ID: 1139893334

View in Genome Browser
Species Human (GRCh38)
Location 16:70268679-70268701
Sequence TGGGAATCTCTCTTACTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 113}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139893334_1139893345 27 Left 1139893334 16:70268679-70268701 CCTGTCAGTAAGAGAGATTCCCA 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1139893345 16:70268729-70268751 GCCCCTGCCAATCTCCTATCAGG 0: 1
1: 0
2: 0
3: 6
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139893334 Original CRISPR TGGGAATCTCTCTTACTGAC AGG (reversed) Intronic
902669595 1:17963834-17963856 TGGGAAGCATTCTTTCTGACAGG - Intergenic
902783147 1:18717117-18717139 TGGGAATCACTTTGACTGAGTGG - Intronic
905730172 1:40292569-40292591 TGGGATTCCCTGTTTCTGACTGG + Exonic
908354081 1:63314807-63314829 TGAGAATGTGTCTTACTGATCGG + Intergenic
908980771 1:69954632-69954654 TAGCAAAATCTCTTACTGACTGG + Intronic
916665866 1:166967028-166967050 TGGGAATTTCTATTACTGAAAGG - Intronic
916716016 1:167447326-167447348 TGGGAAGCTCTCTATATGACAGG - Intronic
917598320 1:176552008-176552030 GGGGACTGTCTCTTAGTGACTGG - Intronic
918445383 1:184612120-184612142 TGGGAATCTCTGTTAGTTGCTGG - Intronic
924557365 1:245129581-245129603 TGGAAATCTCTCTTCCTCCCAGG + Intergenic
1065006007 10:21380754-21380776 TGGGCCTCTCACTTACTGATCGG - Intergenic
1068006644 10:51398818-51398840 AGGAAATCCCTCTTACTGGCTGG - Intronic
1068764543 10:60748461-60748483 TGGAAAACTCTATGACTGACTGG + Intergenic
1072851172 10:98893744-98893766 TGGGAACATCTCTAACTGCCTGG + Intronic
1074787364 10:116852755-116852777 TGGGCATCTATCTTTCTCACAGG - Intronic
1075075427 10:119347144-119347166 AGGGATTCTCTCTTATTGATGGG + Intronic
1084959028 11:72706570-72706592 TGGAAAACTCTCTGACTGACTGG - Intronic
1087017639 11:93569828-93569850 AGGGAATCTCACTTCCTCACAGG - Intergenic
1088163451 11:106902210-106902232 AAGGAATCTCTTTTACTGAGCGG + Intronic
1089131094 11:116212758-116212780 TCTGAATTTCTCTTCCTGACTGG - Intergenic
1089390615 11:118099209-118099231 TGGGACTGCCTCTTACTGAGGGG - Intronic
1092263353 12:6963732-6963754 TGGGAGTCTCTAATACTGCCGGG + Intergenic
1092506315 12:9104239-9104261 TGGGTACCTCTCTTACTGTTAGG - Exonic
1095768898 12:45928684-45928706 TGGGGATCTCTGAGACTGACTGG + Exonic
1096980781 12:55727434-55727456 TGAGAATCTCTCTTCCGGATGGG - Intronic
1104199892 12:126578473-126578495 TGGGAATATCTCTGACTAATAGG + Intergenic
1105008692 12:132739704-132739726 TGGGTCTCTCTCTGAGTGACGGG + Intronic
1109510691 13:63368146-63368168 TGAGAACCTCTCTTACTGTTTGG - Intergenic
1109906436 13:68847546-68847568 CGGGATTCTCTCCTACTGTCAGG - Intergenic
1110670653 13:78173290-78173312 TAAGAATGTCTCTTACTGGCTGG + Intergenic
1114809084 14:25874672-25874694 TGGGACTCTGTGTTACTGACTGG - Intergenic
1116769223 14:49107943-49107965 TGGGAATTTCTCTGCCTGAGTGG - Intergenic
1119738232 14:76997587-76997609 TGGGAATGTCCCTTCCTGAGGGG + Intergenic
1122050629 14:99057444-99057466 TGAGAGTCTCTCTTACTCGCTGG - Intergenic
1129518701 15:76172221-76172243 TTGCAATCTCTTTTACAGACTGG - Intronic
