ID: 1139911638

View in Genome Browser
Species Human (GRCh38)
Location 16:70400886-70400908
Sequence CCCCAGCAGCACTGGCTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 353}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139911630_1139911638 18 Left 1139911630 16:70400845-70400867 CCACAGGCCTCATCAGGGCTCCT 0: 1
1: 0
2: 6
3: 28
4: 329
Right 1139911638 16:70400886-70400908 CCCCAGCAGCACTGGCTCAAAGG 0: 1
1: 0
2: 2
3: 33
4: 353
1139911629_1139911638 19 Left 1139911629 16:70400844-70400866 CCCACAGGCCTCATCAGGGCTCC 0: 1
1: 0
2: 2
3: 21
4: 198
Right 1139911638 16:70400886-70400908 CCCCAGCAGCACTGGCTCAAAGG 0: 1
1: 0
2: 2
3: 33
4: 353
1139911632_1139911638 11 Left 1139911632 16:70400852-70400874 CCTCATCAGGGCTCCTGGCTCTA 0: 1
1: 1
2: 0
3: 17
4: 229
Right 1139911638 16:70400886-70400908 CCCCAGCAGCACTGGCTCAAAGG 0: 1
1: 0
2: 2
3: 33
4: 353
1139911628_1139911638 22 Left 1139911628 16:70400841-70400863 CCGCCCACAGGCCTCATCAGGGC 0: 1
1: 0
2: 2
3: 20
4: 261
Right 1139911638 16:70400886-70400908 CCCCAGCAGCACTGGCTCAAAGG 0: 1
1: 0
2: 2
3: 33
4: 353
1139911624_1139911638 24 Left 1139911624 16:70400839-70400861 CCCCGCCCACAGGCCTCATCAGG 0: 1
1: 0
2: 0
3: 22
4: 204
Right 1139911638 16:70400886-70400908 CCCCAGCAGCACTGGCTCAAAGG 0: 1
1: 0
2: 2
3: 33
4: 353
1139911626_1139911638 23 Left 1139911626 16:70400840-70400862 CCCGCCCACAGGCCTCATCAGGG 0: 1
1: 0
2: 5
3: 28
4: 271
Right 1139911638 16:70400886-70400908 CCCCAGCAGCACTGGCTCAAAGG 0: 1
1: 0
2: 2
3: 33
4: 353
1139911634_1139911638 -2 Left 1139911634 16:70400865-70400887 CCTGGCTCTAATCCACGGAGACC 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1139911638 16:70400886-70400908 CCCCAGCAGCACTGGCTCAAAGG 0: 1
1: 0
2: 2
3: 33
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139911638 Original CRISPR CCCCAGCAGCACTGGCTCAA AGG Intronic
900479707 1:2892055-2892077 CACCAGCTGCCCTGGCTCAGAGG + Intergenic
900785191 1:4644849-4644871 GTCCAGCAGCACTGGAACAAAGG + Intergenic
900841698 1:5053993-5054015 ACCCTGGAGAACTGGCTCAAAGG + Intergenic
900990644 1:6096772-6096794 CCCCAGGGGCACTGGCCCCATGG - Intronic
901203883 1:7483095-7483117 CCCCAGCAGCCCGAGGTCAAGGG + Intronic
902359634 1:15935363-15935385 CCCCAGCAGTACTGCATCTACGG + Exonic
902581773 1:17412244-17412266 CCCACGCAGCTATGGCTCAAGGG + Intronic
904382010 1:30117825-30117847 GCCCTGCAGCACTGGCGCTAAGG + Intergenic
904577841 1:31516957-31516979 CAGCAGCAGAACAGGCTCAAAGG + Intergenic
904677175 1:32205680-32205702 AACCAGCAGCTCTGGCTCCATGG - Exonic
905375641 1:37518424-37518446 CCCCAGCAGTGCTGGCCCACCGG + Intergenic
906201908 1:43965964-43965986 CCACAGCAGCACTGGCTCCTTGG + Intronic
907316644 1:53576765-53576787 CCACACCAGCACAGGCTCGAGGG + Intronic
907520356 1:55019719-55019741 CCCCAGCAGCCCGGGCCCCAGGG - Intergenic
907685813 1:56609991-56610013 CCCCTCCAGCATTGGCTGAAAGG - Intronic
908767778 1:67569845-67569867 ACCCCGCAACATTGGCTCAAGGG - Intergenic
909377063 1:74952235-74952257 CCCCAGCAGTGCTGGCCCACCGG - Intergenic
911305223 1:96224526-96224548 CCCCAGCAGTGCCGGCCCAACGG - Intergenic
912538743 1:110396521-110396543 CCCCAGCAGTGCTGGCCCACCGG - Intergenic
912657356 1:111499005-111499027 CCTCAACATCCCTGGCTCAAGGG - Intronic
913445827 1:118949738-118949760 TTCCATCAGCACTGGTTCAATGG + Intronic
915097379 1:153472896-153472918 CCACCCCAGAACTGGCTCAATGG - Intergenic
916256091 1:162789626-162789648 CCCCAGTAGCAAAGGATCAAAGG - Intergenic
916488293 1:165278842-165278864 CCTCAGCAGCACTGGGTGCAGGG - Intronic
917929033 1:179811321-179811343 CTCAAGCTGCACTGGCACAATGG - Intronic
918002250 1:180508774-180508796 CCCCAGCAGTACCGGCCCACCGG + Intergenic
