ID: 1139913352

View in Genome Browser
Species Human (GRCh38)
Location 16:70412503-70412525
Sequence GCGTGGTGGCATGTTTCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 493
Summary {0: 1, 1: 1, 2: 13, 3: 101, 4: 377}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139913345_1139913352 11 Left 1139913345 16:70412469-70412491 CCCTATCTCTACAAAAAATACAA 0: 420
1: 12632
2: 171923
3: 241397
4: 144993
Right 1139913352 16:70412503-70412525 GCGTGGTGGCATGTTTCTGTAGG 0: 1
1: 1
2: 13
3: 101
4: 377
1139913346_1139913352 10 Left 1139913346 16:70412470-70412492 CCTATCTCTACAAAAAATACAAA 0: 4530
1: 102448
2: 256591
3: 163839
4: 90505
Right 1139913352 16:70412503-70412525 GCGTGGTGGCATGTTTCTGTAGG 0: 1
1: 1
2: 13
3: 101
4: 377
1139913344_1139913352 30 Left 1139913344 16:70412450-70412472 CCTGGGCAACACGACAACACCCT 0: 1
1: 9
2: 417
3: 6101
4: 31251
Right 1139913352 16:70412503-70412525 GCGTGGTGGCATGTTTCTGTAGG 0: 1
1: 1
2: 13
3: 101
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139913352 Original CRISPR GCGTGGTGGCATGTTTCTGT AGG Intronic
900362313 1:2294947-2294969 GGGTGGTGGCAGGGCTCTGTGGG + Intronic
901316508 1:8313639-8313661 GCGTGGTGGCGTGCACCTGTAGG - Intergenic
901693861 1:10991968-10991990 GCATGGTGGCATGTAACTGTAGG + Intergenic
901906136 1:12413343-12413365 GCGTGGTGGTATGTACCTGTAGG + Intronic
902424048 1:16305247-16305269 GCGTGGTGGCATGCACCTGTGGG + Intronic
902775144 1:18669943-18669965 GCGTGGTGGCACGTGCCTGTAGG + Intronic
903200744 1:21736126-21736148 GTGTGGTGGCACTTATCTGTAGG + Intronic
903521612 1:23955009-23955031 GTGTGGAGGCATGTTTATGAAGG - Intergenic
903594120 1:24480937-24480959 GCGTGGTGGCGTATGCCTGTAGG - Intergenic
904690417 1:32289694-32289716 GCGTGGTGGTGTGTGCCTGTAGG - Intergenic
905114039 1:35621855-35621877 GTATGGTGGCATGTGCCTGTAGG + Intronic
905185032 1:36190139-36190161 GCATGGTGGCATATGCCTGTAGG - Intergenic
905759186 1:40539357-40539379 GTGTGGTGGCATGTGCCTGTAGG + Intronic
907496530 1:54848915-54848937 GTATGGTGGCAAGTATCTGTAGG - Intergenic
908705423 1:66948758-66948780 GCATGGTGGCATGCACCTGTAGG + Intronic
909244101 1:73255078-73255100 GCGTGGTGGCAAGCATCTGTAGG - Intergenic
909687273 1:78364341-78364363 GCGTGGTGGCACGCACCTGTAGG - Intronic
909896735 1:81080658-81080680 GTGTGGTGGCATGTGCCTGTAGG - Intergenic
910584670 1:88866226-88866248 GCGTGGTGGCATGTGCCTGTAGG + Intronic
910952698 1:92667752-92667774 GCGTGGTGGCATGTGCCTGTAGG - Intronic
911406590 1:97448083-97448105 GCATGGTGGCATGCACCTGTAGG + Intronic
911475902 1:98371940-98371962 GGGGTGTGGCATGTTGCTGTTGG + Intergenic
911985861 1:104621018-104621040 GTGTGGTGGCAAGTTCTTGTAGG + Intergenic
914761298 1:150600757-150600779 GCATGGTGGCACGTGCCTGTAGG + Intergenic
916862633 1:168823010-168823032 GCCTGTTGGGATGTTTCTGATGG + Intergenic
917427533 1:174930454-174930476 GCATGGTGGCATGTGACTGCAGG - Intronic
917823288 1:178789043-178789065 GCGTGGTGGCATGCACCTGGAGG - Intronic
918620177 1:186594748-186594770 GCATGGTGGCATGTGTGGGTGGG + Intergenic
918761948 1:188420984-188421006 GTGTGGTGGCGTGTGCCTGTAGG - Intergenic
919204768 1:194407646-194407668 GCGTGGTGGCATGTACAGGTGGG + Intergenic
919912380 1:202119423-202119445 GCATGGTGGCATGTGCCTGTGGG + Intergenic
920586110 1:207163007-207163029 ACGTGGTGGCAGGTGCCTGTAGG + Intergenic
920778460 1:208964560-208964582 GCGTGGTGGCACGTGCCTGTTGG - Intergenic
921864071 1:220070300-220070322 GAGTGAGGGCATGTTTCTGATGG + Intronic
922426691 1:225503412-225503434 GCATGGTTGCATGTGCCTGTGGG - Intronic
923282288 1:232455540-232455562 GCGTGGTGGCGGGTGCCTGTAGG + Intronic
923478790 1:234363219-234363241 GCATGGTGGCGTGTGCCTGTAGG + Intergenic
923669578 1:236029036-236029058 GTGTGGTGGCATGTGCCTGTAGG + Intronic
