ID: 1139891831

View in Genome Browser
Species Human (GRCh38)
Location 16:70258088-70258110
Sequence GGTCCCGGTGTCCGAGTTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 58}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139891831_1139891839 6 Left 1139891831 16:70258088-70258110 CCAGCAACTCGGACACCGGGACC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1139891839 16:70258117-70258139 GAGACGACTCGCACAGGGTCAGG 0: 1
1: 0
2: 0
3: 2
4: 50
1139891831_1139891837 0 Left 1139891831 16:70258088-70258110 CCAGCAACTCGGACACCGGGACC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1139891837 16:70258111-70258133 CCAATGGAGACGACTCGCACAGG 0: 1
1: 0
2: 0
3: 3
4: 17
1139891831_1139891840 11 Left 1139891831 16:70258088-70258110 CCAGCAACTCGGACACCGGGACC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1139891840 16:70258122-70258144 GACTCGCACAGGGTCAGGATAGG 0: 1
1: 0
2: 0
3: 3
4: 92
1139891831_1139891838 1 Left 1139891831 16:70258088-70258110 CCAGCAACTCGGACACCGGGACC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1139891838 16:70258112-70258134 CAATGGAGACGACTCGCACAGGG 0: 1
1: 0
2: 0
3: 2
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139891831 Original CRISPR GGTCCCGGTGTCCGAGTTGC TGG (reversed) Exonic
900174753 1:1286734-1286756 GGCCCTGGAGTCAGAGTTGCCGG - Intronic
900599502 1:3497031-3497053 GGTCCCGGTGGCAGGGTGGCAGG + Exonic
902673771 1:17994191-17994213 GGGCCTGGTGACCGAGATGCAGG + Intergenic
903132808 1:21290433-21290455 GGTCCCGCTGCCCGGGTGGCCGG + Exonic
919690800 1:200526978-200527000 GGTGCGGGTGTCAGAGCTGCAGG - Intergenic
924093334 1:240524962-240524984 GGTCACGGTGTCTCAGTAGCTGG - Intronic
1065114994 10:22476425-22476447 GCTCCCGGTGCCCGCGTCGCTGG - Intergenic
1070726487 10:78794985-78795007 GGTCAAGGTGTCTGAGATGCAGG - Intergenic
1071372491 10:84966565-84966587 GGTTCAGGTGTGCGCGTTGCTGG + Intergenic
1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG + Exonic
1076861225 10:133139315-133139337 GGTCCCTGTGTGCGGGTGGCTGG + Intergenic
1091203852 11:133804290-133804312 GGTGCCTGTGTGGGAGTTGCAGG - Intergenic
1106208147 13:27618731-27618753 GGACCCAGTGTCCGAGGTGGAGG - Intronic
1108521611 13:51251601-51251623 GTTCCGGGTGTCCGAGAGGCGGG + Exonic
1115338206 14:32263330-32263352 GGTACCTGTGTCCAAGGTGCAGG - Intergenic
1122770125 14:104094097-104094119 GGTCCACGTGTCAGAGCTGCGGG + Intronic
1132622852 16:875885-875907 GGTCCTGGGGTCCCAGCTGCTGG - Intronic
1132793506 16:1706754-1706776 GGTCCCGCGGTCCGGGGTGCCGG - Intronic
1137250156 16:46735567-46735589 CGTCCCCGTGTCTGAGCTGCTGG + Intronic
1137531752 16:49282382-49282404 GGTCCCGGCGGCCGGGGTGCAGG + Intergenic
1139891831 16:70258088-70258110 GGTCCCGGTGTCCGAGTTGCTGG - Exonic
1141532856 16:84658719-84658741 TGTCCCGGGGACCGAGTGGCTGG - Intronic
1142495965 17:306440-306462 GGTCACGGTCTCCTCGTTGCAGG - Intronic