918476281 1:184928376-184928398 CCCCAACTCCACTGGCTCCAAGG + Intronic
919904473 1:202068625-202068647 CCCCACCAGCCCTTGCTCAAAGG + Intergenic
921801817 1:219410824-219410846 CCCCAGCAGTGCTGGCCCACCGG + Intergenic
921897107 1:220412604-220412626 CCCCAGCAGTGCTGGCCCACCGG + Intergenic
922352564 1:224746257-224746279 ACCCAACAGCACTGGTTCACGGG + Intergenic
923305745 1:232686591-232686613 CAGCAGCAGCCATGGCTCAAGGG + Intergenic
924305955 1:242689600-242689622 CCCCAGCAGTGCTGGCCCACCGG + Intergenic
1063300384 10:4845103-4845125 CCCCAGCAGTGCTGGCCCACCGG - Intronic
1064197800 10:13259778-13259800 CCCCAGCAGTGCTGGCCCACCGG + Intergenic
1064960181 10:20954829-20954851 CCCCATCCACACTGGCTCAGAGG - Intronic
1065617358 10:27541931-27541953 CCCCAGTAGCAATGGTTCAGGGG + Exonic
1066186314 10:33013464-33013486 CCCCAGCAGTGCTGGCCCACCGG + Intergenic
1066282106 10:33927599-33927621 CCACAGCAGCTATGGCCCAAGGG + Intergenic
1066722553 10:38355280-38355302 CCCCAGTAGCAAAGGATCAAAGG - Intergenic
1068455547 10:57250011-57250033 CCCCAGCAGTGCTGGCCCACCGG + Intergenic
1068523631 10:58104621-58104643 CCACAGGAGCACTTGCCCAAGGG - Intergenic
1069617334 10:69814383-69814405 CCCCTGCTGCCCTGGCTCCATGG - Intronic
1069756083 10:70775155-70775177 GCCCCGCAGCACTGTCTCAGTGG - Intronic
1069878142 10:71575654-71575676 CCCCAGCTGGACTGGCTCCCTGG + Intronic
1070790831 10:79188391-79188413 CCCCAGCAAGACTGGCTCGGGGG - Intronic
1071003768 10:80859412-80859434 CCCCAGCAGTGCTGGCCCACTGG + Intergenic
1071037471 10:81265102-81265124 CCCCAGCAGTGCTGGCCCACCGG - Intergenic
1071085347 10:81862877-81862899 CCCCAGCAGTGCTGGCCCACTGG - Intergenic
1071563647 10:86660708-86660730 CGCCAGCAGCACAGGCTCCAAGG + Intronic
1072009311 10:91289742-91289764 CCTCAGGAGCACTGGCTCTTTGG + Intergenic
1072635433 10:97174599-97174621 CCCCAGGAGCCCAGGCGCAAGGG - Intronic
1074290723 10:112136544-112136566 CCCCAGCAGCTCTGGGTCCTCGG + Intergenic
1075361595 10:121841196-121841218 CACCAGCAGTACTGGCTTGACGG - Exonic
1075504994 10:123013692-123013714 CCCCAGCAGTGCTGGCCCACCGG - Intronic
1075537516 10:123283541-123283563 CCCCAGCAGTGCTGGCCCACCGG - Intergenic
1076841860 10:133049797-133049819 TACCAGCAGCACTGGTTCCAGGG + Intergenic
1077091247 11:779317-779339 CCCCACCTGCACTGGCCCCAAGG + Intronic
1077132050 11:977956-977978 CTCCAGCAGCACCGTCTGAAAGG - Intronic
1077152389 11:1078086-1078108 CCCCAGGAGCCCTAGCTGAAGGG + Intergenic
1077218064 11:1403336-1403358 CCACAGCGTCACTGGCTCACCGG + Intronic
1078251891 11:9623223-9623245 CCCCAGCAGTGCTGGCCCACCGG - Intergenic
1078301190 11:10133492-10133514 CCCCAGCAGTGCTGGCCCACCGG - Intronic
1078359278 11:10655938-10655960 CCCCAGCAGCCCTGCCTGCAGGG + Intronic
1078464970 11:11543521-11543543 CTCCAGCAGCACTTGGTGAATGG - Intronic
1079312052 11:19375572-19375594 CTCAAGCAGCACTGGCTTGATGG - Intronic
1080106011 11:28512519-28512541 CCCCAGCAGTGCCGGCTCACCGG - Intergenic
1080204431 11:29712819-29712841 CCCCAGCAGTGCTGGCCCACTGG + Intergenic
1080621456 11:33990272-33990294 CCCCAGCAGTGCTGGCCCACCGG + Intergenic
1081125071 11:39312001-39312023 CCCCAGCAGTGCTGGCCCACTGG + Intergenic
1081126928 11:39333257-39333279 CCCCAGCAGTGCTGGCCCACTGG - Intergenic
1081318877 11:41666159-41666181 ACCCAGCAGAGCTGGCTCCATGG + Intergenic
1084096866 11:66917153-66917175 CCTCAGCCTCACAGGCTCAAGGG + Intronic
1084175007 11:67418479-67418501 CTCCAGCAGCACAGGCAGAAAGG - Exonic
1084385466 11:68840946-68840968 CCCGTGCAGCGCTGGGTCAAGGG - Intronic
1084485381 11:69444987-69445009 CCCCCGCAGCCCTGGCTTACTGG - Intergenic
1085941141 11:81207789-81207811 CCCCAGCAGTACTGGCACACAGG + Intergenic
1086087576 11:82970845-82970867 CCCCAGCAGTGCTGGCCCACCGG + Intergenic
