ID: 1139876849

View in Genome Browser
Species Human (GRCh38)
Location 16:70153016-70153038
Sequence AATCAGATGAAGACCATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 294}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139876849 Original CRISPR AATCAGATGAAGACCATGGA GGG Intronic
900791225 1:4682235-4682257 CACCATATGAAGACCATCGATGG - Intronic
900831312 1:4967659-4967681 AATCAGGTGAAGACCCTACAAGG + Intergenic
900833950 1:4985556-4985578 AGCCACAGGAAGACCATGGAAGG - Intergenic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903523259 1:23971985-23972007 AATCAGATGAAAGCCAAGGAAGG - Exonic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
905218988 1:36430976-36430998 AATTGGATGAAGATCAGGGAAGG + Intronic
905349414 1:37334421-37334443 AAACCGATGTAGACCCTGGAGGG + Intergenic
905391885 1:37641255-37641277 AATCAGATGAAGGCCATAAGAGG + Intergenic
905587161 1:39129578-39129600 AGTCAGAGTAAGACCAGGGATGG + Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909270104 1:73612753-73612775 ACTCAGCTGACGCCCATGGAGGG + Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
911101256 1:94097605-94097627 ATTCTGATGAAGACCATTGTAGG - Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
918421261 1:184366297-184366319 AATCAGAGGAAGAGCAAGGAAGG - Intergenic
918470377 1:184866714-184866736 AATCAGAAGAAAACCAGAGATGG + Intronic
919218693 1:194596210-194596232 TATCAGATGTAGAGCATGGTAGG - Intergenic
920452081 1:206067055-206067077 GATCTGCTGAAGTCCATGGAAGG + Intronic
920656817 1:207882837-207882859 AAGCCGTGGAAGACCATGGAAGG - Intergenic
920959903 1:210654980-210655002 AATCAGAGAAAGCCCATTGAAGG + Intronic
921025096 1:211271244-211271266 ACACAGATAAAGACAATGGAGGG + Exonic
922022725 1:221720396-221720418 AGTCAGATGAAGGAGATGGATGG - Intronic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922591926 1:226783877-226783899 AATCAGATGAAGAACATTATAGG - Intergenic
922956880 1:229610412-229610434 AATAAAATGAAGGCCAGGGAAGG + Intronic
923814989 1:237367686-237367708 GATCAGGGAAAGACCATGGAAGG - Intronic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064260633 10:13783134-13783156 AATCATAGAAAAACCATGGATGG - Intronic
1065962873 10:30748439-30748461 TTTCAGAGGAAGACCTTGGAAGG + Intergenic
1066479379 10:35780692-35780714 AAACAGATGAAGAAAATTGATGG + Intergenic
1067271773 10:44797686-44797708 AATCAGATGATGACAATGTGAGG + Intergenic
1068872425 10:61959625-61959647 AATCAGATGAATGCTATGAATGG - Intronic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069757270 10:70780980-70781002 AATCAGCTGGAGCCCTTGGAAGG - Intronic
1069957219 10:72059648-72059670 AAGCAGGTGAAGCTCATGGAAGG + Exonic
1071745198 10:88410594-88410616 ATTGAGATGAAAACCAGGGAAGG - Intronic
1071745353 10:88412496-88412518 ATTGAGATGAAAACCAGGGAAGG + Intronic
1071747140 10:88434980-88435002 AATCAGATGAAGACTAAGACTGG + Intronic
1071802236 10:89076649-89076671 AATCAGAGGAAGAATAAGGAAGG + Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1073231413 10:101974283-101974305 AATGAGATGAATTCCATGGAAGG + Intronic
1074346262 10:112689273-112689295 CATCTGATGAAGACAATGCATGG - Intronic
1075223960 10:120608679-120608701 AATCAGAGGCAAAACATGGAGGG + Intergenic
1075688634 10:124380533-124380555 AGTCAGAGGAGGACCATGGAGGG - Intergenic