924248841 1:242110669-242110691 GTGTGGTGGCATGTGCCTGCAGG + Intronic
1063199378 10:3772899-3772921 CCCAGGTGGCATTTTTCTGTTGG - Intergenic
1064053736 10:12080139-12080161 GCGTGGTGGCGGGTGCCTGTGGG + Intronic
1066419284 10:35249069-35249091 GAGTGGTGGCATGCACCTGTTGG - Intronic
1066471676 10:35703885-35703907 GTGTGTTGACATGTTTGTGTTGG - Intergenic
1066536489 10:36397723-36397745 GCATGGTGGCACGTGCCTGTAGG - Intergenic
1068413836 10:56691142-56691164 TGGTGGTGGCAATTTTCTGTCGG + Intergenic
1068454161 10:57233803-57233825 GCGTGGTGGCTGGTGCCTGTAGG + Intergenic
1069382310 10:67853423-67853445 GCCTGGTGGCATGCATCTGTAGG + Intergenic
1069401023 10:68046830-68046852 GCGTGGTGGCACACATCTGTGGG + Intronic
1069521010 10:69121511-69121533 GAGTGGTGGCATGTGCCTATTGG - Intergenic
1069691938 10:70359413-70359435 GTGTGGTGGCATGCACCTGTGGG + Intronic
1070629492 10:78074858-78074880 GCGTGGTGGCATGCACCTGTAGG - Intergenic
1071097375 10:81993483-81993505 TTGTGGTGGCATGCATCTGTAGG - Intronic
1073305283 10:102498601-102498623 GCTTGGTGGCATGCACCTGTAGG - Intronic
1073370218 10:102981527-102981549 GTGTGGTGGCATGCACCTGTGGG - Intronic
1073397623 10:103230992-103231014 GCGTGGTAGCACGTATATGTAGG + Intergenic
1073525312 10:104175736-104175758 GCGTGGTGGCACATGTCTGCAGG - Intronic
1073601511 10:104850444-104850466 GCATGGCGGCATGTGCCTGTAGG + Intronic
1074804117 10:117030025-117030047 GCGTGATGGCATGCACCTGTAGG - Intronic
1075109507 10:119566741-119566763 GCATGGTGGCATGCCCCTGTGGG - Intergenic
1076064065 10:127434789-127434811 GCATGGTGGCATGTGCCTGTAGG - Intronic
1078660479 11:13281646-13281668 GTGTGATGGCACGTGTCTGTAGG - Intronic
1079695865 11:23481979-23482001 GCATGGTGGCATGCACCTGTAGG + Intergenic
1080399504 11:31921036-31921058 GCATGGTGGCATATGCCTGTAGG - Intronic
1082766604 11:57173574-57173596 GCATGGTGGCATGCACCTGTGGG - Intergenic
1083211032 11:61186290-61186312 ACGTGGTGGCACGTGCCTGTAGG - Intergenic
1084913161 11:72407783-72407805 GCGTGGTGGCAGGCACCTGTAGG - Intronic
1084989321 11:72908789-72908811 GCATAGTGGCATATGTCTGTAGG - Intronic
1085059627 11:73433048-73433070 GCGTGGTGGCACGCACCTGTAGG - Intronic
1085158359 11:74317687-74317709 GTGTGGTGGCATGGGCCTGTGGG - Intergenic
1085586885 11:77717037-77717059 GCATGGTGGCTTGTGCCTGTAGG + Intronic
1085649487 11:78254658-78254680 GCGTGGTGGTGTGTGCCTGTAGG + Intronic
1086258734 11:84912292-84912314 GCGTGGTGGCGGGTGCCTGTAGG - Intronic
1086903573 11:92394331-92394353 GGGTGGTGGCATGCACCTGTAGG + Intronic
1087046689 11:93849294-93849316 GTGTGGTGGCCTGTGCCTGTAGG - Intronic
1087317611 11:96622525-96622547 GCATGGTGGCACATATCTGTTGG - Intergenic
1088493306 11:110407212-110407234 GTGTGGTGGCTTGTGCCTGTAGG - Intergenic
1089125119 11:116171479-116171501 TTGTGGTGGCATGTGTGTGTTGG + Intergenic
1090956175 11:131514725-131514747 GCGTGGTAGCATGGACCTGTAGG - Intronic
1091226653 11:133960770-133960792 ATGTGGTGGCATGTGCCTGTAGG - Intergenic
1091313751 11:134596238-134596260 GCATGGTGGCATGTGACTGTAGG - Intergenic
1091422388 12:353202-353224 GCGTGGTGGCATACATCTGTAGG + Intronic
1091570061 12:1677318-1677340 GCATGGTGGCATGTACCCGTAGG - Intergenic
1091730873 12:2879140-2879162 GTGTAGTGGCATGTGCCTGTAGG - Intronic
1092138220 12:6164412-6164434 GCATGGTGGCATGCGCCTGTAGG + Intergenic
1094527787 12:31243989-31244011 GTGTGGTGGCAGGTGCCTGTGGG - Intergenic
1096325228 12:50654491-50654513 ATGTGGTGGCATGTGCCTGTAGG - Intronic
1096354149 12:50925898-50925920 GCATGGTGGCAGGTGCCTGTAGG + Intronic
1096378380 12:51133786-51133808 GCATGGTGGCAGGTGCCTGTAGG + Intronic
1096809579 12:54160958-54160980 GAGTGTTTGCATGTTTCTGAGGG - Intergenic
1097172311 12:57123461-57123483 CTGTGGTGGCATGCATCTGTAGG - Intronic
