ID: 1139891825

View in Genome Browser
Species Human (GRCh38)
Location 16:70258066-70258088
Sequence GATGACCCCTCTGGGCCTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 175}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139891825_1139891839 28 Left 1139891825 16:70258066-70258088 CCAGCAGGCCCAGAGGGGTCATC 0: 1
1: 0
2: 0
3: 19
4: 175
Right 1139891839 16:70258117-70258139 GAGACGACTCGCACAGGGTCAGG 0: 1
1: 0
2: 0
3: 2
4: 50
1139891825_1139891829 -5 Left 1139891825 16:70258066-70258088 CCAGCAGGCCCAGAGGGGTCATC 0: 1
1: 0
2: 0
3: 19
4: 175
Right 1139891829 16:70258084-70258106 TCATCCAGCAACTCGGACACCGG 0: 1
1: 0
2: 0
3: 2
4: 70
1139891825_1139891832 6 Left 1139891825 16:70258066-70258088 CCAGCAGGCCCAGAGGGGTCATC 0: 1
1: 0
2: 0
3: 19
4: 175
Right 1139891832 16:70258095-70258117 CTCGGACACCGGGACCCCAATGG 0: 1
1: 1
2: 0
3: 3
4: 50
1139891825_1139891837 22 Left 1139891825 16:70258066-70258088 CCAGCAGGCCCAGAGGGGTCATC 0: 1
1: 0
2: 0
3: 19
4: 175
Right 1139891837 16:70258111-70258133 CCAATGGAGACGACTCGCACAGG 0: 1
1: 0
2: 0
3: 3
4: 17
1139891825_1139891830 -4 Left 1139891825 16:70258066-70258088 CCAGCAGGCCCAGAGGGGTCATC 0: 1
1: 0
2: 0
3: 19
4: 175
Right 1139891830 16:70258085-70258107 CATCCAGCAACTCGGACACCGGG 0: 1
1: 0
2: 0
3: 6
4: 68
1139891825_1139891838 23 Left 1139891825 16:70258066-70258088 CCAGCAGGCCCAGAGGGGTCATC 0: 1
1: 0
2: 0
3: 19
4: 175
Right 1139891838 16:70258112-70258134 CAATGGAGACGACTCGCACAGGG 0: 1
1: 0
2: 0
3: 2
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139891825 Original CRISPR GATGACCCCTCTGGGCCTGC TGG (reversed) Exonic