ID: 1139884004

View in Genome Browser
Species Human (GRCh38)
Location 16:70196097-70196119
Sequence CAGGGTGGGCCAGGTGTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139883996_1139884004 22 Left 1139883996 16:70196052-70196074 CCTTAGACTGGAATGAGAAGGGG No data
Right 1139884004 16:70196097-70196119 CAGGGTGGGCCAGGTGTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139884004 Original CRISPR CAGGGTGGGCCAGGTGTTGT AGG Intergenic
No off target data available for this crispr