ID: 1139878386

View in Genome Browser
Species Human (GRCh38)
Location 16:70164468-70164490
Sequence CCATGTGAGGTGTTGGAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139878386_1139878394 24 Left 1139878386 16:70164468-70164490 CCAAACTCCAACACCTCACATGG No data
Right 1139878394 16:70164515-70164537 AATGAATGGGCAAAAAGTGGAGG No data
1139878386_1139878393 21 Left 1139878386 16:70164468-70164490 CCAAACTCCAACACCTCACATGG No data
Right 1139878393 16:70164512-70164534 TTAAATGAATGGGCAAAAAGTGG No data
1139878386_1139878395 25 Left 1139878386 16:70164468-70164490 CCAAACTCCAACACCTCACATGG No data
Right 1139878395 16:70164516-70164538 ATGAATGGGCAAAAAGTGGAGGG No data
1139878386_1139878392 11 Left 1139878386 16:70164468-70164490 CCAAACTCCAACACCTCACATGG No data
Right 1139878392 16:70164502-70164524 TAACAGATGATTAAATGAATGGG No data
1139878386_1139878391 10 Left 1139878386 16:70164468-70164490 CCAAACTCCAACACCTCACATGG No data
Right 1139878391 16:70164501-70164523 TTAACAGATGATTAAATGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139878386 Original CRISPR CCATGTGAGGTGTTGGAGTT TGG (reversed) Intergenic
No off target data available for this crispr