1091799676 12:3316965-3316987 CTCCAGCAGCACTGTCGCAGCGG - Intergenic
1092135212 12:6142369-6142391 CCCCAGCAGTGCTGGCCCACCGG + Intergenic
1092291815 12:7163949-7163971 CCCCAGCATCACTGGAACTAAGG - Intergenic
1092617142 12:10225816-10225838 CCCCAGCAGTGCTGGCCCACCGG - Intergenic
1092950483 12:13498939-13498961 CCACCCCAGCACAGGCTCAAAGG - Intergenic
1093652561 12:21661702-21661724 CCCCAGCAGCGCCGGCCCACTGG + Intronic
1093715532 12:22377079-22377101 CCCCAGCAGTGCCGGCTCACCGG + Intronic
1093921677 12:24866249-24866271 CCCCAGCAGTGCTGGCCCACCGG + Intronic
1094023723 12:25941146-25941168 CCCCAGCAGCACAGTCTGCATGG - Intergenic
1094589292 12:31805977-31805999 CCCCAGCAGTGCTGGCCCACCGG - Intergenic
1094661294 12:32472464-32472486 CCCCAGCAGTGCTGGCCCACCGG + Intronic
1095444947 12:42273890-42273912 CCCCAGCAGTGCTGGCCCACCGG - Intronic
1095685622 12:45030020-45030042 CCCCAGCAGCCCTGTATGAAGGG + Intronic
1096782939 12:54001226-54001248 CCCCAGGAGCACTGGGTGAGGGG + Intronic
1099228147 12:79993412-79993434 CCCCAGCAGTACTGGCCCACCGG - Intergenic
1100381133 12:94062967-94062989 CCCCACCACCACAGGCTAAAAGG + Intergenic
1100649816 12:96573080-96573102 TACCAGCAGCACTGGCCCACTGG - Intronic
1102826881 12:115954369-115954391 CCCCAGCTGTACTGGCCCATAGG + Exonic
1102898802 12:116620164-116620186 GCCCAGCAGTGCAGGCTCAAAGG + Intergenic
1103798412 12:123520930-123520952 CTCCAGCAGCCCTGGGTCAAAGG + Intronic
1104344501 12:127983555-127983577 CCCTAGCAGTACTGGCCCACTGG + Intergenic
1104582648 12:130022227-130022249 CCCCAGCAGTGCTGGCCCACCGG + Intergenic
1104805441 12:131586572-131586594 CCCCAGCTCCACTGGCTCTGTGG - Intergenic
1104889474 12:132133282-132133304 CCCCATCAGCCCCGGCTCCAAGG - Intergenic
1105037762 12:132938926-132938948 CCCCAGCAGTGCTGGCCCACCGG + Intronic
1105761327 13:23517508-23517530 CACCAGCAGCACAGGCTGGAGGG - Intergenic
1106078317 13:26479689-26479711 CCACAGCACCACTTGCTCATGGG - Intergenic
1106143767 13:27034142-27034164 CCCCATCAGCAGGGGCTGAATGG + Intergenic
1107550034 13:41465363-41465385 GCTGAGCAGCACTGACTCAAAGG - Intronic
1108438547 13:50425585-50425607 CCCCACCACCACTGGCTAAGGGG + Intronic
1108851606 13:54737464-54737486 CCCCAGCAGTGCTGGCCCACCGG - Intergenic
1109141057 13:58714255-58714277 CCCCAGCAGTGCTGGCCCACCGG + Intergenic
1109745828 13:66622121-66622143 CCCCAGCAGTGCTGGCCCACGGG + Intronic
1109993314 13:70087658-70087680 TCCCAGCAGCCCCAGCTCAAAGG - Intronic
1112518656 13:100077688-100077710 CCCCAGCAGTGCTGGCCCACCGG + Intergenic
1113586491 13:111469552-111469574 CAGCAGCAGCCCTGGCTCAGAGG - Intergenic
1114533288 14:23408462-23408484 CCCCAGCCTCTCTGGCTCCACGG + Intergenic
1114560299 14:23585070-23585092 CCCCAGCAGTGCTGGCCCACCGG - Intergenic
1115342573 14:32308068-32308090 TCCCAGCAGCCCTTGCTGAAAGG + Intergenic
1118699959 14:68423324-68423346 CCCCAGCGGCCCTGGCTCTCTGG + Intronic
1119761616 14:77155662-77155684 CCCTAGCAGAGCTGGCTCCACGG + Intronic
1120209859 14:81623955-81623977 CCCCAGCAGTGCTGGCCCACCGG - Intergenic
1120215730 14:81679381-81679403 CCCCAGCAGTGCTGGCTCATGGG - Intergenic
1120704759 14:87734940-87734962 CCCCAGCAGTGCTGGCCCACTGG - Intergenic
1120869946 14:89328298-89328320 CACCAGCAGCCCTGGATGAATGG + Intronic
1120869963 14:89328374-89328396 CACCAGCAGCCCTGGATGAATGG + Intronic
1120870011 14:89328640-89328662 CACCAGCAGCACTAGATGAATGG + Intronic
1121535323 14:94686899-94686921 TCCCAGGAGCACTGGCATAAGGG - Intergenic
1122306018 14:100767186-100767208 CCCCACCAGAGGTGGCTCAAGGG + Intergenic
1122361495 14:101169505-101169527 CACCAGCACCACTGGCTGATGGG + Intergenic
1122885379 14:104708220-104708242 CCCCAGATGCACTGGCTCACGGG - Intronic