1134468975 16:14505161-14505183 TGGCAATCTTACTTACTGAAAGG + Intronic
1137008213 16:35298092-35298114 TGTGAATTTCTCTTGTTGACTGG - Intergenic
1137014917 16:35365044-35365066 TGTGAATTTCTCTTGTTGACTGG - Intergenic
1137036059 16:35570935-35570957 TGTGACTCTCCCTTACTGCCTGG - Intergenic
1139893334 16:70268679-70268701 TGGGAATCTCTCTTACTGACAGG - Intronic
1140215257 16:73001862-73001884 TGAGAATCTCTGCTACTTACTGG - Intronic
1146677090 17:34781139-34781161 TGGAATTCTCGCTTACTGCCTGG + Intergenic
1148636950 17:49156280-49156302 AGGGAATCTCTGTCACTGAAGGG - Intronic
1151578193 17:74963287-74963309 AGGGAACCTCCCCTACTGACTGG + Intronic
1152662546 17:81549479-81549501 TGGGACTTTCTCTTCCTCACTGG - Intronic
1152797058 17:82313736-82313758 AGGCACTCTCTCGTACTGACGGG + Intergenic
1156706741 18:39891598-39891620 TAGGAACATCTATTACTGACTGG + Intergenic
1157682126 18:49615397-49615419 AGGGAAGCTCTCTTCCTGACAGG + Intergenic
1159943255 18:74425253-74425275 TGGGAAACTGACTTCCTGACGGG - Intergenic
1159943264 18:74425314-74425336 TGGGAAACTGACTTCCTGACAGG - Intergenic
1162787467 19:13044747-13044769 TTGTAATCTCTTTTACTAACAGG - Intronic
926619051 2:15030556-15030578 TGGGCACCTCTCTTTCTGCCAGG + Intergenic
926857576 2:17273423-17273445 TGGGCATCACTCTAACTGGCTGG + Intergenic
928203732 2:29269240-29269262 TGGGAAGCTCTATTGCTGATGGG + Intronic
928521540 2:32093996-32094018 TGGGAATTCCTAATACTGACTGG - Intronic
929030653 2:37647545-37647567 TGTGAATCTCTATTACAGGCTGG + Intronic
930066278 2:47330145-47330167 TGAGAATTTCTCTTCCTGAGAGG - Intergenic
930281731 2:49377523-49377545 TGTTAATCTCTGTTGCTGACAGG - Intergenic
947822389 2:233081177-233081199 TGGGAATGTCTGTCTCTGACAGG + Intronic
1170826085 20:19797098-19797120 TGGGACACTCACTTACTGAGTGG - Intergenic
1174745835 20:53061616-53061638 TGGAACTTTCTTTTACTGACAGG + Intronic
1181442986 22:22947608-22947630 TGAGAATCTCTCTAAATCACTGG + Intergenic
949179000 3:1103265-1103287 TGTGAATCTGTGTTGCTGACAGG + Intronic
949841190 3:8321852-8321874 TGGGAATCTGTATTTCTAACAGG - Intergenic
951578798 3:24140473-24140495 TGGGAATCTCTCTTTCTGTGTGG + Intronic
952221038 3:31324694-31324716 TTGGAATCAATCATACTGACTGG - Intergenic
954329744 3:49883442-49883464 TGGGAGTCTCTGGTACTCACTGG + Intergenic
961937101 3:130596686-130596708 TTGGAATTTCCCATACTGACTGG + Intronic
966299020 3:178458098-178458120 TGGTAATCTCCAATACTGACAGG - Intronic
968561767 4:1287084-1287106 TGGGAACCTGTCTTCCTGCCTGG - Intergenic
969666858 4:8563096-8563118 TGAGAATGTCACTTTCTGACAGG - Intronic
973538217 4:51906125-51906147 TGGGAATGGCTTTTACTGAGAGG + Intronic
975298407 4:72761214-72761236 TGGAAATTTGTCTTACTGACAGG + Intergenic
975976063 4:80097961-80097983 TGCAAATCTCTCTTCCTGCCAGG - Intronic
979702004 4:123679788-123679810 TTGGAATCCCTCTTCTTGACTGG - Intergenic
980481943 4:133398715-133398737 TGTGAGTCTCTCTTGCTGAGGGG + Intergenic
982294046 4:153808515-153808537 TTTGATTCTCTCTTTCTGACTGG - Intergenic
982420846 4:155195423-155195445 TGGGAATCTACATTATTGACAGG + Intergenic
982438854 4:155410736-155410758 TGGAAATATCTGTTTCTGACTGG + Intergenic
