ID: 1139877858

View in Genome Browser
Species Human (GRCh38)
Location 16:70160766-70160788
Sequence CTCCCTTGCCACCGTCTTGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 110}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139877853_1139877858 9 Left 1139877853 16:70160734-70160756 CCTGCCGTTGCATGCATTTGAAA 0: 1
1: 0
2: 0
3: 3
4: 99
Right 1139877858 16:70160766-70160788 CTCCCTTGCCACCGTCTTGGTGG 0: 1
1: 0
2: 2
3: 12
4: 110
1139877851_1139877858 29 Left 1139877851 16:70160714-70160736 CCAGCTTCCACAGTATATTACCT 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1139877858 16:70160766-70160788 CTCCCTTGCCACCGTCTTGGTGG 0: 1
1: 0
2: 2
3: 12
4: 110
1139877854_1139877858 5 Left 1139877854 16:70160738-70160760 CCGTTGCATGCATTTGAAAGTTA 0: 1
1: 0
2: 2
3: 17
4: 254
Right 1139877858 16:70160766-70160788 CTCCCTTGCCACCGTCTTGGTGG 0: 1
1: 0
2: 2
3: 12
4: 110
1139877852_1139877858 22 Left 1139877852 16:70160721-70160743 CCACAGTATATTACCTGCCGTTG 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1139877858 16:70160766-70160788 CTCCCTTGCCACCGTCTTGGTGG 0: 1
1: 0
2: 2
3: 12
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139877858 Original CRISPR CTCCCTTGCCACCGTCTTGG TGG Exonic