1097638799 12:62154052-62154074 GTGTGGTGGCAGGTGCCTGTAGG - Intronic
1097648440 12:62264121-62264143 GCGTGGTGGCATGTGCCTGCAGG - Intronic
1097939027 12:65283568-65283590 GCATGGTGGCAGGTGCCTGTAGG - Intronic
1098256158 12:68617900-68617922 GCATGGTGGCATGCGCCTGTAGG - Intronic
1098333577 12:69379550-69379572 TAGTGGTGGCATGTGCCTGTGGG - Intronic
1099187843 12:79535143-79535165 CCGTGGTGGCATGTGCCTGTAGG + Intergenic
1099588516 12:84554191-84554213 GCGTGGTGGCGGGCGTCTGTAGG - Intergenic
1100698019 12:97116844-97116866 GCGTGGTGGCAGGCGCCTGTAGG - Intergenic
1102332225 12:112044064-112044086 GCGTGGTGGCAGGCGCCTGTAGG - Intronic
1102808939 12:115807140-115807162 GTGTGGTGGCATGCATCTGTGGG - Intergenic
1103444756 12:120987334-120987356 GCGTGGTGGCGGGTGCCTGTAGG + Intronic
1103584452 12:121941470-121941492 GTGTGGTGGCACGTGCCTGTGGG - Intronic
1104003057 12:124872695-124872717 GTGTGGTGGCACATGTCTGTAGG - Intronic
1104693332 12:130843194-130843216 GCATGGTGGCATGTGCCTGTAGG + Intergenic
1105302360 13:19147471-19147493 GCGTGGTGGCGCGTGGCTGTAGG + Intergenic
1106449592 13:29868076-29868098 GCGTGGTGGCATGCACCTGCAGG + Intergenic
1106547206 13:30741242-30741264 GCGTGGTGGCAGGCACCTGTAGG - Intronic
1108073457 13:46653690-46653712 GCGTGGTGGCGTGCACCTGTAGG + Intronic
1108102441 13:46970917-46970939 GTGTGGTGGCATGCACCTGTAGG + Intergenic
1108355770 13:49627724-49627746 GCGTGGTGGCACCTACCTGTAGG - Intergenic
1108398105 13:50009596-50009618 GTGTGGTGGTATGTGCCTGTAGG + Intronic
1108420078 13:50239913-50239935 GCGTGGTGGCACGTGCCTGTAGG - Intronic
1111797890 13:92946550-92946572 GCGTGGTGGCAGGCGCCTGTGGG - Intergenic
1111885736 13:94018426-94018448 ATGTGGTGGCATGTGCCTGTAGG - Intronic
1112334605 13:98503839-98503861 GAGTCGTGGCATGTTCCTGGGGG - Intronic
1112453773 13:99538651-99538673 GCATGGTGGCATGTGCCTGTAGG + Intronic
1112960502 13:105119997-105120019 GCGTGGTGGCATGAGCCTATGGG + Intergenic
1113143553 13:107182411-107182433 GCGTGGTGGCATTCACCTGTAGG - Intronic
1113770675 13:112906459-112906481 GCGTGTGTGCATGTTCCTGTGGG - Intronic
1114309276 14:21452177-21452199 GCGTGGTGGCGTGGTCCTGTAGG - Intronic
1114693027 14:24602379-24602401 GCGTGGTGGCGGGCGTCTGTAGG + Intergenic
1115854382 14:37614423-37614445 GTGTTGTGGGATGTTTATGTAGG - Intronic
1116213468 14:41978212-41978234 GTGTGGTGGCAGGTGCCTGTAGG - Intergenic
1116567469 14:46467642-46467664 GCGTGGTGGCGGGTGCCTGTAGG + Intergenic
1116821428 14:49631484-49631506 GCGTGGTGGCAGGTGCCTGTAGG + Intronic
1116924688 14:50622253-50622275 GCACGGTGGCATGTGCCTGTAGG + Intronic
1116940120 14:50783185-50783207 GCGTGGTAGCAGGCATCTGTAGG - Intronic
1118015602 14:61657300-61657322 GGGTGGTGGCATTTACCTGTAGG - Intronic
1119634197 14:76260889-76260911 GCCTGGTGGCATGCACCTGTAGG + Intergenic
1119668822 14:76503471-76503493 GCATGGTGGCACGCATCTGTAGG + Intergenic
1119820736 14:77614523-77614545 GCGTGGTGGCGGGTGCCTGTAGG + Intronic
1120782440 14:88497638-88497660 GCGTGGTAGCAGGTACCTGTAGG + Intronic
1122596507 14:102896932-102896954 TGGTGGTGGCATGTACCTGTAGG + Intronic
1122733844 14:103823197-103823219 GCGTGGTGGCGGGTGCCTGTAGG + Intronic
1122943105 14:104991923-104991945 GCGTGGTGGCATGTGCGTGGCGG - Intronic
1123807842 15:23893609-23893631 GCATGGTGGCATGCACCTGTAGG - Intergenic
1124124209 15:26923616-26923638 GTGTGCTTGCTTGTTTCTGTAGG + Intronic
1124136348 15:27039189-27039211 GCATGTCAGCATGTTTCTGTGGG + Intronic
1124358231 15:29014843-29014865 GCCTGGTGCCATGTACCTGTAGG - Intronic
1124912622 15:33937392-33937414 GCGTGGTGGCAGGCGCCTGTAGG + Intronic
1125558487 15:40606896-40606918 GCATGGTGGCATGTTCCTGTAGG - Intronic
1125955748 15:43790001-43790023 GCGTGGTGGCACGCACCTGTAGG + Intronic