982467429 4:155748037-155748059 GGGAAATATCTCTTACTGACAGG + Intergenic
984988983 4:185359671-185359693 TGGGAATTTCTTTTAATTACAGG - Intronic
987527194 5:19067876-19067898 TGGGAATAGCTCTTATTGAAGGG + Intergenic
988527178 5:31997546-31997568 TGGGAAACTGTCTATCTGACAGG - Intronic
990220524 5:53583361-53583383 TGGAAAGCTGTCTTTCTGACAGG - Intronic
992817491 5:80458708-80458730 TGGGAATTTATCTTACAGATAGG - Intronic
993934495 5:93985222-93985244 AGACAATCTCTATTACTGACAGG - Intronic
994259182 5:97636541-97636563 TGAGAATCTCTCTCACTATCTGG + Intergenic
997839970 5:137230278-137230300 TGTGAATGTCTTTTTCTGACTGG - Intronic
1004679444 6:17878694-17878716 TTGGAATAATTCTTACTGACAGG - Intronic
1013569067 6:111402231-111402253 TGGGAATCTCTTTTAGTCCCAGG + Intronic
1014470883 6:121813499-121813521 AGGGAATCTTTCTTACTAATAGG - Intergenic
1021878883 7:25074926-25074948 TGGGAATCTCTCTTAGGAAAAGG - Intergenic
1025161801 7:56667749-56667771 TGTGAATTTCTGCTACTGACTGG + Intergenic
1026199732 7:68204216-68204238 TGGGAATATCTCTAAATGAAAGG + Intergenic
1027525360 7:79262121-79262143 TGGGAATCTGGTTTACAGACAGG - Intronic
1028999645 7:97139529-97139551 TGAGAACCTCTCTTCCTGTCTGG - Intronic
1031622684 7:123953989-123954011 TGGGAATGGCTGTTATTGACTGG + Exonic
1033634245 7:143194717-143194739 TGGGAATTTCTTTTTCTGGCTGG + Intergenic
1035199409 7:157251011-157251033 TGGGAATCTCTATGAATAACTGG - Intronic
1035346721 7:158204957-158204979 TGGGCATGTCTCTTACTGGAGGG + Intronic
1041241757 8:55854401-55854423 TGGACATCTCCCTCACTGACAGG + Intergenic
1045328572 8:101135753-101135775 TGAGAATGTGACTTACTGACAGG + Intergenic
1045950635 8:107848181-107848203 AGGGAATCTCTTTTTATGACGGG - Intergenic
1046460915 8:114534909-114534931 TGGGATTCTCCCTTATTCACTGG + Intergenic
1047379910 8:124351361-124351383 TGAAAAACTCTCTTATTGACAGG + Intronic
1050296890 9:4214468-4214490 TGAGAATCTCCCTAACTGCCAGG + Intronic
1053048871 9:34941913-34941935 TGGGCATCTCTCATACTGGAAGG - Intergenic
1053582179 9:39416668-39416690 TGGGGCTCTCTCTTACAGAGAGG + Intergenic
1053846596 9:42243996-42244018 TGGGGCTCTCTCTTACAGAGAGG + Intergenic
1054103757 9:60975407-60975429 TGGGGCTCTCTCTTACAGAGAGG + Intergenic
1054582593 9:66931439-66931461 TGGGGCTCTCTCTTACAGAGAGG - Intronic
1055164311 9:73172694-73172716 AAGGTAGCTCTCTTACTGACTGG - Intergenic
1058290435 9:103234567-103234589 TGAGGGTCTATCTTACTGACTGG + Intergenic
1059646404 9:116272372-116272394 TGGGAAGATTTCTCACTGACAGG + Intronic
1192286426 X:69742944-69742966 TGGGAATCTAACTTACAGCCAGG - Intronic
1192735674 X:73847445-73847467 TGGGAAGATCCCTTACTGCCAGG - Intergenic
1195746157 X:108120820-108120842 TGGGATTCTATTTAACTGACTGG - Intronic
1200036719 X:153335692-153335714 TCAGAATCTCTGTTACTGACAGG - Intronic
1201849135 Y:18458299-18458321 TGGGAGGGTCTCTTACTGAGGGG + Intergenic
1201884183 Y:18862076-18862098 TGGGAGGGTCTCTTACTGAGGGG - Intergenic
1202350897 Y:23989899-23989921 TGGGAGGGTCTCTTACTGAGGGG - Intergenic
1202519882 Y:25680220-25680242 TGGGAGGGTCTCTTACTGAGGGG + Intergenic