1123051893 14:105547999-105548021 CCCCAGCAGTGCTGGCCCACCGG + Intergenic
1124573136 15:30883929-30883951 CCCCAGCAGTGCTGGCCCACCGG + Intergenic
1125406619 15:39358855-39358877 TCCTAGCAGCAGTGGCTCTATGG - Intergenic
1127569099 15:60223500-60223522 CCCCTGCATTCCTGGCTCAATGG - Intergenic
1127766056 15:62186750-62186772 CCCCAGCAGTGCTGGCCCACCGG - Intergenic
1128133524 15:65246280-65246302 CCCCAGCAACCCTGGCTGAGAGG + Intronic
1128598562 15:68975857-68975879 CCCCAGCAGTGCTGGCCCACTGG - Intronic
1128813297 15:70587362-70587384 CCCCAGCAGTGCTGGCCCACCGG - Intergenic
1132378783 15:101350857-101350879 GCCGACCAGCACTGGCTTAACGG + Intronic
1132667522 16:1089034-1089056 CCCTGGCAGCACAGGCTCACTGG + Intergenic
1132996579 16:2826789-2826811 CCGCAGCAGCAGCCGCTCAAGGG + Intergenic
1134803011 16:17103042-17103064 CTCCATCAGCACTGGAGCAATGG + Exonic
1137533460 16:49299338-49299360 ACCCAGCAGCAGTGGCAGAATGG - Intergenic
1137754320 16:50889429-50889451 CCCCAGCAGCCTTGGCCCAGTGG + Intergenic
1138688786 16:58749026-58749048 CCCCAGCAGTGCTGGCCCACCGG + Intergenic
1139785822 16:69391026-69391048 TGCCACCAGCACTGGCTGAAAGG - Intronic
1139911638 16:70400886-70400908 CCCCAGCAGCACTGGCTCAAAGG + Intronic
1142598548 17:1041389-1041411 CACCTTCAGCACTGGCTTAAAGG - Intronic
1142603143 17:1067023-1067045 CCCCAACACAGCTGGCTCAAAGG + Intronic
1145905141 17:28512122-28512144 CTCCAGCTACACTGGCTGAAGGG - Intronic
1146992720 17:37289772-37289794 CCCCATCAGCAAAGGCTCACTGG - Intronic
1148229169 17:45920503-45920525 CCCCAGCATTGCTGCCTCAAGGG + Intronic
1148551649 17:48554189-48554211 TCCAAGCAGCCCTGGCTGAAGGG + Intronic
1148841685 17:50502790-50502812 CCCCAGCAGCCCAGGCTGACTGG + Intergenic
1149316619 17:55444634-55444656 CCCCAGTAGCAAAGGGTCAAAGG - Intergenic
1149916393 17:60613787-60613809 CCCCAGCAGTGCTGGCCCACCGG + Intronic
1150788279 17:68180021-68180043 CCCCAGCAGTGCTGGCCCACGGG + Intergenic
1152596530 17:81240337-81240359 CCCCAGCAGCCTTGGATCCAGGG + Intronic
1153796857 18:8631533-8631555 TCTCAGCAGCACTGGCTCAAAGG - Intronic
1153820459 18:8827232-8827254 CCCAAGCAGCCCTGGCTTCATGG + Intronic
1154111531 18:11572464-11572486 TCCCAGCTGCACATGCTCAAGGG - Intergenic
1155227020 18:23737709-23737731 CCACAGCAGCATTGGCTCAGAGG + Intronic
1161122859 19:2539718-2539740 CCCCAGCTGCCCTGTCTCATTGG + Intronic
1161369125 19:3899822-3899844 ACCCAGGAGCACTGGCTCCTTGG - Intronic
1162173821 19:8814299-8814321 TCCCTGAAGGACTGGCTCAAAGG + Intronic
1162225984 19:9223268-9223290 CCGAAGCAGCACCAGCTCAATGG + Intergenic
1163720338 19:18895598-18895620 CCCACGCAGCACTGTCTGAAGGG + Intronic
1164003222 19:21125166-21125188 CCTCTGCATCCCTGGCTCAAGGG - Intronic
1164310468 19:24041487-24041509 CCCCAGCAGTGCTGGCCCACCGG + Intronic
1165095957 19:33410091-33410113 ACCCGACAGCACTGGCTCCACGG - Intronic
1165481245 19:36065794-36065816 CACCAGCGGCACTGGCTCTGTGG + Intronic
1166061153 19:40326470-40326492 CCCCAGCAGCCCTGGCCCGCCGG - Exonic
1166649715 19:44563392-44563414 CCCCAGCAGTGCTGGCCCACCGG - Intergenic
1167202334 19:48074668-48074690 CCCCTGCAGGACTGGCCCACAGG + Intronic
1167874731 19:52402288-52402310 GCCCAGCAGCACTGCCACCACGG - Intronic
1167915926 19:52740059-52740081 GCCCAGCAGCACTGACACCATGG + Intergenic
1167927463 19:52833262-52833284 GCCCAGCAGCACTGACACCATGG + Intronic
1168659898 19:58157476-58157498 CCCCAGCAGTGCTGGCCCACCGG + Intergenic
924965616 2:73827-73849 CCCCACCACCCCTGGCTCCATGG + Intergenic
925088689 2:1134910-1134932 CCCCAGCAGTTCTGGCCCACCGG - Intronic
925362433 2:3288907-3288929 CCCCAGCAGCCCTGGCCCCCTGG + Intronic
927890012 2:26742403-26742425 CCCCAGCAGCCCTGCCTTCAGGG + Intergenic
