ID: 1139891840

View in Genome Browser
Species Human (GRCh38)
Location 16:70258122-70258144
Sequence GACTCGCACAGGGTCAGGAT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 92}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139891827_1139891840 24 Left 1139891827 16:70258075-70258097 CCAGAGGGGTCATCCAGCAACTC 0: 1
1: 0
2: 0
3: 12
4: 100
Right 1139891840 16:70258122-70258144 GACTCGCACAGGGTCAGGATAGG 0: 1
1: 0
2: 0
3: 3
4: 92
1139891826_1139891840 25 Left 1139891826 16:70258074-70258096 CCCAGAGGGGTCATCCAGCAACT 0: 1
1: 0
2: 1
3: 7
4: 99
Right 1139891840 16:70258122-70258144 GACTCGCACAGGGTCAGGATAGG 0: 1
1: 0
2: 0
3: 3
4: 92
1139891833_1139891840 -4 Left 1139891833 16:70258103-70258125 CCGGGACCCCAATGGAGACGACT 0: 1
1: 0
2: 0
3: 1
4: 44
Right 1139891840 16:70258122-70258144 GACTCGCACAGGGTCAGGATAGG 0: 1
1: 0
2: 0
3: 3
4: 92
1139891831_1139891840 11 Left 1139891831 16:70258088-70258110 CCAGCAACTCGGACACCGGGACC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1139891840 16:70258122-70258144 GACTCGCACAGGGTCAGGATAGG 0: 1
1: 0
2: 0
3: 3
4: 92
1139891834_1139891840 -10 Left 1139891834 16:70258109-70258131 CCCCAATGGAGACGACTCGCACA 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1139891840 16:70258122-70258144 GACTCGCACAGGGTCAGGATAGG 0: 1
1: 0
2: 0
3: 3
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139891840 Original CRISPR GACTCGCACAGGGTCAGGAT AGG Exonic