ID: 1139891831

View in Genome Browser
Species Human (GRCh38)
Location 16:70258088-70258110
Sequence GGTCCCGGTGTCCGAGTTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 58}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139891831_1139891840 11 Left 1139891831 16:70258088-70258110 CCAGCAACTCGGACACCGGGACC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1139891840 16:70258122-70258144 GACTCGCACAGGGTCAGGATAGG 0: 1
1: 0
2: 0
3: 3
4: 92
1139891831_1139891838 1 Left 1139891831 16:70258088-70258110 CCAGCAACTCGGACACCGGGACC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1139891838 16:70258112-70258134 CAATGGAGACGACTCGCACAGGG 0: 1
1: 0
2: 0
3: 2
4: 27
1139891831_1139891839 6 Left 1139891831 16:70258088-70258110 CCAGCAACTCGGACACCGGGACC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1139891839 16:70258117-70258139 GAGACGACTCGCACAGGGTCAGG 0: 1
1: 0
2: 0
3: 2
4: 50
1139891831_1139891837 0 Left 1139891831 16:70258088-70258110 CCAGCAACTCGGACACCGGGACC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1139891837 16:70258111-70258133 CCAATGGAGACGACTCGCACAGG 0: 1
1: 0
2: 0
3: 3
4: 17

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139891831 Original CRISPR GGTCCCGGTGTCCGAGTTGC TGG (reversed) Exonic