929070066 2:38020684-38020706 CCCCAGCAGTGCTGGCTCACTGG + Intronic
929533119 2:42764508-42764530 CCCCACCAGCTCTGGCTTCAGGG + Intergenic
929779232 2:44947059-44947081 CCCCAGCAGCACCAGCACCAGGG + Intergenic
929999197 2:46849583-46849605 TCCCACCAGCACTAACTCAAGGG - Intronic
931706636 2:64951742-64951764 CCCCAGCTGCCCTGGCTCACAGG - Intergenic
935173069 2:100625867-100625889 CTCCAGCAGCACTGACTCCCAGG - Intergenic
935866436 2:107392448-107392470 CCCCAGCAGTGCTGGCCCACCGG + Intergenic
936832358 2:116663114-116663136 CCAAAGCAGTACTGCCTCAATGG + Intergenic
937209590 2:120259938-120259960 CCCCAGCAGTGCTGGCCCACCGG - Intronic
937537918 2:122914083-122914105 GGCCAGCAGCAATGCCTCAAGGG + Intergenic
941651799 2:168100288-168100310 CCCCAGCAGCACAGTTACAAAGG - Intronic
942194546 2:173504563-173504585 CCCCAACAGCAGTGACTCAGAGG + Intergenic
943072226 2:183154070-183154092 CCCCTGCAGCCGTGGCTGAAAGG - Intronic
943941437 2:194002928-194002950 CCCCAGCAGTGCTGGCCCACTGG - Intergenic
944291628 2:198013725-198013747 CCCCAGCTGCACTGGTTCATTGG - Intronic
944615200 2:201452123-201452145 CCCGAGCTGCACTGGCGCAGTGG - Intronic
945922579 2:215770754-215770776 CACCAGCAGCAGTGGCTCATGGG - Intergenic
946423447 2:219578418-219578440 ACTCACCAGCACTGGCTCATTGG + Intergenic
946429066 2:219615014-219615036 CCCCAGCAGCACTGGGACGCTGG + Intronic
946644707 2:221820559-221820581 CCACAGCAGCAGTAGCTCAGGGG - Intergenic
947257141 2:228180122-228180144 CCCCAGCGGAACAGGGTCAAAGG - Intronic
947820081 2:233063336-233063358 CCCCAGCAGCACTCCCTCCCAGG + Intronic
948247205 2:236496583-236496605 CGCCAGCAGCAAGGGCTCCAGGG + Intronic
948470932 2:238178330-238178352 CACCACCAGAACTGGCTCCATGG + Intronic
948549806 2:238763510-238763532 TCTGAGCAGCACTGGCACAAAGG - Intergenic
948642340 2:239383682-239383704 CCTCAGCAGCTCTCACTCAAGGG + Intronic
1171248635 20:23632729-23632751 CCCCAGCAGCACTGGCTGTAAGG + Intronic
1173831517 20:46092023-46092045 CCCCAGCAGTGCTGGCCCACCGG + Intergenic
1176898995 21:14417253-14417275 CCACAGCAGCTCTGCCCCAAAGG - Intergenic
1177182381 21:17757775-17757797 CCCCAGCAGTGCTGGCCCACCGG - Intergenic
1179879376 21:44287095-44287117 CGCCAGCAGCCCTGACTCCAAGG + Exonic
1180194055 21:46183010-46183032 CTCCAGCTTCACTGCCTCAACGG - Exonic
1180833935 22:18920371-18920393 CCCCAGCAGCCTTGCCTCACTGG + Intronic
1181065885 22:20305868-20305890 CCCCAGCAGCCTTGCCTCACTGG - Intergenic
1182045092 22:27267928-27267950 CCACAGCAGCTCTGGTTCACAGG + Intergenic
1182359799 22:29739827-29739849 CCACAGCACCACTGGCTCCCAGG + Intronic
1183095870 22:35552026-35552048 CCCCAGCATCCCTCGCTCACTGG - Exonic
1184566930 22:45297703-45297725 CTCCAGAAGCACTTGCTGAAAGG - Intergenic
1184844227 22:47071296-47071318 CCACAGCAGCACAGGCTGTAAGG - Intronic
1185062122 22:48612554-48612576 CCCCAGCAGCCCTCGCCTAATGG + Intronic
1203284021 22_KI270734v1_random:145669-145691 CCCCAGCAGCCTTGCCTCACTGG + Intergenic
949825772 3:8163820-8163842 CTCCAGCATCACTGGCATAAAGG + Intergenic
950107655 3:10398514-10398536 CCCCAGCAGCCCAGGCTTCACGG + Intronic
950256953 3:11513430-11513452 CCCCAGCAGTGCTGGCCCACTGG - Intronic
951243743 3:20316524-20316546 CCCCAGCTGGAGTGGCTCAAAGG - Intergenic
951418278 3:22451424-22451446 CCACAGCAGCAGAAGCTCAAAGG + Intergenic
952834503 3:37591784-37591806 CCCCAGCAGCACTGGCCTTGAGG + Intronic
953056476 3:39391532-39391554 CCCCAGCATGACTGACTCCAGGG - Exonic
953666382 3:44929063-44929085 GCCCAGCAGCCGTGGCTGAAAGG - Intronic
953714612 3:45306842-45306864 CCCCAGCAGTACCGGCCCACCGG + Intergenic
954690117 3:52391303-52391325 CTTGAGCAGCACTGGCTCCAGGG - Exonic
955933451 3:64080132-64080154 CCCCAGCAGAGCTGGCTCCCAGG + Intergenic
