ID: 1139905848

View in Genome Browser
Species Human (GRCh38)
Location 16:70365444-70365466
Sequence GGGATTAACAGGACTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139905844_1139905848 -9 Left 1139905844 16:70365430-70365452 CCTGCTACCAAAGAGGGATTAAC 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1139905848 16:70365444-70365466 GGGATTAACAGGACTGAGGATGG 0: 1
1: 0
2: 1
3: 23
4: 210
1139905841_1139905848 5 Left 1139905841 16:70365416-70365438 CCAGAGTTCTGGGACCTGCTACC 0: 1
1: 1
2: 0
3: 17
4: 258
Right 1139905848 16:70365444-70365466 GGGATTAACAGGACTGAGGATGG 0: 1
1: 0
2: 1
3: 23
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139905848 Original CRISPR GGGATTAACAGGACTGAGGA TGG Intronic
900466927 1:2830256-2830278 GGCATTAACTGGAAGGAGGAGGG - Intergenic
900743802 1:4346507-4346529 GGGGTGGACAGGGCTGAGGAAGG + Intergenic
901143934 1:7052819-7052841 TGGATTGACAGCACGGAGGAGGG - Intronic
904389346 1:30171543-30171565 GAGATTACCAGGAAAGAGGAAGG - Intergenic
904526887 1:31140504-31140526 TGGATGAACAAGACTGAAGAGGG + Intergenic
904641677 1:31936166-31936188 GGGATTAACAGGCGTGAGGGTGG - Intronic
905245756 1:36612145-36612167 GGGATCACCAGGGCTGAGGATGG - Intergenic
907789558 1:57648612-57648634 GGGAACAACAGGACTGGAGAAGG - Intronic
910629653 1:89341891-89341913 GTGATTACCAGGAGTGAGGCTGG - Intergenic
911465588 1:98249156-98249178 GTGATTACCAGGGCTGGGGAGGG + Intergenic
912158381 1:106950382-106950404 GGGATTATCAGCACTGAGAGTGG - Intergenic
913543571 1:119844565-119844587 GGTTTAATCAGGACTGAGGAAGG + Intergenic
916712513 1:167424594-167424616 GAGTTTAACATGACTGAGGAGGG - Exonic
921512639 1:216050966-216050988 GGGAGGATAAGGACTGAGGAAGG - Intronic
1063550218 10:7025485-7025507 GGGATTTCCAGGAATGGGGATGG + Intergenic
1065138589 10:22698157-22698179 GGGAGTATCAGGTCTGAGGTTGG - Intronic
1066328397 10:34390617-34390639 GGGATTGTCAGGACTGGGGAAGG - Intronic
1067027935 10:42860018-42860040 GGGGCTGATAGGACTGAGGATGG - Intergenic
1068436122 10:56993392-56993414 GAAATGAACAGGACTGAGTAGGG + Intergenic
1069718407 10:70535067-70535089 AGAATAAACAGGACAGAGGAAGG + Intronic
1069959285 10:72070201-72070223 GGGGTTTCCAGGACTGAGGTGGG - Intronic
1070724266 10:78777691-78777713 GGTATTTACAGGCCTGGGGAAGG - Intergenic
1071411357 10:85400026-85400048 GCCATTAAGTGGACTGAGGAAGG + Intergenic
1073052751 10:100679414-100679436 GGGAATTACAGATCTGAGGAAGG - Intergenic
1073118963 10:101109630-101109652 GGGAATAACAGGAGGAAGGAGGG + Intronic
1077068914 11:658562-658584 GGAAATCACAGGACTGCGGATGG + Intronic
1077636838 11:3847605-3847627 TAGAATACCAGGACTGAGGAAGG - Intergenic
1078020272 11:7651240-7651262 GGGAACAGCAGGGCTGAGGAAGG + Intronic
1080101973 11:28470213-28470235 GGGGGTAAGAGGACTGAGCAAGG - Intergenic
1085199470 11:74692969-74692991 AGGAGAAACAGGAGTGAGGATGG - Intergenic
1094293050 12:28873547-28873569 GGGATGAAAGGGACTGAGTAGGG + Intergenic
