGTATAAAGG + Intergenic
1019981680 7:4626222-4626244 GTCTTGGGTGATTTGGTGAATGG + Intergenic
1022404727 7:30078084-30078106 CTCTTGAATGCTTTCTAGAAAGG - Intronic
1023769395 7:43541236-43541258 CTCAGGAGTGCCTTGTAGAAGGG - Exonic
1024830949 7:53456178-53456200 CTTCTGAGTGATTTATAGCATGG + Intergenic
1027172784 7:75884712-75884734 ATCCTGAGTGACTTGTAGATAGG + Intronic
1027718145 7:81700940-81700962 TTCTTGAGTGATTTTTATCAAGG - Exonic
1028550086 7:92050725-92050747 CTTAGGAGTCATTTGTAGAAAGG - Intronic
1031555954 7:123176544-123176566 CTATTTATTGATTTGTAGAAAGG - Intronic
1032452991 7:132050779-132050801 CTTTTGAGTGATTTTTATATAGG + Intergenic
1035423660 7:158751705-158751727 CTGTTGTGTTATTTGTAGAATGG - Intronic
1036508897 8:9382304-9382326 CACTTGAGTAATTTTCAGAAAGG - Intergenic
1037089627 8:14897850-14897872 TTCCTGAGTGATTGGTAGAAAGG - Intronic
1037697092 8:21233180-21233202 GTATTGAGTGATATGTAGAAGGG + Intergenic
1039160125 8:34608831-34608853 CTCTTGAATGATGTGAAAAAAGG + Intergenic
1039906007 8:41786929-41786951 GTGTTGAGTGATTCGTTGAAGGG - Intronic
1044020782 8:87103383-87103405 CTATTTAGTGACTTGTAAAATGG - Intronic
1044302061 8:90596163-90596185 CTCTTATATGATTTCTAGAATGG + Intergenic
1045334740 8:101189495-101189517 GACTGGAGTGATTTGTATAAAGG - Intronic
1046450625 8:114385873-114385895 CTTTTGATTGAATTGGAGAATGG + Intergenic
1046766074 8:118071681-118071703 CTTGTGAGATATTTGTAGAATGG - Intronic
1048383214 8:133886783-133886805 CTCTTGGGAGTTTTGGAGAATGG + Intergenic
1048612692 8:136041111-136041133 CTCTGGACTTATTTGTCGAATGG + Intergenic
1051129534 9:13844154-13844176 ATTTTGGGTGATTTGTGGAATGG - Intergenic
1051393775 9:16596126-16596148 CTTTTGACTAATTTGTAGAAAGG - Intronic
1051994404 9:23197503-23197525 CTCTTGAGTCATTTGAACACTGG + Intergenic
1052081977 9:24217505-24217527 CTCTAGAGTGAGTTGTCTAAGGG + Intergenic
1052093540 9:24357845-24357867 CTCTTTAGAGACTTGTTGAATGG - Intergenic
1055349109 9:75366797-75366819 CTCTTGAGAGATGTGCAGCATGG - Intergenic
1057390447 9:94638407-94638429 CTCAAAAGTGGTTTGTAGAATGG - Intronic
1057640894 9:96820305-96820327 TTCTTTTGTGATGTGTAGAATGG - Intronic
1059899214 9:118904177-118904199 CTCTTGACTTCTTTGTAGCAGGG - Intergenic
1060533272 9:124361910-124361932 CACTTAAGTGATTTTTAGATTGG + Intronic
1188585193 X:31765858-31765880 CTCTAGAGTGCTTTGTAACATGG + Intronic
1188922492 X:35994557-35994579 TTCTTAAGTGATTTGTTCAAGGG - Intergenic
1189752266 X:44234397-44234419 CTCCAGAGTGATTTGAATAATGG - Intronic
1193058362 X:77178308-77178330 CCCTTTAGTGATTAGTAGAAAGG - Intergenic
1193302778 X:79911557-79911579 GTCTTGAGGGAAGTGTAGAATGG - Intergenic
1196186236 X:112747811-112747833 CTCTTTACTCATCTGTAGAATGG + Intergenic
1196593942 X:117521568-117521590 CTCTTCTGTGATGTGAAGAACGG + Intergenic
1197387851 X:125822566-125822588 CTCTTTAGAGATTTGTTGAATGG - Intergenic
1199703597 X:150404855-150404877 CTATTCAGTAATTTGTAGAAAGG - Intronic
1202073374 Y:21015398-21015420 CTCATCTGGGATTTGTAGAATGG - Intergenic
1202078074 Y:21057252-21057274 CTCATCTGGGATTTGTAGAATGG - Intergenic