ID: 1139877858

View in Genome Browser
Species Human (GRCh38)
Location 16:70160766-70160788
Sequence CTCCCTTGCCACCGTCTTGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 110}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139877852_1139877858 22 Left 1139877852 16:70160721-70160743 CCACAGTATATTACCTGCCGTTG 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1139877858 16:70160766-70160788 CTCCCTTGCCACCGTCTTGGTGG 0: 1
1: 0
2: 2
3: 12
4: 110
1139877853_1139877858 9 Left 1139877853 16:70160734-70160756 CCTGCCGTTGCATGCATTTGAAA 0: 1
1: 0
2: 0
3: 3
4: 99
Right 1139877858 16:70160766-70160788 CTCCCTTGCCACCGTCTTGGTGG 0: 1
1: 0
2: 2
3: 12
4: 110
1139877851_1139877858 29 Left 1139877851 16:70160714-70160736 CCAGCTTCCACAGTATATTACCT 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1139877858 16:70160766-70160788 CTCCCTTGCCACCGTCTTGGTGG 0: 1
1: 0
2: 2
3: 12
4: 110
1139877854_1139877858 5 Left 1139877854 16:70160738-70160760 CCGTTGCATGCATTTGAAAGTTA 0: 1
1: 0
2: 2
3: 17
4: 254
Right 1139877858 16:70160766-70160788 CTCCCTTGCCACCGTCTTGGTGG 0: 1
1: 0
2: 2
3: 12
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139877858 Original CRISPR CTCCCTTGCCACCGTCTTGG TGG Exonic
900422194 1:2560465-2560487 CTCCCTGTCCAGAGTCTTGGAGG - Intronic
904276875 1:29390656-29390678 CTCCCTGACCCCCGTCTTGCAGG + Intergenic
907944304 1:59119968-59119990 CTCCCTGGTCACTGTCTTAGTGG + Intergenic
908250862 1:62264587-62264609 CTCCCTTGCCCCCATCTTAGAGG - Intronic
914515076 1:148367442-148367464 GTCCCTTCCAACAGTCTTGGGGG + Intergenic
919257233 1:195140432-195140454 CTCCAATACCACCTTCTTGGTGG + Intergenic
919540105 1:198835312-198835334 CTTCCTTGCCTCCCTCATGGGGG - Intergenic
921328449 1:214011375-214011397 CTCTCTTGCCACCATTTTGGTGG + Intronic
922056276 1:222045372-222045394 CTCCCATGCCACACTCTTTGAGG - Intergenic
923216888 1:231856779-231856801 CTCCCCTGCCACCACCTTTGGGG - Intronic
1068938314 10:62657443-62657465 CTCCCTCCCCACCAACTTGGTGG - Intronic
1069703450 10:70442161-70442183 CTCCCTGGCCACTGTCTAGATGG + Intronic
1072790025 10:98311231-98311253 CTCCCTTGCCAGGCTCTGGGGGG + Intergenic
1075188885 10:120287817-120287839 CTCCTTTCCCACCCTCTTGGGGG - Intergenic
1075472050 10:122698478-122698500 CTCCATTGTCAGCGTCTAGGTGG - Exonic
1077102366 11:827863-827885 CTCCCTTCCCACCTCCTTGCAGG - Intronic
1077286053 11:1766479-1766501 CTCAGATGCCACCTTCTTGGAGG - Intergenic
1081969866 11:47190471-47190493 TTCCCTTGACATCGTCTTGGAGG - Intergenic
1083896071 11:65620449-65620471 CTCCCAAGCCATTGTCTTGGTGG + Intronic
1084595066 11:70111972-70111994 CACCCGTGCCCCCGTTTTGGTGG - Intronic
1084693054 11:70738058-70738080 AGCTCTTGCCACCGTCTTGCGGG - Intronic
1085767489 11:79295719-79295741 CTCCCTTGCCCTCTTCTTTGGGG - Intronic
1089763722 11:120748114-120748136 CTCCCCAGCCAAGGTCTTGGTGG - Intronic
1091964290 12:4724844-4724866 CTCCCCTGCTTCCCTCTTGGGGG + Intronic
1092282386 12:7108205-7108227 CTCCCTGGCCACAGTCCTGGCGG + Intronic
1093990447 12:25584017-25584039 CTCCATTGCCACCATTCTGGAGG - Intronic
1104293464 12:127490391-127490413 CTTCCCTGCCCCAGTCTTGGTGG + Intergenic
1113448442 13:110388213-110388235 CTCGCTTGCCGCCGTCCTGGAGG - Intronic
1113698749 13:112366951-112366973 CTCCCTTGTCACCATCCTGGTGG - Intergenic
1114522684 14:23348803-23348825 CTCCCTTGCTAACCTCTGGGTGG + Intronic