1126127653 15:45310393-45310415 GTGTGGTGGCATGCATCTGTGGG + Intergenic
1126664183 15:51060995-51061017 GCATGATGGCATGCATCTGTAGG + Intronic
1126847204 15:52771982-52772004 GCTTTGTGGGATCTTTCTGTGGG + Intronic
1127660838 15:61098477-61098499 GCATGATGGCATGTGCCTGTAGG - Intronic
1128382355 15:67122359-67122381 GGGTGGTGGCTGGTTTCTCTTGG + Intronic
1129050072 15:72773978-72774000 GCATGGTGGCATGTGCCTGTGGG - Intronic
1129338442 15:74868679-74868701 GTGTGGTGGCATGCACCTGTGGG - Intronic
1129644031 15:77413960-77413982 GTGTGGTGGCATGTGCCTGTGGG - Intronic
1129976656 15:79828071-79828093 GAGTGGTGGCATGTGCCTGTAGG + Intergenic
1130942475 15:88523019-88523041 GTGTGGTGGCATGCGCCTGTCGG - Intronic
1130962000 15:88666248-88666270 GCGTGGTGGCAGGCGCCTGTAGG + Intergenic
1131101969 15:89698994-89699016 GCGTGGTGGCATGTGCTTGGAGG - Intronic
1132525848 16:414274-414296 GTGTGGTGGCATGCACCTGTAGG - Intergenic
1133191236 16:4135077-4135099 GCGTGGTGGCACACTCCTGTAGG + Intergenic
1134323456 16:13185338-13185360 GCATGGTGTCATGTCCCTGTAGG - Intronic
1135332867 16:21575589-21575611 GTGTGGTGGCATGCATCTGTAGG + Intergenic
1135661958 16:24304697-24304719 GCATGGTGGCGTGTACCTGTAGG - Intronic
1136178274 16:28533509-28533531 GTGTGGTGGCTTGTGCCTGTGGG - Intronic
1137623832 16:49895092-49895114 GCATGGTGGCATGTGCCTATAGG + Intergenic
1138665780 16:58567013-58567035 GCATGGTGGCATGCGTCTATAGG + Intronic
1138725597 16:59135315-59135337 GCATGGTGGCATGCACCTGTAGG + Intergenic
1139913352 16:70412503-70412525 GCGTGGTGGCATGTTTCTGTAGG + Intronic
1140046849 16:71445303-71445325 GCGTGGTGGCGGGTGCCTGTAGG + Intergenic
1140187664 16:72788983-72789005 GCCTGGTGGGATACTTCTGTTGG - Intronic
1140306483 16:73807593-73807615 GCATGGTGGAATGTGCCTGTAGG - Intergenic
1140859904 16:79009587-79009609 GTGTGGTGGCATGTGCCTATGGG - Intronic
1142388396 16:89781860-89781882 GCGTGGTGGCAGGCATCTGTAGG + Intronic
1142407160 16:89896690-89896712 GCGTTGTGGCACGTGCCTGTAGG - Intronic
1142543556 17:681273-681295 GTGTGGTGGCATGCACCTGTAGG - Intronic
1142553678 17:757206-757228 GTGTGGTGGCACGTGGCTGTGGG + Intronic
1142774813 17:2128683-2128705 GCGTGGTGGCGTGCACCTGTAGG + Intronic
1143224971 17:5293543-5293565 GCATGGTGGCATGTGCCTATAGG - Intronic
1143429471 17:6870214-6870236 GTGTGTTGTCATGTGTCTGTAGG - Intergenic
1145112670 17:20177846-20177868 GCGTGGTGGCACATGCCTGTGGG - Intronic
1146230815 17:31107401-31107423 GCATGGTGGCATGCACCTGTGGG - Intronic
1146719167 17:35111240-35111262 GCCTGGTGGCATGTGCCTGTAGG + Intronic
1146851336 17:36224426-36224448 GCGTGGTGGCAGGTGCCTGTAGG - Intronic
1146867249 17:36348299-36348321 GCGTGGTGGCAGGTGCCTGTAGG - Intronic
1147070124 17:37948910-37948932 GCGTGGTGGCAGGTGCCTGTAGG - Intergenic
1147081645 17:38028436-38028458 GCGTGGTGGCAGGTGCCTGTAGG - Intronic
1147097596 17:38152406-38152428 GCGTGGTGGCAGGTGCCTGTAGG - Intergenic
1147588124 17:41664695-41664717 TCATGGTGGCATGCATCTGTAGG + Intergenic
1148105648 17:45117382-45117404 GTGTGGGGGCATGTGCCTGTAGG - Intronic
1148427472 17:47611609-47611631 GCATGGTAGCATATGTCTGTAGG - Intronic
1148512728 17:48186605-48186627 GCATGGTGGCATGTGCCTGTAGG - Intronic
1148789110 17:50163264-50163286 GCATGGTGGCACGTGCCTGTAGG + Intergenic
1150079297 17:62222526-62222548 GCGTGGTGGCAGGCGCCTGTAGG - Intergenic
1150578236 17:66449148-66449170 GTGTGGTGGCATGTGCCTGTAGG + Intronic
1150881019 17:69028303-69028325 GCATGGTGGCAGGTGCCTGTAGG - Intronic
1151539510 17:74758000-74758022 GCGGGCTGGGCTGTTTCTGTAGG + Intronic
1151609083 17:75159617-75159639 GTGTGGTGGCATGTGCCTGTAGG - Intronic
1151905363 17:77044819-77044841 GCGTGGTGGCGCGTGTCTGTAGG + Intergenic
1152415887 17:80161610-80161632 GCATGGTGGCATGTGCTTGTGGG - Intergenic