956161942 3:66364410-66364432 CCCCAGCATCACTGGAGCACCGG - Intronic
956183934 3:66544844-66544866 CCCCAGCAGTACTTGCCCAACGG - Intergenic
957277476 3:78108561-78108583 CCCCAGCAGTGCTGGCCCATGGG + Intergenic
958419882 3:93917759-93917781 CCCCAGCAGTGCTGGCCCACTGG + Intronic
960487319 3:118269830-118269852 CCCCAGCAGTGCTGGCCCACTGG + Intergenic
960639608 3:119813094-119813116 CCCCAGCAGCACTGGCTGCCCGG - Intronic
960761665 3:121078741-121078763 CCCCAGCAGTGCTGGCCCACTGG - Intronic
961450976 3:127002173-127002195 GCCCAGCTGCACTGGCTGCAGGG - Intronic
961818071 3:129561477-129561499 CCCCAGCAGTACTGGGTCAGAGG + Intronic
961930880 3:130531473-130531495 GCAGAGCAGCACTGGTTCAATGG - Intergenic
964064072 3:152559608-152559630 CCCCAGCAGCACTGGCCTGCTGG + Intergenic
964139210 3:153378523-153378545 CCCCAGCAGTGCTGGCCCACCGG - Intergenic
964393774 3:156224109-156224131 CCCCAGCAGTGCTGGCCCACCGG - Intronic
964751869 3:160060697-160060719 CCCCAGCAGTGCTGGCCCACTGG + Intergenic
966076073 3:175937546-175937568 CCCCAGCAGTGCTGGCCCACCGG + Intergenic
966725011 3:183101070-183101092 CCCCAGCAGTGCTGGCCCACCGG + Intronic
968759945 4:2437469-2437491 CCCCAGCAGCACTGGCCACCTGG - Intronic
969105597 4:4804995-4805017 CCACAGCAGCACTGCCTCTGGGG + Intergenic
970201625 4:13614712-13614734 CCCTAGCAGCACTGGCTTCTTGG + Exonic
970408640 4:15786922-15786944 CCCCAGCAGTGCTGGCCCACTGG - Intronic
971553031 4:27978522-27978544 CCCCAGCAGTGCTGGCCCACCGG - Intergenic
972900137 4:43672531-43672553 CCCCAGCAGTGCTGGCCCACCGG + Intergenic
974333151 4:60505684-60505706 TCCCAGCAGCAGTGGCTACAAGG + Intergenic
978406525 4:108385174-108385196 CCCCAACAGCAAGGGCTGAATGG + Intergenic
979290812 4:118977237-118977259 CCCCAGCAGTGCTGGCCCACCGG - Intronic
979991471 4:127380108-127380130 CCCCAGCAGTGCTGGCCCACCGG + Intergenic
980979357 4:139641002-139641024 CCACAGCTGCACTGGCCCCATGG - Intergenic
982985772 4:162203761-162203783 CCCCAGCAGTGCTGGCCCACCGG + Intergenic
983051163 4:163049112-163049134 CCACACCAGCACTGGCCCAGTGG - Intergenic
983369761 4:166843012-166843034 CCCCAGCAGCGCCGGCCCACTGG - Intronic
985748264 5:1660031-1660053 CCCCAGCAGGACGGCCTCAGTGG - Intergenic
986233317 5:5886043-5886065 CCCCAGCATCGCTGGCTCCCAGG + Intergenic
986262546 5:6160966-6160988 CCCCAGCAGAACTGTCTGAGAGG + Intergenic
986305142 5:6508981-6509003 CCCCAGCACCTCAGGCTCAACGG + Intergenic
986355736 5:6923885-6923907 CCCCCTCAGCACTAGCTCCAAGG + Intergenic
987027399 5:13941063-13941085 TACAAGCAGCACTGGCACAATGG + Intronic
987358233 5:17083624-17083646 CCCCAGCAGTGCTGGCCCACCGG + Intronic
988793670 5:34632672-34632694 CCCCAGTAGCACTGGATCTGTGG + Intergenic
990323168 5:54649208-54649230 CCCCAGCAGTGCTGGCCCACGGG - Intergenic
991214955 5:64150253-64150275 CCCCAGCAGTGCTGGCCCACCGG + Intergenic
992429244 5:76691666-76691688 CCCCAGCAGCAAAGGGTCATGGG + Intronic
992520521 5:77545860-77545882 CCCCAGTAGCACAGGGACAATGG - Intronic
992531886 5:77659946-77659968 CCTCAGCAGAACAGGCTAAAGGG - Intergenic
993228743 5:85204448-85204470 TGCCAGCAGTACTGGCACAACGG + Intergenic
993872296 5:93267419-93267441 GCCCAGCAGCACTGGGGCAGTGG + Intergenic
994211454 5:97091143-97091165 CTCCAGAAGTACTGGCTCAGAGG - Intronic
994669763 5:102752239-102752261 CCCCAGCAGTGCTGGCCCACTGG + Intergenic
995596445 5:113753305-113753327 CCCCAGCAGTGCTGGCACAGCGG - Intergenic
995824545 5:116280350-116280372 CACAACCAGCTCTGGCTCAAAGG - Intronic
995991237 5:118242047-118242069 CCCTATCAGCATTGGTTCAATGG + Intergenic
996102235 5:119455836-119455858 CCCAAGTAGCACTGGCACTAGGG + Intronic
998921832 5:147077632-147077654 CTCCACTAGCACTGCCTCAATGG - Intronic