1119323533 14:73745380-73745402 GTCCCTGGCCACTGTCTAGGTGG - Intronic
1119893077 14:78197615-78197637 CTCCCTTGCTTCCTTCCTGGTGG + Intergenic
1121794542 14:96724262-96724284 CTCTCTTGCCAAGGTTTTGGGGG - Intergenic
1122263767 14:100537475-100537497 CTCCCTTGTCACTGGCTTGCGGG + Exonic
1123493395 15:20800056-20800078 CTCCCGTGCCATAGTCTAGGGGG - Intergenic
1123549904 15:21369158-21369180 CTCCCGTGCCATAGTCTAGGGGG - Intergenic
1128582721 15:68820327-68820349 CTCCCGTGACTCCGTCTGGGGGG - Intronic
1202958233 15_KI270727v1_random:96376-96398 CTCCCGTGCCATAGTCTAGGGGG - Intergenic
1132538663 16:496841-496863 CTACCTTGCCACCTTCTTGCTGG - Exonic
1132775289 16:1590310-1590332 CTCCTCTGCCCCTGTCTTGGAGG + Intronic
1133170096 16:3977525-3977547 CTCCCTCGCCACCGTCGTGGGGG - Exonic
1133898756 16:9953505-9953527 CTGCCTATCCACCTTCTTGGTGG - Intronic
1134785666 16:16940529-16940551 CTCCCTGGCCGCCATCTTGTAGG - Intergenic
1136690557 16:32025217-32025239 CTTCCTGGCCACTGTTTTGGCGG - Intergenic
1136791146 16:32968779-32968801 CTTCCTGGCCACTGTTTTGGTGG - Intergenic
1136878668 16:33885153-33885175 CTTCCTGGCCACTGTTTTGGTGG + Intergenic
1138532302 16:57641043-57641065 GTCCCTTGCTACCAGCTTGGAGG + Intronic
1139877858 16:70160766-70160788 CTCCCTTGCCACCGTCTTGGTGG + Exonic
1140779967 16:78286000-78286022 CTCTTTTGCCACCTTTTTGGGGG + Intronic
1203093355 16_KI270728v1_random:1230240-1230262 CTTCCTGGCCACTGTTTTGGTGG - Intergenic
1142600351 17:1050796-1050818 CTCCCCTGCCCCCTTCTTAGGGG + Intronic
1142996945 17:3766114-3766136 CGCCCATGCCACCGTTTTCGGGG - Intronic
1143090093 17:4444978-4445000 CTGCCCTGCCACGGTCGTGGGGG + Intronic
1143572228 17:7766554-7766576 CTCCCTTCCCACTGCCTTTGTGG - Intronic
1144955692 17:19017818-19017840 CTCCCATGCCACCATCAGGGTGG - Intronic
1147153419 17:38531353-38531375 CTCCCTGGCCACTGTTTTGGCGG - Exonic
1149636128 17:58170827-58170849 CTTCCTTTTCACCTTCTTGGTGG + Intergenic
1150867630 17:68870379-68870401 CTCCCCTGCCACTGTGTTTGGGG + Intronic
1154450947 18:14474594-14474616 CTCCCGTGCCATAGTCTAGGGGG - Intergenic
1156368028 18:36447507-36447529 CAGCCTTGCCACCCTATTGGGGG - Intronic
1157904572 18:51558111-51558133 CTCAATTGCCACCCTATTGGGGG + Intergenic
1158643373 18:59221222-59221244 CTCTCTAGGCACCGGCTTGGAGG + Intronic
1160612513 18:80099524-80099546 CTCTCCTGCCACCATATTGGAGG - Intergenic
1161876308 19:6913727-6913749 CTCCCTGGCCACAGTCTTCCTGG + Exonic
1165578129 19:36838839-36838861 CTCGCTTGGCACAGTCTTGTAGG - Intronic
1166339251 19:42127766-42127788 TTCCCTTGTCACTGTCTTAGAGG + Intronic
925082325 2:1080081-1080103 CCCCCTCGCCACCGCCCTGGGGG - Intronic
925171664 2:1754029-1754051 CTCCCCTGCTGCCGTCGTGGGGG - Intergenic
927197545 2:20558783-20558805 CTCCCCTCCCACAGGCTTGGAGG - Intergenic
927459055 2:23281900-23281922 CGCCAGTGCCACCATCTTGGTGG + Intergenic
928211673 2:29328371-29328393 CTCCCTGGGCACAGTCCTGGTGG + Exonic
932308514 2:70720899-70720921 CTCCCTTGCCTCCCTGCTGGAGG + Intronic
933652745 2:84862363-84862385 CTTCCTTGACACCTGCTTGGTGG - Intronic
934912427 2:98271904-98271926 CTCCCTTGCAGCAGTGTTGGAGG + Intronic
936050407 2:109218283-109218305 CTCTCTTGCCCCCGTTTTTGTGG + Intronic
936086365 2:109472273-109472295 CTCTCCTGCCACCGTCTTCCTGG - Intronic
938480503 2:131658289-131658311 CTCCCATGCCATAGTCTAGGGGG + Intergenic
939078428 2:137630373-137630395 CTGCCTTGGCACAGTCTTGAGGG - Intronic