1097405246 12:59181519-59181541 GGGATTACCAGGGTGGAGGATGG - Intergenic
1097469043 12:59965877-59965899 GGGATTATCAGAACTGATGCAGG - Intergenic
1097914263 12:65003481-65003503 GGGATTGTCAGTACTGGGGAAGG - Intergenic
1098428215 12:70390317-70390339 GGGATTTACAGGGCTGAAGCAGG - Intronic
1098463683 12:70762925-70762947 GGGATTTGCCAGACTGAGGAAGG - Intronic
1099211412 12:79793690-79793712 AGGATTAAAAGGACTGGGAAGGG - Intronic
1100642364 12:96494213-96494235 GGGAATAATAGGACTTTGGAAGG + Intronic
1100728904 12:97441778-97441800 GGGATAAAAAGGAAGGAGGAAGG + Intergenic
1101799824 12:108011508-108011530 GTGGTGAACAGGAGTGAGGAAGG - Intergenic
1102475221 12:113184552-113184574 GGGATTAACAGGCGTGAGCCCGG - Intronic
1103191886 12:119008736-119008758 GGGAAAAACAGCACTGATGAGGG - Intronic
1103333355 12:120170365-120170387 GGAAATGACAGGACTGAGAAAGG + Intronic
1103333397 12:120170753-120170775 GGAATTGACAGGATTGAGGGTGG - Intronic
1105891438 13:24685208-24685230 GGGAGTAGCAGCCCTGAGGATGG - Intronic
1106169190 13:27274199-27274221 GAGAAAAACAGGAGTGAGGATGG - Intergenic
1108297956 13:49044131-49044153 GGGATGAAAAGGGCTGAGGCTGG + Intronic
1111537420 13:89621211-89621233 GGGAATAAAAGGAGGGAGGAAGG - Intergenic
1112989629 13:105496184-105496206 TGGAGTAACTGGACTGAGGATGG - Intergenic
1115250288 14:31338728-31338750 GGGAAAAACAGGACTGAAGTAGG + Intronic
1115717992 14:36127016-36127038 GGGACTAACAGGAGAGAGAAAGG - Intergenic
1120840738 14:89082899-89082921 GGGGTTAGCAGGGCTGAGAAGGG + Intergenic
1121953508 14:98193336-98193358 GGGATGACCAGGACTGAGTCTGG + Intergenic
1123145454 14:106125520-106125542 GGGAGAAACAGGACTGGGGGTGG - Intergenic
1123427589 15:20184850-20184872 GGGGCTGATAGGACTGAGGATGG - Intergenic
1123536826 15:21191400-21191422 GGGGCTGATAGGACTGAGGATGG - Intergenic
1126049543 15:44673733-44673755 GGAATTAAGAGCTCTGAGGAGGG - Intronic
1127893559 15:63276010-63276032 GGAATTAGCAGGACTCTGGAGGG - Intronic
1129554861 15:76497135-76497157 AGGTTTTACAGGACTAAGGAAGG - Intronic
1129844454 15:78761864-78761886 GGGATTAACAGGACCCTGGAAGG + Intronic
1130257347 15:82331952-82331974 GGGATTAGCAGGACCCTGGAAGG - Intergenic
1130597598 15:85258037-85258059 GGGATTAGCAGGACCCTGGAAGG + Intergenic
1131540033 15:93268165-93268187 AGGATGAGCAGGAGTGAGGAAGG + Intergenic
1131654238 15:94438393-94438415 GAGAGGAATAGGACTGAGGAAGG + Intronic
1131691346 15:94831079-94831101 GGGAGTAACAAGAGTGAAGAAGG - Intergenic
1133237752 16:4395481-4395503 AGGAGGAACAGGGCTGAGGAGGG - Intronic
1133896616 16:9935402-9935424 GAGAGTAAAAGGACAGAGGACGG + Intronic
1136693655 16:32056263-32056285 GGGAGAAACAGGACTGGGGGTGG + Intergenic
1136794145 16:32999498-32999520 GGGAGAAACAGGACTGGGGGTGG + Intergenic
1136856705 16:33664959-33664981 GGGGCTGATAGGACTGAGGATGG + Intergenic
1137465754 16:48707425-48707447 GGGATGAACAGGACTGTGCAAGG - Intergenic
