ID: 1139878390

View in Genome Browser
Species Human (GRCh38)
Location 16:70164481-70164503
Sequence TAAACACCAAACACCATGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139878390_1139878393 8 Left 1139878390 16:70164481-70164503 CCTCACATGGTGTTTGGTGTTTA No data
Right 1139878393 16:70164512-70164534 TTAAATGAATGGGCAAAAAGTGG No data
1139878390_1139878391 -3 Left 1139878390 16:70164481-70164503 CCTCACATGGTGTTTGGTGTTTA No data
Right 1139878391 16:70164501-70164523 TTAACAGATGATTAAATGAATGG No data
1139878390_1139878392 -2 Left 1139878390 16:70164481-70164503 CCTCACATGGTGTTTGGTGTTTA No data
Right 1139878392 16:70164502-70164524 TAACAGATGATTAAATGAATGGG No data
1139878390_1139878395 12 Left 1139878390 16:70164481-70164503 CCTCACATGGTGTTTGGTGTTTA No data
Right 1139878395 16:70164516-70164538 ATGAATGGGCAAAAAGTGGAGGG No data
1139878390_1139878394 11 Left 1139878390 16:70164481-70164503 CCTCACATGGTGTTTGGTGTTTA No data
Right 1139878394 16:70164515-70164537 AATGAATGGGCAAAAAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139878390 Original CRISPR TAAACACCAAACACCATGTG AGG (reversed) Intergenic
No off target data available for this crispr