ID: 1139891837

View in Genome Browser
Species Human (GRCh38)
Location 16:70258111-70258133
Sequence CCAATGGAGACGACTCGCAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 21
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 17}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139891827_1139891837 13 Left 1139891827 16:70258075-70258097 CCAGAGGGGTCATCCAGCAACTC 0: 1
1: 0
2: 0
3: 12
4: 100
Right 1139891837 16:70258111-70258133 CCAATGGAGACGACTCGCACAGG 0: 1
1: 0
2: 0
3: 3
4: 17
1139891825_1139891837 22 Left 1139891825 16:70258066-70258088 CCAGCAGGCCCAGAGGGGTCATC 0: 1
1: 0
2: 0
3: 19
4: 175
Right 1139891837 16:70258111-70258133 CCAATGGAGACGACTCGCACAGG 0: 1
1: 0
2: 0
3: 3
4: 17
1139891831_1139891837 0 Left 1139891831 16:70258088-70258110 CCAGCAACTCGGACACCGGGACC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1139891837 16:70258111-70258133 CCAATGGAGACGACTCGCACAGG 0: 1
1: 0
2: 0
3: 3
4: 17
1139891826_1139891837 14 Left 1139891826 16:70258074-70258096 CCCAGAGGGGTCATCCAGCAACT 0: 1
1: 0
2: 1
3: 7
4: 99
Right 1139891837 16:70258111-70258133 CCAATGGAGACGACTCGCACAGG 0: 1
1: 0
2: 0
3: 3
4: 17

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139891837 Original CRISPR CCAATGGAGACGACTCGCAC AGG Exonic