999307296 5:150527991-150528013 GGCCAGCAGCACTGGCTCATAGG - Exonic
999957114 5:156714601-156714623 CCCTAGGAGCAGTGGCTCAAAGG + Intronic
1003956689 6:11171239-11171261 CCCCAGCAGTGCTGGCCCACCGG + Intergenic
1004220625 6:13743378-13743400 CCCCAGCAGTGCTGGCCCACCGG + Intergenic
1004234277 6:13860312-13860334 CCCCAGCAGCGCTGCCCCACCGG + Intergenic
1004452377 6:15758944-15758966 CCCCAGCAGTGCTGGCCCACCGG - Intergenic
1004501903 6:16216994-16217016 CCCCAGCAGCGCCGGCCCACTGG + Intergenic
1006227056 6:32548110-32548132 CCCCAGCAGTGCTGGCACACCGG - Intergenic
1006521113 6:34571819-34571841 CCCCTGCAGCACTGTCACATCGG + Intergenic
1006677035 6:35771794-35771816 ACCCTGCACCCCTGGCTCAATGG + Intergenic
1007094642 6:39205720-39205742 GCCCAGCTGGACAGGCTCAAGGG - Intronic
1007351813 6:41279033-41279055 CCCCAGCAGCAAAGAATCAAAGG + Intronic
1008020607 6:46573599-46573621 CCACAGTAGCACTGGTTCCAGGG + Intronic
1008271404 6:49494728-49494750 CCCCAGCGGCACCAGCTCAAAGG + Intergenic
1009739288 6:67723227-67723249 CCCCAGCAGCACCGGCCCACTGG + Intergenic
1010135091 6:72542590-72542612 CCCCACCATCACAGGGTCAAGGG - Intergenic
1010573821 6:77508928-77508950 CCACTGCAGCAATGGCTCAGAGG + Intergenic
1011143701 6:84189542-84189564 CCCCAGCAGTGCTGGCCCACCGG + Intronic
1013081475 6:106816948-106816970 CCCCAGCAGTGCTGGCCCACCGG - Intergenic
1014739011 6:125126031-125126053 CCCCAGCAGTGCTGGCCCACTGG + Intronic
1016104720 6:140148308-140148330 CCCCAGCAGTGCTGGCCCACTGG - Intergenic
1019626084 7:2016330-2016352 CCCCACCAGTACTGGCTGAAAGG + Intronic
1020096980 7:5374730-5374752 CCCCATCAGCCCTGGTTCGAAGG - Intronic
1020263955 7:6547940-6547962 CCCCAGCAGCACTTGGCCATGGG - Intronic
1020375340 7:7478731-7478753 CCCCAGCAGTGCTGGCCCACCGG - Intronic
1021308796 7:19065654-19065676 CTGGAGCAGCAGTGGCTCAAAGG + Intronic
1021513800 7:21461423-21461445 CCCCAGCAGTACTGGCCCACTGG - Intronic
1021761265 7:23904897-23904919 CCCCAGCAGTGCTGGCCCACTGG - Intergenic
1023396195 7:39754126-39754148 CCCCAGCAGTGCTGGCCCACCGG - Intergenic
1023602268 7:41891804-41891826 ACCCAGCAGCACTGCATGAAGGG - Intergenic
1024141523 7:46467374-46467396 CCCCAGAGGCACAGGCCCAATGG - Intergenic
1024177556 7:46856559-46856581 ACCCATCATCACTGGCTAAAAGG - Intergenic
1024301813 7:47892743-47892765 CCCCTGCAGCCCTGTCTCCAAGG - Intronic
1024700627 7:51901081-51901103 CCCCAGCAGTGCCGGCTCACCGG - Intergenic
1027668758 7:81071283-81071305 CCCCAGCAGTGCTGGCCCACTGG + Intergenic
1028142508 7:87288898-87288920 CCCCAGCAGTGCTGGCCCACTGG + Intergenic
1029235358 7:99111838-99111860 TCCCTGAAGAACTGGCTCAAAGG + Intronic
1029510719 7:100993209-100993231 CCACAGCAGCCCAGGCTCAACGG + Exonic
1029511210 7:100996458-100996480 CCACAGCAGCCCAGGCTCAACGG + Exonic
1029511436 7:100997880-100997902 CCACAGCAGCCCAGGCTCAACGG + Exonic
1029511938 7:101001129-101001151 CCACAGCAGCCCAGGCTCAACGG + Exonic
1029832366 7:103275111-103275133 CCCCAGCAGTGCTGGCCCACCGG - Intergenic
1030292703 7:107888161-107888183 CCCCAGCAGTGCTGGCCCACTGG + Intergenic
1031426400 7:121610642-121610664 CCCCAGCAGGACTGAGCCAAAGG + Intergenic
1032749064 7:134818761-134818783 CCACAGAAGCTCTGGCGCAATGG - Intronic
1035683568 8:1507342-1507364 CCCCAGCAGTGCTGGCCCACCGG - Intronic
1036563603 8:9919166-9919188 CCGCAGCAGCAGTTGCTCTAGGG - Intergenic
1036729597 8:11250546-11250568 CCTTAGCAGCGCTGGCCCAATGG - Intergenic
1037439682 8:18903119-18903141 CCCTAGCAGCTCAGGCTCAGGGG + Intronic
1038376804 8:27048075-27048097 CCCCACCAGCACTGCCAAAATGG + Intergenic
1040723132 8:50350089-50350111 CCCCAGCAGCGCCGGCTCACGGG + Intronic
1040908246 8:52491211-52491233 GCCCAGAAGCACTTGCTCCAGGG - Intergenic