1075821872 10:125321374-125321396 AGGCAGATGAAGACCATAGTGGG - Intergenic
1075881753 10:125858261-125858283 AAACAGATGAAGCCTAAGGAAGG - Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078752096 11:14175021-14175043 AATCAGAAGATAACCATGGGTGG + Intronic
1078815787 11:14821190-14821212 AAACTGAAGAAGCCCATGGAGGG - Intronic
1080825211 11:35842661-35842683 AAACAGATGTAGATCATGTAGGG + Intergenic
1081690564 11:45075056-45075078 AAGGACAAGAAGACCATGGAAGG + Intergenic
1084689694 11:70717871-70717893 AATCAGATGAAGAAGAAAGATGG + Intronic
1084962699 11:72725662-72725684 AATCAGAGGGAGAGCAGGGAGGG - Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1087020608 11:93598968-93598990 AATCAGAAGTATACCGTGGAAGG - Intergenic
1087200622 11:95341191-95341213 AAACAGATGAAGAGAAAGGAGGG - Intergenic
1087313489 11:96577876-96577898 ACTCAGCTGACGTCCATGGAGGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091033590 11:132213589-132213611 AATCAGAGTAAGACTATGAAGGG + Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1093420128 12:18965299-18965321 ACTCAGCTGATGCCCATGGAGGG - Intergenic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094644541 12:32309522-32309544 AATAAGATGAGGACCATTAAAGG + Intronic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1099440163 12:82688572-82688594 AATCAGATTAAGACACCGGAAGG - Intronic
1099918350 12:88924660-88924682 AACCAGAGAAAGACCATGGGAGG + Intergenic
1100095065 12:91023920-91023942 AATCAGTTGAAGGCCTTGAATGG - Intergenic
1100676856 12:96878088-96878110 ACTGCGATGAAGACCAGGGAGGG - Intergenic
1101077003 12:101140800-101140822 TAGCAGATGTAGAACATGGAAGG - Intergenic
1101607380 12:106257955-106257977 AATCAGTTGACACCCATGGAGGG + Intronic
1103150148 12:118630705-118630727 ACTGAGAAGAAGACCATGCATGG + Intergenic
1105795814 13:23851476-23851498 ACTCAGATGAAGACTATCAATGG + Intronic
1106052512 13:26204787-26204809 AATTAGATGAATACCATGCCAGG - Intronic
1106266659 13:28116555-28116577 ATTAAGATGCAGACCAGGGAGGG - Intergenic
1106545280 13:30725717-30725739 AATAAAATTAAGCCCATGGATGG - Intronic
1107732591 13:43363602-43363624 AAACAGATGAAGCCGATGTACGG - Intronic
1108093346 13:46874624-46874646 AAACAGATGCAAACAATGGAAGG + Intronic
1108242220 13:48476822-48476844 GATCAGATGAAGCAGATGGAAGG + Exonic
1108901286 13:55411268-55411290 AATCAGATTAACAGCATGGTTGG + Intergenic
1110916846 13:81031251-81031273 ACTCAGCTGATGCCCATGGAGGG - Intergenic
1111499817 13:89103517-89103539 AATGAGATGAAGAGAAAGGATGG + Intergenic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1115662724 14:35512830-35512852 AATGAGAAGGAGACCATGCAAGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116705910 14:48299682-48299704 AAACAGATGTAAACCAGGGAAGG + Intergenic
1117625262 14:57630180-57630202 AATCAGATGAAAGCCAAGGAAGG + Intronic
1118235619 14:64002029-64002051 AATGAGATGAAATCCCTGGATGG - Exonic
1119333925 14:73816589-73816611 AACCAGAAGATGACCTTGGAAGG + Intergenic
1119801838 14:77452488-77452510 AATCAGATGGGGACCAGGGATGG + Intronic
1120294409 14:82622358-82622380 AAACACAAGCAGACCATGGATGG - Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122980432 14:105189756-105189778 AAACAGCTGAAGTCCATCGATGG + Intergenic
1123150582 14:106177765-106177787 AAAAAGATGAAGAACAGGGATGG - Intergenic
