ID: 1139891826

View in Genome Browser
Species Human (GRCh38)
Location 16:70258074-70258096
Sequence AGTTGCTGGATGACCCCTCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 99}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139891826_1139891839 20 Left 1139891826 16:70258074-70258096 CCCAGAGGGGTCATCCAGCAACT 0: 1
1: 0
2: 1
3: 7
4: 99
Right 1139891839 16:70258117-70258139 GAGACGACTCGCACAGGGTCAGG 0: 1
1: 0
2: 0
3: 2
4: 50
1139891826_1139891832 -2 Left 1139891826 16:70258074-70258096 CCCAGAGGGGTCATCCAGCAACT 0: 1
1: 0
2: 1
3: 7
4: 99
Right 1139891832 16:70258095-70258117 CTCGGACACCGGGACCCCAATGG 0: 1
1: 1
2: 0
3: 3
4: 50
1139891826_1139891840 25 Left 1139891826 16:70258074-70258096 CCCAGAGGGGTCATCCAGCAACT 0: 1
1: 0
2: 1
3: 7
4: 99
Right 1139891840 16:70258122-70258144 GACTCGCACAGGGTCAGGATAGG 0: 1
1: 0
2: 0
3: 3
4: 92
1139891826_1139891838 15 Left 1139891826 16:70258074-70258096 CCCAGAGGGGTCATCCAGCAACT 0: 1
1: 0
2: 1
3: 7
4: 99
Right 1139891838 16:70258112-70258134 CAATGGAGACGACTCGCACAGGG 0: 1
1: 0
2: 0
3: 2
4: 27
1139891826_1139891837 14 Left 1139891826 16:70258074-70258096 CCCAGAGGGGTCATCCAGCAACT 0: 1
1: 0
2: 1
3: 7
4: 99
Right 1139891837 16:70258111-70258133 CCAATGGAGACGACTCGCACAGG 0: 1
1: 0
2: 0
3: 3
4: 17

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139891826 Original CRISPR AGTTGCTGGATGACCCCTCT GGG (reversed) Exonic