942224692 2:173804938-173804960 CTCCCTGGCCACTGTGTTGAAGG - Intergenic
945041073 2:205744428-205744450 CTCCCTTGCCTCAGTCTGAGAGG - Intronic
946629670 2:221653426-221653448 CTCCCTTGACAGCTTATTGGGGG - Intergenic
1174520960 20:51130342-51130364 CTGCCATGCCACCCTCTTGCAGG - Intergenic
1176209852 20:63914009-63914031 CTGCCCAGCCACCATCTTGGGGG + Intronic
1176308733 21:5138325-5138347 CTGTCTTTCCACCGTTTTGGTGG - Intronic
1176445290 21:6815979-6816001 CTCCCGTGCCATAGTCTAGGGGG + Intergenic
1176823457 21:13681012-13681034 CTCCCGTGCCATAGTCTAGGGGG + Intergenic
1179262210 21:39767747-39767769 CTCACTTGCCAGCATCTGGGTGG - Intronic
1179848326 21:44123707-44123729 CTGTCTTTCCACCGTTTTGGTGG + Intronic
1180993679 22:19953866-19953888 CTGCCTTGGCACCTGCTTGGAGG - Intronic
1184221975 22:43106687-43106709 CTGCATTGCCACTGTCTTGAAGG + Intergenic
955596238 3:60593817-60593839 CTCCCCTGCCACATGCTTGGTGG + Intronic
959582183 3:107993209-107993231 CTCTCCTGCCACCCTATTGGGGG - Intergenic
968137005 3:196227020-196227042 CTCCATTGCCATCTTCCTGGAGG + Exonic
987463995 5:18250825-18250847 CACCCTTGCCACCATCTTCCCGG + Intergenic
989183617 5:38602052-38602074 CTCCATTGCCAATTTCTTGGCGG + Intronic
989576471 5:42992706-42992728 CTCCCCTGTCACCGGCTTGGAGG - Intergenic
990798858 5:59576288-59576310 AGCCCTTGCCACAGACTTGGGGG + Intronic
991499268 5:67259909-67259931 CTCCATTGCCACCACCCTGGTGG - Intergenic
1000327971 5:160186749-160186771 CTCTTTTGCCAGCTTCTTGGAGG - Intergenic
1001098302 5:168793477-168793499 CTCTATTGCCATCCTCTTGGGGG + Intronic
1006297044 6:33174299-33174321 CTCCCTGGCCACTGCCTTTGTGG - Intronic
1006575239 6:35040383-35040405 CTCCATTTCCACTGACTTGGTGG + Intronic
1007217257 6:40250031-40250053 CTCTCTTGCCACCCTCCTGCTGG + Intergenic
1019723307 7:2586735-2586757 CTCAGCTGTCACCGTCTTGGGGG - Intronic
1020006118 7:4784539-4784561 CTCCCTGGCCAGCATCTTTGGGG + Intronic
1029576905 7:101409510-101409532 CTGCCATGCCACCGACTGGGTGG + Intronic
1031484996 7:122315116-122315138 CTCCCATGCCACCGACGTGCTGG + Intergenic
1034011784 7:147536455-147536477 CTCCCTTCCAACAGTTTTGGGGG + Intronic
1034859910 7:154586123-154586145 CCTCGTTGCCACCGTCTTGGAGG + Intronic
1035755401 8:2027196-2027218 GCCCCTTGCCACCTTCTTGCAGG - Intergenic
1037766899 8:21777742-21777764 GTCCCTTTTCACTGTCTTGGGGG - Intronic
1037908516 8:22729423-22729445 CTCCCTTGCCTCACTCTGGGTGG - Intronic
1043395309 8:79829644-79829666 CTCCCCTGCCCCCCTCTGGGGGG + Intergenic
1049202256 8:141346078-141346100 CTCCCTTGCCACCGGCTTTGGGG + Intergenic
1049726940 8:144151275-144151297 CTGCCTTGCTAGCATCTTGGAGG - Intronic
1051408111 9:16760743-16760765 TTCCCTTGCCACCTTCTCTGTGG - Intronic
1052123588 9:24748898-24748920 CTCCCTTTGCACCTTCTTTGTGG - Intergenic
1052651986 9:31316283-31316305 CTGCCTTCCCACCACCTTGGTGG + Intergenic
1052739456 9:32379544-32379566 CTCCCTTGCCCCATCCTTGGTGG - Intergenic
1056735379 9:89205211-89205233 CTCCCTTGCCACTGTTTTTGGGG + Intergenic
1060222345 9:121771428-121771450 CTGCCCTGCCACCACCTTGGGGG - Intronic
1203523905 Un_GL000213v1:68546-68568 CTCCCGTGCCATAGTCTAGGGGG - Intergenic
1190287816 X:48972218-48972240 CTGCCTTTCCACAGTCTGGGGGG - Intergenic
1194584817 X:95719193-95719215 GTCCCTTGCCATGGTGTTGGAGG + Intergenic
1200229036 X:154434907-154434929 CCCCCTTGCCACCAGCATGGGGG - Intronic