ID: 1139891832

View in Genome Browser
Species Human (GRCh38)
Location 16:70258095-70258117
Sequence CTCGGACACCGGGACCCCAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 1, 2: 0, 3: 3, 4: 50}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139891826_1139891832 -2 Left 1139891826 16:70258074-70258096 CCCAGAGGGGTCATCCAGCAACT 0: 1
1: 0
2: 1
3: 7
4: 99
Right 1139891832 16:70258095-70258117 CTCGGACACCGGGACCCCAATGG 0: 1
1: 1
2: 0
3: 3
4: 50
1139891825_1139891832 6 Left 1139891825 16:70258066-70258088 CCAGCAGGCCCAGAGGGGTCATC 0: 1
1: 0
2: 0
3: 19
4: 175
Right 1139891832 16:70258095-70258117 CTCGGACACCGGGACCCCAATGG 0: 1
1: 1
2: 0
3: 3
4: 50
1139891827_1139891832 -3 Left 1139891827 16:70258075-70258097 CCAGAGGGGTCATCCAGCAACTC 0: 1
1: 0
2: 0
3: 12
4: 100
Right 1139891832 16:70258095-70258117 CTCGGACACCGGGACCCCAATGG 0: 1
1: 1
2: 0
3: 3
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139891832 Original CRISPR CTCGGACACCGGGACCCCAA TGG Exonic