1124085844 15:26549730-26549752 AATCAGATTGAGCCCATGGCAGG + Intronic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1127341669 15:58051885-58051907 AAGCTCATGAAAACCATGGAGGG - Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1128355175 15:66921351-66921373 TATCTCATGAAGGCCATGGAAGG + Intergenic
1130322963 15:82855490-82855512 AATCGTATGAAAGCCATGGACGG + Intronic
1131132104 15:89906782-89906804 AAGAAGAAGAAGATCATGGAGGG + Intronic
1132026363 15:98407511-98407533 GATGACATTAAGACCATGGATGG - Intergenic
1133365206 16:5203715-5203737 CATCAGAAGGAGACCGTGGAGGG + Intergenic
1134609633 16:15598073-15598095 CAACAGATGAAGAGCAGGGAGGG + Intronic
1135072746 16:19366445-19366467 AAACCGATGAAGACCTTAGATGG - Intergenic
1135144801 16:19951927-19951949 AATCAGAAGCTGTCCATGGAGGG - Intergenic
1135500447 16:22991375-22991397 AATGAGAGGAAGCCAATGGAGGG + Intergenic
1135815394 16:25627927-25627949 GTTCTGATGGAGACCATGGAAGG - Intergenic
1135846148 16:25920374-25920396 AATGAGTTGCAGATCATGGAGGG - Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137971906 16:52994002-52994024 AATCAGATGTAGATCTTAGATGG + Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139791541 16:69440947-69440969 AATCAAATGAAGGCCAGGCACGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1139876849 16:70153016-70153038 AATCAGATGAAGACCATGGAGGG + Intronic
1140571248 16:76108643-76108665 AATCAGATGAAGGCCTTCAAAGG + Intergenic
1140647348 16:77047166-77047188 CATCAGAAGAAGAAAATGGAAGG + Intergenic
1141761834 16:86033619-86033641 AACGAGAGGAAGGCCATGGATGG - Intergenic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1144319377 17:14099322-14099344 AATCAAATGAATACTATGGCTGG - Intronic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146874909 17:36401679-36401701 AATCAGAAGAAAACCATGGCTGG - Intronic
1147064479 17:37911200-37911222 AATCAGAAGAAAACCATGGCTGG + Intergenic
1149278229 17:55069774-55069796 AATTAAATGAAGACTCTGGATGG - Intronic
1149411230 17:56409417-56409439 AAGCATAAGAAGACCCTGGAAGG + Intronic
1150871468 17:68916632-68916654 AATAAAATGAAGAGGATGGATGG + Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1153517234 18:5915182-5915204 ATTAAGATGAAGACCATTGTCGG - Intergenic
1155894640 18:31309731-31309753 ATTCAGATGAAGACCATCAATGG - Intergenic
1156074345 18:33255290-33255312 AAACAGACTAAGATCATGGAAGG + Intronic
1156442965 18:37210110-37210132 CATCAGCTGCAGTCCATGGATGG + Intronic
1156911767 18:42419134-42419156 AAGCAGATGAAGCCCATTCAAGG + Intergenic
1156941696 18:42775320-42775342 AATCATAAGAAAACCATGAAGGG + Intronic
1157245107 18:46046745-46046767 AATGAAATGCAAACCATGGAGGG - Intronic
1159249558 18:65856604-65856626 AAGAAGATGAAGAACATGAAAGG + Intronic
1159408063 18:68032513-68032535 AATCATATAAAGAACATGTAAGG - Intergenic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1163350697 19:16774811-16774833 GATCAGATGAAGAAAATGGAAGG - Intronic
1164603534 19:29579627-29579649 GAGCAGATGGAGACCAGGGAGGG - Intergenic
1164772906 19:30825861-30825883 ACTCAGGTGAAGACCATAGCTGG + Intergenic
1165697898 19:37914969-37914991 ATGCAGGTGAAGAGCATGGAGGG - Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168542628 19:57225748-57225770 ATGCAGATGAAGACCAGGCACGG - Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