1152483968 17:80577414-80577436 GTGTGGTGGCATGCACCTGTAGG - Intronic
1153029764 18:702599-702621 GCATGGTGGCTTGTGCCTGTGGG + Intronic
1153034256 18:744526-744548 GCGTGGTGGCATGCACCTGTAGG - Intronic
1153956496 18:10100991-10101013 GCCTGGTGGCAATTTTCTGAGGG - Intergenic
1154248657 18:12723528-12723550 GCATGGTGGCATGTGCCTGTAGG - Intronic
1155460745 18:26079719-26079741 GTGTGGTGGTATGTGCCTGTGGG - Intronic
1156284191 18:35674842-35674864 GCGTGGTGGCAGGCACCTGTAGG + Intronic
1156328586 18:36097872-36097894 GCATGGTGGCATGTGCCTGTGGG - Intergenic
1159446717 18:68549905-68549927 GCGTGGTGGCAGGCACCTGTAGG - Intergenic
1159506983 18:69351432-69351454 GTGTGCTGGCATGTACCTGTGGG + Intergenic
1159736102 18:72099770-72099792 GCATGGTGGCATGTGTCTGTAGG + Intergenic
1161569264 19:5021454-5021476 GTGTGGTGGCATGTACCTGTGGG + Intronic
1162611954 19:11762737-11762759 CCATGGTGGCATGTCCCTGTAGG + Intergenic
1162996992 19:14342520-14342542 GCGTGGTGGCACTTGCCTGTAGG - Intergenic
1163555720 19:17991592-17991614 GCATGGTGGCACGTGCCTGTAGG + Intronic
1163808110 19:19412491-19412513 GTGTGGTGGCATGCATCTGTAGG + Intronic
1164993352 19:32700566-32700588 GCGTGGTTGCAGGTGCCTGTGGG - Intronic
1164998098 19:32738179-32738201 GCCTGGTGGCAGCTTCCTGTTGG + Intronic
1165176051 19:33930650-33930672 GTGTGGTGGCGTGTGTCTGTAGG - Intergenic
1165620019 19:37237999-37238021 GCGTGGTGACGTGTGCCTGTGGG - Intronic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
1166691472 19:44823825-44823847 GTGTGATGGCATGTGCCTGTGGG - Intergenic
1167140298 19:47645957-47645979 GCGTGGTGGCATGCGCCTGTAGG + Intronic
1167737485 19:51304891-51304913 GCATGCTGGCATGCATCTGTAGG + Intergenic
1168025857 19:53643185-53643207 GCATGGTGGCATGTACCTGTTGG - Intergenic
1168095231 19:54110587-54110609 GCGTGGTGGCAGGTGCCTGCAGG + Intronic
1168221189 19:54961685-54961707 GCATGGTGGCAGGTGCCTGTAGG + Intronic
1168334350 19:55588864-55588886 GTGTGGTGGCGTGTGCCTGTAGG - Intergenic
1168366398 19:55791907-55791929 TCATGGGGGCATCTTTCTGTTGG - Intronic
925159615 2:1674963-1674985 GCGCGCTGGCAGGTTTCTGAGGG - Intronic
925809032 2:7680297-7680319 GCGTGGTGGTGTGTGTCTGTGGG - Intergenic
925948662 2:8890656-8890678 GTGTGGTAGCATGTACCTGTAGG - Intronic
925962234 2:9028434-9028456 GCGTGGTGGCATGGGTCTTCAGG - Intergenic
926240633 2:11082120-11082142 GCGTGGTGGCATGTGCCTGTAGG - Intergenic
926289719 2:11518959-11518981 GCGTGGTGGTAGGTGCCTGTAGG + Intergenic
927274278 2:21248723-21248745 GCATGGTGGCATGCACCTGTAGG - Intergenic
927585951 2:24305455-24305477 GCGTGGTGGCGTGTGCCTGTAGG + Intronic
928050358 2:27987674-27987696 GCATGGTGACATGTTCCTGTAGG + Intronic
928513954 2:32027765-32027787 GCGTGGTGGCAGGTGCCTGTAGG - Intronic
928688403 2:33773869-33773891 GCATGGTAGCATGTCCCTGTAGG - Intergenic
928988426 2:37204414-37204436 GCGTGGTGGCATGCACTTGTAGG - Exonic
929237813 2:39625071-39625093 GCGTGGTGGCACGTGCCTATAGG + Intergenic
929736387 2:44554735-44554757 GTGTGGTGGCATATGTCTGTAGG + Intronic
929747422 2:44673286-44673308 GTATGGTGGCATGTACCTGTGGG + Intronic
930111670 2:47684111-47684133 GCGTGGTGGCAGGCGCCTGTAGG + Intergenic
930561901 2:52969992-52970014 GCGTGGTGGCGGGTGCCTGTGGG + Intergenic
930807461 2:55505422-55505444 GCCTGGTGGCATGTGCCTGTAGG - Intergenic
931372154 2:61673641-61673663 GTGTGGTGGTATGTGCCTGTAGG - Intergenic
931731440 2:65157007-65157029 GTGTGGTGGCAGGTGCCTGTGGG + Intergenic
932394899 2:71436652-71436674 GCGTGGTGGCACATGTCCGTAGG - Intergenic
933251435 2:80033432-80033454 GCTTGGTGGCATGCACCTGTAGG + Intronic
933756922 2:85647025-85647047 GCCTGGTGGCAGGTGCCTGTAGG - Intronic
936501021 2:113066415-113066437 GCATGGTGGCATGCACCTGTAGG - Intergenic