1138356277 16:56383542-56383564 GGGAGGAACAGGCATGAGGATGG - Intronic
1139394527 16:66629991-66630013 GTGACTCACAGGACTCAGGAAGG - Intronic
1139905848 16:70365444-70365466 GGGATTAACAGGACTGAGGATGG + Intronic
1141500294 16:84439367-84439389 GGGTTTCACAAGCCTGAGGATGG + Intronic
1142364845 16:89644792-89644814 GGGGTGGGCAGGACTGAGGAGGG + Exonic
1203096409 16_KI270728v1_random:1261179-1261201 GGGAGAAACAGGACTGGGGGTGG + Intergenic
1203118282 16_KI270728v1_random:1513434-1513456 GGGGCTGATAGGACTGAGGATGG + Intergenic
1145775108 17:27522256-27522278 AGGAAAAACAGGACTGAGAAGGG + Intronic
1146137672 17:30337507-30337529 AGTCTTATCAGGACTGAGGAAGG - Intergenic
1146253133 17:31367853-31367875 GCTATTCACAGGACTGAGGTGGG + Intronic
1147120821 17:38334190-38334212 GGGATTAACAGGATTGAAGTGGG - Intronic
1147717756 17:42519745-42519767 AGGAAAAACAGGACTCAGGAGGG - Intronic
1148194003 17:45700232-45700254 GGGCTCAACAGAACTGAGCAAGG - Intergenic
1148779212 17:50112205-50112227 GGGACCCACAGGACAGAGGAGGG + Intronic
1149141482 17:53437468-53437490 GGGATTGTCAAGGCTGAGGAAGG - Intergenic
1153089609 18:1329355-1329377 GAGATTAACAGGGCTGGGGAAGG + Intergenic
1153584340 18:6605781-6605803 GGGGTAAGCAGAACTGAGGATGG + Intergenic
1154126688 18:11698194-11698216 GGGATAAAGAGGGCTGAGGCTGG + Intronic
1155988426 18:32254827-32254849 GGGAGGAGCAGGAGTGAGGATGG - Intronic
1156077950 18:33303315-33303337 GGGATTACCAGGAGTTAGGTGGG + Intronic
1156454459 18:37285189-37285211 GGGATGGGCAGGACTGGGGAGGG - Intronic
1158330979 18:56361579-56361601 GGGATCAACAGGCTAGAGGAGGG - Intergenic
1159024219 18:63167949-63167971 GGAATTAGCAGGACTGAGGCAGG + Intronic
1159627647 18:70713479-70713501 CGGATTAACAGCAAGGAGGAAGG + Intergenic
1160448687 18:78947160-78947182 GGGAAGAAGAGGACAGAGGAAGG + Intergenic
1161425162 19:4199091-4199113 TGGATAAACAGGGCAGAGGATGG + Intronic
1162059122 19:8084096-8084118 GGCATCAACAGGACTGGGGAGGG - Intronic
1162262853 19:9546653-9546675 GGGATTAGAAAGAGTGAGGAGGG - Intergenic
1163287425 19:16357398-16357420 GGGATAAGCCAGACTGAGGAGGG + Intronic
1164676366 19:30104260-30104282 GGAATCTACAGGACTGAGGAAGG - Intergenic
1167797073 19:51716487-51716509 GAGATTATGATGACTGAGGATGG - Intronic
925568405 2:5282387-5282409 GTGATTACCAGGTGTGAGGAGGG + Intergenic
928478333 2:31654213-31654235 AGGATGAACAGGACTGAGATTGG + Intergenic
928626805 2:33148187-33148209 GGGCTTAACAAGAATAAGGATGG - Intronic
928702968 2:33917787-33917809 GGGAATGGCAGGACTGAGAATGG - Intergenic
929059557 2:37909346-37909368 GGGAATGAGAGGAATGAGGAGGG + Intergenic
929356669 2:41033166-41033188 GTCATTAAATGGACTGAGGATGG - Intergenic
929474516 2:42232571-42232593 AAGATTAACAGGAGTGAGGTGGG - Intronic
931688916 2:64818648-64818670 GGGATTATCAGGACTATGGAAGG + Intergenic
931710646 2:64987347-64987369 GGGATGAGCAGGTTTGAGGAAGG + Intergenic
932393707 2:71422532-71422554 GGGGTTAACTTGACAGAGGAGGG + Intronic