927800211 2:26091879-26091901 GATCAGATGAGGACCAGGCATGG + Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
930024926 2:47024114-47024136 TGGCAGATGAAGACCAAGGAAGG - Intronic
930450094 2:51525054-51525076 AATCAGAAGAACAAGATGGAAGG - Intergenic
930630648 2:53750902-53750924 ATTAAGATGAAGACCTTTGAAGG - Exonic
930822259 2:55658387-55658409 ATTGGGATGAAGAACATGGAGGG + Intronic
933415998 2:81986478-81986500 AATCAGATGACGGACGTGGAGGG - Intergenic
935041601 2:99434711-99434733 AATCAAACAAAAACCATGGAAGG - Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
939282457 2:140081805-140081827 AATCAGATCAAGAAAATAGATGG + Intergenic
939617687 2:144379090-144379112 TATCAGATGAAGAGAAAGGAAGG - Intergenic
940051310 2:149467943-149467965 CAACAGATGAAGACCATGATGGG - Intronic
940329108 2:152455332-152455354 AATCAGATGAAGTCCTTTTAGGG + Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
943599217 2:189893532-189893554 AAGCAGGTGCAGCCCATGGAGGG - Intronic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
944005270 2:194897035-194897057 ACTCAGCTGATGCCCATGGAGGG - Intergenic
944681088 2:202077326-202077348 AAGCATCTGAAGACGATGGAAGG - Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945754560 2:213830229-213830251 ACTCAGTTGATGTCCATGGAGGG - Intronic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
948000288 2:234562189-234562211 CATCAGGGGGAGACCATGGAAGG - Intergenic
948680685 2:239632560-239632582 AATCTGATGAAGACATTGTAAGG + Intergenic
1169052001 20:2587206-2587228 AATGAGAAGAAGACAATGGCAGG - Intronic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169604643 20:7302910-7302932 AATAAGATGAAAAGCATGCAAGG - Intergenic
1169647661 20:7832025-7832047 AATCAAATGAAAGCCAAGGAAGG - Intergenic
1170998539 20:21390999-21391021 AAAGAGATGAAGACTAAGGATGG - Intergenic
1172518962 20:35555081-35555103 TACCAGATGGAAACCATGGAGGG + Intronic
1173979391 20:47211491-47211513 AATCAGAATAAGACCTAGGATGG + Intronic
1175303448 20:57959412-57959434 AATCAGATGAATTCCAAGCAAGG + Intergenic
1179269365 21:39838606-39838628 AGTCAGGTGAAGACCCTGGGAGG + Intergenic
1179389772 21:40977144-40977166 AATCAGAAGAAAACAATGCAGGG - Intergenic
1179907484 21:44431432-44431454 AATCAAATGAAGACTATGCTGGG - Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182385100 22:29931799-29931821 AAGCAGATTAAGACCATTGGAGG + Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1183247883 22:36708038-36708060 AAGCACCTGGAGACCATGGAGGG + Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
951877967 3:27448667-27448689 AATCAGATAAAGAAGATGGACGG - Exonic
952437755 3:33289015-33289037 GCTGAGATGAAGACCATGGAAGG + Intronic
952552974 3:34499943-34499965 AATCAGATGAGTATAATGGAAGG + Intergenic
953176704 3:40560076-40560098 AATCAGAAGCTGTCCATGGAGGG + Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
955084397 3:55688582-55688604 AAGCTGTTGAAGACCATGGTTGG + Intronic
956684264 3:71809769-71809791 AATCAGATGAAGAGCTCAGACGG + Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960677441 3:120209924-120209946 AAACAAATGAAGACTATGGTTGG + Intronic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961039287 3:123665943-123665965 AACCAGATGAGGGACATGGATGG + Intronic