1041143118 8:54843745-54843767 CCCCTGCAGGACTGGAGCAAGGG - Intergenic
1041389960 8:57339332-57339354 CCCCAGCAGCACTGCCCCATTGG - Intergenic
1041873403 8:62660872-62660894 CCCCAGCTGGGCTGGCTGAATGG - Intronic
1043709889 8:83403116-83403138 CCCCAGCAGTGCTGGCCCACCGG + Intergenic
1047482834 8:125301188-125301210 CCCCAGCAGCACAGGCTGGTGGG + Intronic
1047821510 8:128526240-128526262 CCCCAGCACCACTACCACAATGG - Intergenic
1048676955 8:136793987-136794009 CCCCAGCAGTGCTGGCCCACCGG - Intergenic
1049776560 8:144408621-144408643 CCGCAGCAGCACTTGCTGCAGGG + Intronic
1049797798 8:144504522-144504544 CCCCAGCCCCACTGGCACATGGG + Intronic
1049818299 8:144618767-144618789 CCCCAGCAGGACTTGCTCCCAGG - Intergenic
1049925921 9:406999-407021 CGCCAGCAGCACTTCCTCACCGG + Exonic
1055651383 9:78410170-78410192 CCCCAGCAGTGCCGGCTCACAGG + Intergenic
1056771388 9:89480605-89480627 CCCCAGCAGTGCTGGCCCACCGG - Intronic
1057212762 9:93209690-93209712 CACCAGCAGGCCTGGCTCAGAGG - Intronic
1057218271 9:93241680-93241702 CCCCAGCATTCCTGGCTCCAAGG - Intronic
1057383914 9:94591331-94591353 CCCCAGCAGTGCTGGCCCACTGG - Intronic
1057543854 9:96001906-96001928 CCCCAGCAGTGCTGGCCCACTGG - Intronic
1057563820 9:96150612-96150634 CCCTAGAACCACTGGCTTAAAGG + Intergenic
1058365191 9:104200768-104200790 CCCCAGCAGTGCTGGCTCACTGG + Intergenic
1058620584 9:106878790-106878812 CCACAGCAGCACTGACTATATGG - Intronic
1059035494 9:110749709-110749731 CAGCAGCAGCATTGGTTCAAAGG + Intronic
1060042673 9:120312883-120312905 CCCCAGCACCACTAGCTCACAGG - Intergenic
1060325390 9:122609693-122609715 CACCAGGAGCACTGTCTCATGGG + Intergenic
1060656177 9:125374219-125374241 CCCTAGGAGCACAGGCTCCAGGG - Intergenic
1061064657 9:128269848-128269870 CCTCTGCAGCACTTGCTCTAAGG - Intronic
1061990787 9:134157550-134157572 CGGCAGCAGGACTGGCTCAGAGG - Intronic
1062028209 9:134350243-134350265 CCCCAGCCCCACTGGCTCTCTGG - Intronic
1062047311 9:134430442-134430464 CCCCAGCAGCAATGCCCCAGGGG + Intronic
1062111332 9:134783637-134783659 CCCCTGCAGCACCGGCTCGCAGG + Intronic
1186282073 X:8003462-8003484 CCCCAGCAGTGCTGGCCCACCGG - Intergenic
1187304614 X:18083976-18083998 CCCCAGCAGTGCTGGCCCACCGG + Intergenic
1187588433 X:20689745-20689767 CACCACCACCACTGGTTCAAGGG + Intergenic
1193642565 X:84029087-84029109 CCTCACCACCACTGGCTAAAGGG + Intergenic
1193797904 X:85898870-85898892 ACCCAGCAACACTGGCTGGAAGG + Intronic
1194166351 X:90521508-90521530 CCCCAGCAGTGCTGGCCCACCGG + Intergenic
1194650818 X:96512439-96512461 CCCCAGCAGTGCTGGCCCACCGG - Intergenic
1196851594 X:119943619-119943641 CCCCAGCAGCCGTGGGACAAGGG + Exonic
1197215210 X:123860379-123860401 CCCCAGCAGCGCCGGCCCGAGGG - Intronic
1197966757 X:132071791-132071813 CACCAGCTGAACTGGCACAAAGG + Intergenic
1197978761 X:132194259-132194281 CCCCAGCAGTGCTGGCCCACCGG + Intergenic
1198694453 X:139320975-139320997 CCCCAGCAGTGCTGGCCCACTGG + Intergenic
1199258428 X:145744009-145744031 CCCCAGCAGCAGTGGCAGCATGG + Intergenic
1199557674 X:149126745-149126767 GCCCAGCAGCAGTTCCTCAAGGG + Intergenic
1199608666 X:149595709-149595731 CCCAAGGCGCACTGGCTCAGGGG + Intergenic
1199630456 X:149773651-149773673 CCCAAGGCGCACTGGCTCAGGGG - Intergenic
1199884694 X:152007874-152007896 CCCCACCAGCAATGGAACAAAGG + Intergenic
1201145825 Y:11065014-11065036 CTCCATCAGCACTGGGGCAAGGG - Intergenic
1201495686 Y:14589971-14589993 CCCCAGCAGTGCTGGCCCACTGG - Intronic
1201496931 Y:14598384-14598406 CCCCAGCAGCGCTGGCCCACCGG - Intronic
1202235763 Y:22708683-22708705 CCCCAGCCGGGCTGGCTCACCGG + Intergenic
1202307400 Y:23487485-23487507 CCCCAGCCGGGCTGGCTCACCGG - Intergenic
1202563405 Y:26183101-26183123 CCCCAGCCGGGCTGGCTCACCGG + Intergenic