936560986 2:113539723-113539745 GCGTGGTGGCATGTACCTGTAGG + Intergenic
937696899 2:124818382-124818404 GCATGGTGACATGTGACTGTAGG + Intronic
938989374 2:136612218-136612240 GCATGGTAGCATGCATCTGTAGG - Intergenic
944557929 2:200906348-200906370 GGGTGGTGGCAGGTGCCTGTAGG - Intergenic
946709934 2:222495273-222495295 GTGTGGTGGCATGTGCCTGTGGG + Intronic
946846724 2:223865709-223865731 GCATGGTGGCATGTGCCTATAGG + Intronic
946999041 2:225432114-225432136 GCGTGGTGGCAGGCATGTGTAGG - Intronic
947153580 2:227138177-227138199 GTGTAGTGGCATGTACCTGTAGG + Intronic
947221615 2:227798706-227798728 GCGTGGTGGCATGTGCCTGTTGG - Intergenic
947629399 2:231642273-231642295 GCGTGGTGGCACGAAGCTGTAGG - Intergenic
1169094129 20:2881166-2881188 GCGTGGTGGCGTGTGCCTCTGGG + Intronic
1169107227 20:3006768-3006790 GTGTGGTGGCATGTGCCTATAGG - Intronic
1169192683 20:3668113-3668135 GCGTGGTGGTGTGTACCTGTAGG - Exonic
1169455630 20:5749990-5750012 GCATGGTGGCACATGTCTGTAGG - Intergenic
1170467422 20:16635583-16635605 GCATGGTGGCATGTGCCTGTAGG - Intergenic
1170906855 20:20524093-20524115 GCGTGGTGGCGGGTGCCTGTAGG - Intronic
1172135919 20:32686628-32686650 GCGTGGTGGCAGGCACCTGTAGG - Intergenic
1172255250 20:33512036-33512058 GCGTGGTGGCATGCGCCTGTAGG + Intronic
1172400045 20:34642346-34642368 GAGTGGTGGTATGTGCCTGTAGG - Intronic
1172470786 20:35193312-35193334 GCGTGGTGGCATGCGCCTGTAGG - Intergenic
1174347602 20:49942118-49942140 GTGTGGTGGTATGTACCTGTAGG + Intronic
1174486059 20:50861990-50862012 GCATGGTGGCATGTGCCTGTGGG - Intronic
1174532657 20:51226319-51226341 GCGTGGTGGCGCGTGCCTGTAGG + Intergenic
1174602855 20:51738941-51738963 GCGTGGTGGCAGGTGCCTGTAGG + Intronic
1174609554 20:51787958-51787980 GCGTGGTGGCATGCGCCTGTAGG - Intronic
1175585323 20:60134538-60134560 GCATGGTGGCATATGCCTGTAGG - Intergenic
1177935594 21:27341339-27341361 GCATGGTGGCAGGGTTATGTGGG + Intergenic
1178578014 21:33812635-33812657 GCATGGTGGCATGCACCTGTAGG - Intronic
1178591901 21:33917935-33917957 GCTTGGTAGCATGTGTCTGTAGG - Intergenic
1178824262 21:36002322-36002344 GCATGGTGGCATGCACCTGTGGG + Intronic
1180636496 22:17266438-17266460 GGGGGGTGCCATGTGTCTGTAGG - Intergenic
1180665322 22:17506263-17506285 GCGTGGTGGCATGTGCCTGCAGG - Intronic
1180911154 22:19451451-19451473 GCTTAGTGGAATGTTTCTGAGGG - Intronic
1181157081 22:20929600-20929622 GTGTGGTGGCGTGTGCCTGTAGG - Intronic
1181293948 22:21819885-21819907 GCTTGGTGGCTTGTGCCTGTAGG - Intronic
1181384291 22:22532632-22532654 GCGTGGTGGCATATGCCTGCAGG - Intergenic
1182209102 22:28659405-28659427 ACGTGGTGGCATGAACCTGTAGG - Intronic
1182264602 22:29104293-29104315 GTGTGATGGCATGTGCCTGTAGG - Intronic
1182593832 22:31402646-31402668 GCATGGTGGCATATGCCTGTAGG - Intronic
1182786551 22:32912580-32912602 GGGTGGTGGCATGCACCTGTAGG + Intronic
1183081050 22:35456872-35456894 GCGTGGTGGCACATGCCTGTGGG - Intergenic
1183166354 22:36149943-36149965 GCGTGGTGGTATGTACCTGTAGG - Intronic
1184234942 22:43178284-43178306 GAGTGGTGGCGTGTTTGTGTGGG - Intronic
1184772021 22:46602879-46602901 GCGTGGTGGCATGTGCCTGTAGG - Intronic
950728671 3:14936987-14937009 GCGTGGTGGCACATGCCTGTGGG - Intergenic
952100906 3:30011933-30011955 GCGTGGTGGCAGGCGCCTGTAGG - Intergenic
952364063 3:32659501-32659523 GCGCGGTGGCAGGTGCCTGTAGG + Intergenic
953739846 3:45528196-45528218 ATGTGGTGGCATGTGTCTGTAGG + Intronic
953860760 3:46542355-46542377 GTGTGGTGGCATGCACCTGTTGG + Intronic
953954415 3:47220352-47220374 GCGTGGTGGCAGGCGCCTGTAGG - Intergenic
954159802 3:48712872-48712894 GCGTGGTGGCAGATGCCTGTAGG + Intronic
954281367 3:49581118-49581140 GCATGGTGGCACACTTCTGTAGG - Intronic
954349298 3:50029592-50029614 GCGTGGTGGCGTGTACCTGTAGG + Intronic