963287748 3:143452073-143452095 AATCAGATGATGATTATTGATGG + Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964653042 3:159033263-159033285 AATAAGATCATGTCCATGGATGG - Intronic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967042786 3:185709020-185709042 AATGAGTTGAGGACCATGTAAGG - Intronic
967608842 3:191481133-191481155 ACTCAGCTGGAGCCCATGGAGGG + Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
969104839 4:4797885-4797907 GATCAGATGAAGACTCAGGAGGG - Intergenic
969906538 4:10401845-10401867 ATCCAGAGCAAGACCATGGAGGG + Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
972702746 4:41509717-41509739 AAACAGATGGAGAACATGGAAGG + Intronic
972801706 4:42482595-42482617 ATTCAGCTGAAGACTCTGGAGGG + Intronic
974642843 4:64654096-64654118 TATCACAAGAAGAGCATGGAGGG - Intergenic
975162326 4:71138361-71138383 AATCAAATGACGATCATGGTTGG + Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
975791562 4:77958481-77958503 AATCAGATGAAAGCAAAGGAAGG - Intergenic
976381770 4:84407681-84407703 AATCAGATGATGATGAGGGAGGG + Intergenic
977808460 4:101331638-101331660 AAGCAAATGAAAAGCATGGAAGG + Intronic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978831387 4:113089534-113089556 AAGCAGATGAAGGCCAGGCATGG + Intronic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979578671 4:122328306-122328328 AAAAAGATGAAGACCATGAGAGG + Exonic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982555946 4:156864940-156864962 AATCTGATGAAAGCTATGGATGG + Intronic
982665959 4:158264003-158264025 AAACAGCTAAAGACCATGAAAGG + Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
987505849 5:18770814-18770836 AATCAAATTAAGACCATGGATGG - Intergenic
988336914 5:29919728-29919750 CATCTTAGGAAGACCATGGATGG - Intergenic
989254607 5:39352633-39352655 AAAGAGATGAAGAGAATGGATGG - Intronic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
992818050 5:80464406-80464428 TATCAGAAGAACAGCATGGAGGG + Intronic
993852669 5:93030808-93030830 AAACAGATGAAGGAGATGGAAGG - Intergenic
1000479201 5:161750790-161750812 AATCATATGAAAAGCATGGTTGG - Intergenic
1001120663 5:168977388-168977410 AAGAAGATGAAGACAATGGTAGG - Intronic
1001295969 5:170499244-170499266 AAACAGATGAAGAGCAAAGATGG + Intronic
1001717208 5:173825941-173825963 AATCACATGAAGACCACGATTGG - Intergenic
1006150631 6:31985394-31985416 AAACAGATTAAGACCATTAAAGG - Intronic
1006156932 6:32018132-32018154 AAACAGATTAAGACCATTAAAGG - Intronic
1006377371 6:33678952-33678974 ACTCAGCTGCTGACCATGGAGGG + Intronic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1008830964 6:55761384-55761406 AATGATATGAAGACCATAGAGGG - Intronic
1009802443 6:68556501-68556523 AAATAGATGAAGACTATGGAGGG + Intergenic
1010823176 6:80440397-80440419 AATCACAGGAAGAGAATGGATGG + Intergenic
1011633658 6:89351353-89351375 AATCTGATGAAGACCTGGCACGG - Intronic
1012083513 6:94792142-94792164 AATCAGGAGAACATCATGGAAGG + Intergenic
1012807287 6:103910188-103910210 AATCAGTTGAAGACCTTAGTAGG - Intergenic
1013081185 6:106814780-106814802 AATCAGAAGCTGTCCATGGAGGG - Intergenic
1017686818 6:156922107-156922129 ACTTAGATGAATACCATGGGGGG - Intronic
1019383832 7:742119-742141 AAACAGATGAAGCCCAAGGTGGG - Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1021392430 7:20109891-20109913 TCTCAGATGGATACCATGGATGG + Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1023680336 7:42679345-42679367 AATCAGATAAAGAACACAGAAGG + Intergenic
