ID: 1139878395

View in Genome Browser
Species Human (GRCh38)
Location 16:70164516-70164538
Sequence ATGAATGGGCAAAAAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139878388_1139878395 18 Left 1139878388 16:70164475-70164497 CCAACACCTCACATGGTGTTTGG No data
Right 1139878395 16:70164516-70164538 ATGAATGGGCAAAAAGTGGAGGG No data
1139878385_1139878395 26 Left 1139878385 16:70164467-70164489 CCCAAACTCCAACACCTCACATG No data
Right 1139878395 16:70164516-70164538 ATGAATGGGCAAAAAGTGGAGGG No data
1139878390_1139878395 12 Left 1139878390 16:70164481-70164503 CCTCACATGGTGTTTGGTGTTTA No data
Right 1139878395 16:70164516-70164538 ATGAATGGGCAAAAAGTGGAGGG No data
1139878386_1139878395 25 Left 1139878386 16:70164468-70164490 CCAAACTCCAACACCTCACATGG No data
Right 1139878395 16:70164516-70164538 ATGAATGGGCAAAAAGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139878395 Original CRISPR ATGAATGGGCAAAAAGTGGA GGG Intergenic
No off target data available for this crispr