956236595 3:67079183-67079205 GCGTGGTGGCATACACCTGTGGG - Intergenic
956420049 3:69078610-69078632 GTATGGTGGCATGTACCTGTAGG - Intronic
957277083 3:78104453-78104475 GTGTGGTTTCATGTTTCAGTAGG + Intergenic
957550463 3:81697436-81697458 GCATGGTGGCAGGTGCCTGTAGG - Intronic
957830777 3:85515582-85515604 GCGTGGTGGCACTCTCCTGTAGG - Intronic
959061806 3:101623056-101623078 GCATGGTGGCATGCACCTGTAGG - Intergenic
960222014 3:115123941-115123963 GCTTGGTAGCTTGTTTATGTGGG - Intronic
960635183 3:119777918-119777940 GCATGGTGACATGTGCCTGTAGG + Intergenic
962113724 3:132478629-132478651 ACGTGGTGGCATGTACCTGGTGG + Intronic
962133618 3:132709419-132709441 GTGTGGTGGCGTGTGCCTGTGGG - Intronic
962578598 3:136777008-136777030 GTGTGGTGGCATGTACCTGTAGG + Intergenic
962725767 3:138225247-138225269 GCGTGGTGGCACATGCCTGTAGG - Intronic
963256014 3:143145580-143145602 GCATGGTGGCATGTGCCTGGAGG + Intergenic
965195915 3:165594096-165594118 GTGTGGTGGCATGTGTTTATAGG + Intergenic
965270988 3:166617291-166617313 GTGGGGTGGCATGCATCTGTAGG + Intergenic
965579250 3:170249651-170249673 GCATGGTGGCATGAGCCTGTGGG + Intronic
966721905 3:183072005-183072027 GCATGGTGGCACGTGCCTGTGGG - Intronic
967009278 3:185416758-185416780 GCATGGTGGCATGTGCCTGTAGG - Intronic
967300587 3:188008646-188008668 GTGTGGTGGCATGTGCCTGTAGG - Intergenic
967985748 3:195094389-195094411 GCGTGTGGGCAGGTGTCTGTTGG - Intronic
968416123 4:435611-435633 CCTTAGTGGCATGTTTCTGATGG - Intronic
970910500 4:21269542-21269564 GCATGGTGGCATGCACCTGTAGG - Intronic
972489565 4:39574377-39574399 GCATGGTGGCATGCACCTGTAGG - Intronic
972655049 4:41056053-41056075 GCATGGTGGCAGGTGCCTGTGGG + Intronic
972961168 4:44453929-44453951 GGGTGGGGGAATGTTTATGTTGG + Intergenic
973238588 4:47932655-47932677 GTGTGGTGGCACGTGTGTGTAGG + Intronic
973303564 4:48617485-48617507 GTGTGGTGGTATGTGCCTGTAGG - Intronic
975653491 4:76618163-76618185 GCGTGGTGGCATGTGCCTATAGG + Intronic
975969854 4:80020245-80020267 GCATGGTGGCATGTGCCTATAGG + Intronic
978061574 4:104345686-104345708 GATTGGTGGCATGTTTCTGGGGG - Intergenic
978637574 4:110828038-110828060 GCATGGTTTCATGTGTCTGTTGG + Intergenic
979535547 4:121816092-121816114 GCGTGGTGGCATGTGCTTGTAGG - Intronic
981800718 4:148652309-148652331 GCCTGGGGGCAGGTTTCTGAGGG + Intergenic
983497230 4:168457075-168457097 GCATGGTGGCATATGCCTGTGGG + Intronic
984187541 4:176564421-176564443 GCATGGTGGCATGCACCTGTAGG - Intergenic
985306693 4:188550320-188550342 CCTTGGTGGCATGTTTATGCTGG - Intergenic
985332725 4:188857936-188857958 GCGTGGTAGCATGTGCCTATAGG - Intergenic
985483580 5:135525-135547 GCATGGTGGCAGGTACCTGTAGG + Intergenic
987006953 5:13720519-13720541 ACGTGGTGGCCTGTGCCTGTGGG - Intronic
988643979 5:33073465-33073487 GTGTGGTGGCATGTACCTTTAGG - Intergenic
990292610 5:54368251-54368273 GAGTGTAGGCATTTTTCTGTGGG + Intergenic
990439890 5:55833804-55833826 GCGTGGTGGCAGGTGCCTGTAGG + Intergenic
990514484 5:56518951-56518973 ACGTGGGGGCATGGATCTGTGGG - Intronic
990580990 5:57167510-57167532 GTGTGGTGGCATGTGCCTGTAGG + Intergenic
992115921 5:73538542-73538564 GCATGGTGGCATGTGCCTGTAGG + Intergenic
992190620 5:74288037-74288059 GAGTGGTGGCATGTTGCGGGGGG - Intergenic
992295315 5:75321665-75321687 GTGTGGTGGCATGAGCCTGTAGG + Intergenic
992354431 5:75966650-75966672 GAGTAGTGGCATGTGGCTGTTGG - Intergenic
992446302 5:76837168-76837190 GAGTGTTGGCATGTTCCTGTAGG - Intergenic
992857825 5:80881307-80881329 CCGTGGTGGCATGTTTGTTACGG + Intergenic
994098507 5:95869317-95869339 GCATGGTGGCATGCACCTGTAGG + Intergenic
994117106 5:96073252-96073274 CCGTGGTGGCATGTTTAAGAGGG + Intergenic
994906475 5:105845946-105845968 AAGTGGTAACATGTTTCTGTGGG + Intergenic