1024381492 7:48702046-48702068 TATCATATGATGCCCATGGAAGG - Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1028864404 7:95691239-95691261 GAACAGATGCAGTCCATGGAAGG + Intergenic
1029154384 7:98504793-98504815 AAACAGATGAAGACTCTGAATGG + Intergenic
1029289243 7:99489369-99489391 AGTCAGATGAAGCCCACAGAAGG - Intronic
1032655726 7:133927754-133927776 AATGAGATGAAGGTCATAGATGG + Intronic
1033164385 7:139027058-139027080 AACCAGATGAAGACAATGACAGG + Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033550804 7:142445693-142445715 ACTCAGAAAAAGACCATGAATGG + Intergenic
1034571598 7:151960577-151960599 AATCAGAGGAAGAGCCTAGATGG + Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035555421 8:564012-564034 GTGCAGGTGAAGACCATGGACGG + Intergenic
1036914485 8:12791999-12792021 AATCAGATGAAGCAGATGGGAGG + Intergenic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1039166751 8:34689452-34689474 TACCAGATGAACACCATGGTGGG - Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040693180 8:49964224-49964246 AATCAGTTGAAGACCTTGGAAGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1040873447 8:52124827-52124849 CAGCAGATGAAGGCCTTGGAAGG + Intronic
1041061554 8:54039709-54039731 AATTAGAAAAAGAACATGGAGGG - Intergenic
1043871757 8:85440427-85440449 AATCAGATGAACCCCACTGAAGG - Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1046619897 8:116517972-116517994 AGTGAGATGAAGTCCATGGAAGG + Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1047001232 8:120574802-120574824 AATGAGATGGAGACCCAGGAAGG + Intronic
1048410228 8:134164710-134164732 ACCCAGAAGAAGACCATGGCTGG - Intergenic
1048765536 8:137840260-137840282 TATCAGAAGAAGACCACGAAAGG + Intergenic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1050698969 9:8315280-8315302 AATCAGAAGAAGAAAATGAATGG - Exonic
1055035551 9:71814480-71814502 AATCACATTAAGACCATGGGAGG - Intronic
1055633351 9:78247580-78247602 AATGAGCTGAAAACCATGGGAGG + Intronic
1057899914 9:98940525-98940547 AGGCAGATGAAGAACAGGGAGGG - Intergenic
1058510226 9:105710477-105710499 AATCAGATGAAAGCCAAGGAAGG - Intronic
1058639147 9:107066133-107066155 AATCAGATGATGACAATTGCTGG + Intergenic
1186527628 X:10264025-10264047 AATCACATGGAGACTATTGATGG - Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189173976 X:38935566-38935588 AGTCAGATGTGGACCTTGGAAGG - Intergenic
1189393208 X:40595518-40595540 AATCAAATGAACACCAATGAAGG - Intronic
1189615215 X:42776268-42776290 AAGCAGATGAAAACATTGGAGGG - Intergenic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190136330 X:47802628-47802650 AATCAGAAGCTGTCCATGGAAGG + Intergenic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1190948105 X:55115496-55115518 CAACAGATGAAAACCATGGTGGG + Intronic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1193366822 X:80644281-80644303 ACTCAGATGGTGTCCATGGAGGG - Intergenic
1194860852 X:98997701-98997723 AACCAGAGGAAAATCATGGATGG - Intergenic
1197041170 X:121937689-121937711 ATTCATATTAAGAACATGGAAGG - Intergenic
1199721258 X:150544160-150544182 CTTCAGATGAATGCCATGGATGG + Intergenic
1199904197 X:152207673-152207695 AAGCAGATGAAGGCCATGGTGGG - Intronic