932761082 2:74439773-74439795 GGGTTTAACAGGAGTGCAGAGGG - Intronic
935972284 2:108541708-108541730 GGCATGAACAGCACTGAGGCAGG - Intronic
936073703 2:109388021-109388043 GGGCTGAACAGGAGTCAGGATGG - Intronic
936513085 2:113164326-113164348 AGGATGAAGAGGACTGGGGAAGG + Intronic
947549320 2:231035364-231035386 GGTAGTAGAAGGACTGAGGAAGG - Intergenic
948531872 2:238614144-238614166 GGGATTACCAGTACAGAGGCTGG - Intergenic
948594989 2:239074020-239074042 GGGAGCAGCAGGACTGAGGGGGG + Intronic
1168995392 20:2129242-2129264 GGGTTTACATGGACTGAGGATGG - Intronic
1169844772 20:9977653-9977675 GGGATTAAAAGGGATGAGAAAGG - Intergenic
1171289574 20:23974417-23974439 GGGAGTCACAGAACTCAGGATGG - Intergenic
1173096279 20:40031731-40031753 AGGAATATCAGGACTGAGGGAGG - Intergenic
1178363923 21:31972754-31972776 GTGACAAACAGGAATGAGGAAGG + Intronic
1180709390 22:17829532-17829554 TGGATGCACAGGACTGAGGAAGG + Intronic
1181632234 22:24157240-24157262 GGGAGGAACAGGACTGCGGGAGG + Intronic
1181908389 22:26217975-26217997 GAGATTGACAGGACAGAGAAGGG - Intronic
1183251392 22:36732846-36732868 GTGTTTCCCAGGACTGAGGAGGG - Intergenic
1183916885 22:41128052-41128074 GGGACTAAGAAGGCTGAGGAAGG + Intronic
1184293493 22:43510035-43510057 AGGAAGAACAGGGCTGAGGAGGG + Intergenic
1185169437 22:49284107-49284129 GGGGTTTCCAGGAATGAGGAGGG + Intergenic
949093787 3:61729-61751 GGGAATAAATGGATTGAGGAAGG + Intergenic
950358354 3:12430715-12430737 GAGATGAACAGGAGAGAGGAAGG + Intronic
952138063 3:30446025-30446047 GGGTGAAACAGTACTGAGGAAGG + Intergenic
952569419 3:34696390-34696412 GGGAATGAAAGGACTGAGGCTGG + Intergenic
953756050 3:45646796-45646818 GGGACTAAAGGGACTGAGGTGGG - Intronic
954258086 3:49420012-49420034 GGGATTACCAGGCATGGGGAGGG - Intronic
954782160 3:53069887-53069909 GCAATTACAAGGACTGAGGAGGG + Intronic
954888100 3:53894873-53894895 GGGAATAACAGAACTCAGTAGGG - Intergenic
956888782 3:73588531-73588553 GTGGGAAACAGGACTGAGGAGGG - Intronic
961096052 3:124157889-124157911 TGGAGCAACAGGACTCAGGAAGG - Intronic
961907009 3:130273364-130273386 GAGATTACCAGGGCTGAGGCAGG + Intergenic
962003255 3:131322632-131322654 GTGATTAGTAGGTCTGAGGAGGG + Intronic
963822704 3:149915829-149915851 GGGACTGAGGGGACTGAGGAAGG + Intronic
964155427 3:153579550-153579572 GGGATTAAAATGAGTGAGGCAGG + Intergenic
966425846 3:179778846-179778868 GGGAGCAACAGGAGTGAGGGCGG + Intronic
966884942 3:184372367-184372389 GGGATACACAGGACTGAAAAGGG - Exonic
968148718 3:196320585-196320607 GGGATCCAGGGGACTGAGGAGGG + Intronic
968280936 3:197476256-197476278 GGAAGGAAAAGGACTGAGGATGG - Intergenic
970277466 4:14417219-14417241 TGGAATAATAGGACTGAGGAAGG - Intergenic
970740443 4:19231146-19231168 AAGATCAACAAGACTGAGGAAGG + Intergenic
971176988 4:24291645-24291667 GGGATCAGCAGGACTTCGGATGG - Intergenic
974026067 4:56734292-56734314 GAGAGTATCAGGACAGAGGAAGG - Intergenic