1150047493 17:61927805-61927827 GGTCCCGGCGTCTGAGTTCTTGG - Intronic
1150060478 17:62065037-62065059 GGTCCAGATGCCCGAGTTCCCGG - Intronic
1155613222 18:27692667-27692689 GGTCCCTGTGTCCCTCTTGCAGG + Intergenic
1156473541 18:37392019-37392041 GGTTCTGGTGACCCAGTTGCAGG - Intronic
1162302497 19:9851929-9851951 GGCCCCGGTATCCGAGTTCCCGG + Intergenic
1163261318 19:16191842-16191864 GGTCCAGGTGTCCGTGTTGGAGG + Exonic
1164005191 19:21142145-21142167 GGTCCCGGTGTCTTAGCTGTGGG - Exonic
1164159764 19:22618517-22618539 GGTCCTGGAGTCCGAGTGTCTGG + Intergenic
1167569514 19:50278121-50278143 GGCCGAGGTGTCCGAGCTGCGGG + Exonic
1167612782 19:50515302-50515324 GGTCAAGGTGCCCGAGTTGCAGG - Intergenic
937832987 2:126444222-126444244 GGCCACGGTGTCAGAGTGGCTGG - Intergenic
941787471 2:169514116-169514138 GGTCCAGCTGTCCCAGCTGCCGG + Intronic
942206214 2:173622099-173622121 GGTCCGTGTGTCAGTGTTGCAGG - Intergenic
944199911 2:197095519-197095541 GGTCCTGGTGGCTGAGGTGCAGG - Intronic
1170572753 20:17641702-17641724 GATCCCGGGCTCCGAGATGCTGG - Intronic
1174171005 20:48618247-48618269 GTTCCCGGTGTCGGGGTTGGAGG - Intergenic
1175877897 20:62238893-62238915 GGTCCCGGGATCGCAGTTGCCGG - Intronic
1178351017 21:31873290-31873312 GGTCCCGGGGTCCGGGTGCCTGG - Intergenic
953850887 3:46464732-46464754 GGTCCCTGTGTCCGGTTGGCTGG - Intronic
961993512 3:131217073-131217095 GTTCACGGTGTCCTAGTTCCCGG - Intronic
963827361 3:149970439-149970461 GGTCCAGGTGCCCGGGTTGGGGG - Intronic
974089902 4:57300450-57300472 GGTCCCGCAGTCAGAGTGGCCGG - Intergenic
998885129 5:146686198-146686220 GTTCCAGGTGCCGGAGTTGCAGG + Intronic
999274869 5:150323505-150323527 GGTCCAGGTGTCCTGGTTCCCGG - Intronic
1002048584 5:176556058-176556080 GGTCCCTGTGGCTGGGTTGCAGG - Intronic
1012996604 6:105981563-105981585 GTTCCCGGAGTCCCAGTTCCCGG + Intergenic
1013788861 6:113813253-113813275 GGACCCAGAGTCTGAGTTGCCGG - Intergenic
1017649074 6:156564606-156564628 GGCCCAGGTGGCCGAGTCGCCGG - Intergenic
1020136836 7:5592534-5592556 GGTCGGGGTGTCCGAGGTGGGGG + Intergenic
1022536613 7:31102419-31102441 GGTCCAGGTGTCCTAGCTGTGGG + Intronic
1029112060 7:98217578-98217600 GGACCCGGTGTCTGGGTTGCAGG - Intronic
1032505120 7:132428604-132428626 GGTTCCTGTGTCTGAGTAGCAGG - Intronic
1035225976 7:157432421-157432443 GGTGTGGGTGTCCGTGTTGCTGG - Intergenic
1035361374 7:158315954-158315976 GGTCGCGGTGGCAGAGTTGGAGG + Intronic
1039892910 8:41696717-41696739 GGTCTCGGTGGCCGGGCTGCTGG + Exonic
1047748093 8:127860188-127860210 GGTCCTGGTGGCGGAGGTGCTGG + Intergenic
1048304471 8:133273989-133274011 GGCCTAGGTGTCCGGGTTGCAGG - Intronic
1048911089 8:139135762-139135784 AGTCCCTGTGTCTGAGCTGCTGG + Intergenic
1049460903 8:142727281-142727303 GGTGCCGGTGTCCGCGGCGCTGG - Exonic
1059455696 9:114398636-114398658 GCTCCCTATGTCCGAGTTCCTGG - Intergenic