ID: 1139880000

View in Genome Browser
Species Human (GRCh38)
Location 16:70174572-70174594
Sequence CTGGGGAGGAAGGAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3262
Summary {0: 3, 1: 0, 2: 45, 3: 416, 4: 2798}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139879984_1139880000 17 Left 1139879984 16:70174532-70174554 CCCTGGGACAGCCCGGGGGCGGT 0: 3
1: 0
2: 2
3: 11
4: 135
Right 1139880000 16:70174572-70174594 CTGGGGAGGAAGGAGGAGGAAGG 0: 3
1: 0
2: 45
3: 416
4: 2798
1139879990_1139880000 6 Left 1139879990 16:70174543-70174565 CCCGGGGGCGGTGAGGGGTGGAT 0: 3
1: 0
2: 1
3: 34
4: 282
Right 1139880000 16:70174572-70174594 CTGGGGAGGAAGGAGGAGGAAGG 0: 3
1: 0
2: 45
3: 416
4: 2798
1139879991_1139880000 5 Left 1139879991 16:70174544-70174566 CCGGGGGCGGTGAGGGGTGGATG 0: 3
1: 0
2: 1
3: 28
4: 337
Right 1139880000 16:70174572-70174594 CTGGGGAGGAAGGAGGAGGAAGG 0: 3
1: 0
2: 45
3: 416
4: 2798
1139879985_1139880000 16 Left 1139879985 16:70174533-70174555 CCTGGGACAGCCCGGGGGCGGTG 0: 3
1: 1
2: 4
3: 47
4: 374
Right 1139880000 16:70174572-70174594 CTGGGGAGGAAGGAGGAGGAAGG 0: 3
1: 0
2: 45
3: 416
4: 2798

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139880000 Original CRISPR CTGGGGAGGAAGGAGGAGGA AGG Intronic
Too many off-targets to display for this crispr