974309099 4:60181092-60181114 TGGATTCACAGCACTGAGGATGG - Intergenic
976381133 4:84400310-84400332 GGGATAAACAGGAATAAAGAAGG + Intergenic
977098764 4:92780695-92780717 GGGCTTACCAGGCCAGAGGATGG - Intronic
977151621 4:93520039-93520061 GGGTTTTAGAAGACTGAGGAAGG + Intronic
977401156 4:96534275-96534297 GGGATTAAGATTAGTGAGGAAGG + Intergenic
978036935 4:104006729-104006751 GTGATTCACTGGACTGAGCATGG - Intergenic
979409045 4:120351686-120351708 GAGATTAAGAGGAGTGAGCATGG + Intergenic
980000858 4:127486167-127486189 GGGATAACCAGGCCTGATGAAGG - Intergenic
980987613 4:139710955-139710977 GGGGGTAACAGGACAGAGAAGGG + Intronic
981121666 4:141058285-141058307 GGGATGAAGAGGAGTGGGGAGGG + Intronic
982241328 4:153302654-153302676 GGGATTAAAAGTAATGAGGTTGG + Intronic
983110155 4:163740174-163740196 GGGATTAGGAGGACAGGGGATGG - Intronic
986536465 5:8793371-8793393 GGGAAAAAGAGAACTGAGGATGG + Intergenic
986615472 5:9613230-9613252 GAGATCAATAGGAGTGAGGAAGG + Intergenic
986900446 5:12424738-12424760 GGGAATATCAGGAGTGAGGATGG - Intergenic
988702319 5:33687692-33687714 GGCCTTAACAGGACTGAGCTGGG + Intronic
990286899 5:54309863-54309885 GGCACGAACAGGACTGAGTAGGG - Intronic
991599732 5:68340484-68340506 GAGATTAACCAGGCTGAGGATGG + Intergenic
992648233 5:78832244-78832266 GAGATAAACAGGACTGAAGGAGG + Intronic
992952337 5:81872686-81872708 ATGATTTACAGGACAGAGGAGGG - Intergenic
994688695 5:102989205-102989227 GGGATTAACACAAGTGAGGCTGG + Intronic
995807403 5:116068922-116068944 GGAATTGACTGGACTGAGGGAGG - Intergenic
997984266 5:138491031-138491053 GGGATGGGCAGGACTGATGAGGG + Intergenic
998097524 5:139404696-139404718 GAGATTAGGAGGACTGAAGAGGG + Intergenic
999054329 5:148557552-148557574 GGGATTTAGAGAACTGAGGAAGG + Intronic
999063519 5:148660298-148660320 GGAATTAACAGAATTGAGCAAGG + Intronic
1000554114 5:162702818-162702840 CAGATTAACAGAACAGAGGATGG - Intergenic
1001932161 5:175680916-175680938 GTGTTGAAAAGGACTGAGGAAGG + Intronic
1002715340 5:181223591-181223613 GGGAGTAGCAGGACAGCGGAGGG + Exonic
1006443557 6:34066689-34066711 GAGAGGAACAGGACTGAAGAAGG + Intronic
1007475402 6:42116475-42116497 GGGATGGTGAGGACTGAGGAAGG - Intronic
1010787018 6:80015456-80015478 TGTTTTAATAGGACTGAGGAGGG + Intronic
1013305279 6:108841838-108841860 GGGATGACCAGGGCTGGGGATGG - Intergenic
1013323779 6:109023169-109023191 AGGATTAACATGTATGAGGAGGG - Intronic
1014284573 6:119482350-119482372 TGAATTAATAGTACTGAGGAAGG + Intergenic
1015389699 6:132667762-132667784 GGGATGAACAGGAAAGAGGAAGG - Intergenic
1017014273 6:150087580-150087602 GGGAAGGACAGGACTGTGGAGGG - Intergenic
1018105968 6:160486717-160486739 AGCATTCCCAGGACTGAGGAAGG + Intergenic
1018911080 6:168101240-168101262 GGGGTTTCCAGGACTGAGGCGGG - Intergenic
1019144157 6:169966213-169966235 GGGATTAACAGGACTTGGTGAGG - Intergenic
1020596113 7:10210134-10210156 GGGAGTAACTGGACTGGGCAAGG + Intergenic
