ID: 1139891839

View in Genome Browser
Species Human (GRCh38)
Location 16:70258117-70258139
Sequence GAGACGACTCGCACAGGGTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 50}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139891831_1139891839 6 Left 1139891831 16:70258088-70258110 CCAGCAACTCGGACACCGGGACC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1139891839 16:70258117-70258139 GAGACGACTCGCACAGGGTCAGG 0: 1
1: 0
2: 0
3: 2
4: 50
1139891827_1139891839 19 Left 1139891827 16:70258075-70258097 CCAGAGGGGTCATCCAGCAACTC 0: 1
1: 0
2: 0
3: 12
4: 100
Right 1139891839 16:70258117-70258139 GAGACGACTCGCACAGGGTCAGG 0: 1
1: 0
2: 0
3: 2
4: 50
1139891833_1139891839 -9 Left 1139891833 16:70258103-70258125 CCGGGACCCCAATGGAGACGACT 0: 1
1: 0
2: 0
3: 1
4: 44
Right 1139891839 16:70258117-70258139 GAGACGACTCGCACAGGGTCAGG 0: 1
1: 0
2: 0
3: 2
4: 50
1139891825_1139891839 28 Left 1139891825 16:70258066-70258088 CCAGCAGGCCCAGAGGGGTCATC 0: 1
1: 0
2: 0
3: 19
4: 175
Right 1139891839 16:70258117-70258139 GAGACGACTCGCACAGGGTCAGG 0: 1
1: 0
2: 0
3: 2
4: 50
1139891826_1139891839 20 Left 1139891826 16:70258074-70258096 CCCAGAGGGGTCATCCAGCAACT 0: 1
1: 0
2: 1
3: 7
4: 99
Right 1139891839 16:70258117-70258139 GAGACGACTCGCACAGGGTCAGG 0: 1
1: 0
2: 0
3: 2
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139891839 Original CRISPR GAGACGACTCGCACAGGGTC AGG Exonic