1021249427 7:18305890-18305912 GGGACTAACTGGAACGAGGAAGG + Intronic
1023945220 7:44797308-44797330 GGGATCTACAGGACCGAGCATGG - Intronic
1024311244 7:47971308-47971330 TGGGTTACCAGGACTGAGGATGG + Intronic
1024834683 7:53502585-53502607 GGCATTAACTCCACTGAGGAGGG + Intergenic
1030694320 7:112568417-112568439 GGGATTGACAGGAATGAAGAAGG + Intergenic
1032062275 7:128735140-128735162 GGGAGCAACAGGAATGAGGGAGG - Intergenic
1032621899 7:133542626-133542648 GGGGAGAATAGGACTGAGGAGGG + Intronic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1035366818 7:158353890-158353912 GGGAGAAACAGCCCTGAGGATGG + Intronic
1035720859 8:1790734-1790756 GGGATGCACAGGAATGAGGCAGG - Intergenic
1037757399 8:21720012-21720034 GGGAGTAACAGAATTGGGGAGGG - Intronic
1038539071 8:28376347-28376369 GGGATTAACAGGCGTGAGCCCGG - Intronic
1040369904 8:46759292-46759314 GGGATTGAAAGGAGGGAGGAAGG - Intergenic
1041089582 8:54289643-54289665 GGGACTGCCAGGGCTGAGGAAGG + Intergenic
1042114263 8:65414206-65414228 TGGATTCCCAGGGCTGAGGAAGG + Intergenic
1042376718 8:68060710-68060732 GAGATTCACAGGCCTGAGGAAGG + Exonic
1047050547 8:121106860-121106882 GGGATTAGAAGGCCTGAGGAAGG + Intergenic
1047278631 8:123425660-123425682 GGCATGAACAGCCCTGAGGATGG - Intronic
1048330467 8:133467363-133467385 GGGTTTACCACGAGTGAGGAAGG - Intronic
1049309835 8:141927995-141928017 GGGCTGAGCTGGACTGAGGACGG - Intergenic
1051462845 9:17342848-17342870 GGGATTAGCAGGACAGGGCAGGG - Intronic
1052204464 9:25822327-25822349 GGTAGTAGAAGGACTGAGGAGGG - Intergenic
1057908715 9:99002114-99002136 GGGAATAAAAGGAGAGAGGAGGG - Intronic
1058172268 9:101696097-101696119 AGCATTAGCAGCACTGAGGAGGG + Intronic
1059611509 9:115902300-115902322 TGAATTATCTGGACTGAGGATGG + Intergenic
1061149469 9:128820701-128820723 GGGCTTAGCAGGACTGTGGCTGG - Exonic
1061274965 9:129564724-129564746 GGGAAAAACAGGACTGAGGATGG + Intergenic
1061806057 9:133138311-133138333 GGGATTAACGGGACAGTGGGTGG - Intronic
1062041667 9:134407248-134407270 GGGATTTGGAGGCCTGAGGAAGG + Intronic
1186652464 X:11575671-11575693 GGGATTAAAAGGAAAGAGGGTGG + Intronic
1186674923 X:11806120-11806142 GGCAATAACAAAACTGAGGATGG + Intergenic
1186877462 X:13830365-13830387 GGAAGTAACAGGAGTAAGGAAGG - Intronic
1186995950 X:15122648-15122670 GGTAGTAGAAGGACTGAGGAGGG - Intergenic
1189919079 X:45885792-45885814 GCCATGAACAGGAGTGAGGACGG - Intergenic
1190760352 X:53433516-53433538 GGGATTCACAACAATGAGGATGG - Intronic
1192182085 X:68922440-68922462 GGGATGGACAGGACAGATGAAGG + Intergenic
1195828070 X:109024686-109024708 GGGATTAAGCTGACAGAGGAAGG - Intergenic
1197111727 X:122782893-122782915 GGGATTAGCTTGATTGAGGAGGG + Intergenic
1197713006 X:129685583-129685605 GCCATTTACAGAACTGAGGAAGG + Intergenic
1198066058 X:133097741-133097763 GGTGATAAGAGGACTGAGGAAGG + Intergenic
1198395188 X:136212766-136212788 AGGGATAACAGGAGTGAGGAGGG - Intergenic