995288611 5:110422379-110422401 GCGTGGTGGCGGGTGCCTGTAGG + Intronic
995560300 5:113374041-113374063 GCGTGGTGGCATGCGCCTGTGGG - Intronic
997305980 5:132836695-132836717 GCATGGTGGCATGTGCCTGCAGG - Intergenic
997961934 5:138329041-138329063 GCATGGTGGCACGTGCCTGTAGG - Intronic
998595751 5:143528211-143528233 GCGTGGTGGCTGGGTTCTGGGGG + Intergenic
999420662 5:151439512-151439534 GCGTGGTGGTGTGTGCCTGTAGG + Intronic
999456292 5:151719158-151719180 GCGTGGTGACATGTGCCTGTAGG - Intergenic
999473295 5:151875309-151875331 GCATGGTGGCATGCACCTGTAGG - Intronic
999624630 5:153507286-153507308 GGGTGGTGGAATGTTTGTGGGGG - Intronic
999946482 5:156601820-156601842 GCGTGGTGGCAGGCGCCTGTAGG - Intronic
1000551550 5:162671725-162671747 GTGTGGTTGTATGTTTGTGTTGG + Intergenic
1001142841 5:169159635-169159657 GCGTGGTGGCAGGCACCTGTAGG + Intronic
1002095893 5:176830712-176830734 GTGTGCTGGCATGTATGTGTGGG + Intronic
1002117482 5:176974671-176974693 GTGTAGTGGCATGTGCCTGTAGG + Intronic
1004410980 6:15381218-15381240 GCGTGGTGGCGGGTGCCTGTAGG + Intronic
1004624000 6:17357751-17357773 GCGTGGTAGCAGGTGCCTGTAGG - Intergenic
1005557762 6:27005839-27005861 GCATGGTGGCATGTTCCTAAAGG - Intergenic
1005878817 6:30038156-30038178 GTGTGGTGGCGTGTGCCTGTAGG + Intergenic
1005999539 6:30954733-30954755 GGGTGATGGGAGGTTTCTGTTGG - Intergenic
1006346798 6:33488844-33488866 GCGTGGTGGCACGCACCTGTAGG + Intergenic
1006367233 6:33622680-33622702 GCGTGGTGCCTTCTTTCTGATGG + Intronic
1006607661 6:35270273-35270295 GCATGGTGGCACGTGCCTGTAGG - Intronic
1007568359 6:42870782-42870804 GCATGGTGGCATATGCCTGTAGG + Intergenic
1007647957 6:43397294-43397316 GCATGGTGGCAGGTGCCTGTAGG + Intergenic
1007976438 6:46106244-46106266 GCATGGTGGCACGCTCCTGTAGG - Intergenic
1008948893 6:57132579-57132601 GCATGGTGGCATGTGCCTATAGG + Intronic
1010107499 6:72186990-72187012 GTGTGGTGGCATGCGCCTGTAGG + Intronic
1010996880 6:82543773-82543795 GCATGTTTGCATGTGTCTGTTGG + Intergenic
1013402680 6:109814275-109814297 GTGTGGTGGCATGTGCTTGTGGG - Intronic
1014741978 6:125156325-125156347 GTGTGGTGGCATGTGCCTGTAGG + Intronic
1015275667 6:131381235-131381257 GGGTGTTGGCATGTCTGTGTTGG + Intergenic
1015764829 6:136705439-136705461 TTGTGGTGGCATGTACCTGTAGG - Intronic
1017404176 6:154099144-154099166 GCGCGGTGGCATGCACCTGTAGG + Intronic
1017673767 6:156793472-156793494 GCATGGTGGCATGTGCCTGTAGG - Intronic
1018281663 6:162192589-162192611 GCGTGGTAGCATGTGCCTGTAGG - Intronic
1018379862 6:163248876-163248898 GCATGGTGGCAGGCGTCTGTTGG + Intronic
1018583222 6:165326108-165326130 ACGGGATGTCATGTTTCTGTAGG - Intergenic
1018715602 6:166530356-166530378 GCTTGTTGGAATGATTCTGTGGG - Intronic
1019501278 7:1366065-1366087 ACATGGTGGCAGGGTTCTGTGGG + Intergenic
1019832794 7:3349736-3349758 GCGTGGTGGCAGGTGCCTGTAGG - Intronic
1020036966 7:4969770-4969792 GAGTGGTGGCATGTGCCTGTAGG + Intergenic
1020163318 7:5788909-5788931 GAGTGGTGGCATGTGCCTGTAGG - Intergenic
1020171629 7:5849559-5849581 GCGTGGTGGCACGTGCCTGTAGG + Intergenic
1020551511 7:9611984-9612006 GAGTTGAGACATGTTTCTGTTGG + Intergenic
1021454057 7:20810471-20810493 GCATGGTGGAATGTGCCTGTAGG - Intergenic
1022007000 7:26275173-26275195 GTGTGGTGGCATGTGACTGTAGG - Intergenic
1022088715 7:27094101-27094123 TCCTTCTGGCATGTTTCTGTTGG + Exonic
1023061115 7:36328192-36328214 GCATGGTGGCACATGTCTGTAGG - Intronic
1023290237 7:38660507-38660529 TCATGGTGGCATGTGCCTGTGGG - Intergenic
1023438040 7:40158609-40158631 GCGTGGTGGCATGTGCCTGTAGG + Intronic
1023786005 7:43708320-43708342 GTGTGGTGGCACATGTCTGTAGG + Intronic
1025263645 7:57438920-57438942 ACGTTGTGGAATGTTTCTGGTGG + Intergenic
1026812651 7:73481569-73481591 GCGTGTAGCCATGGTTCTGTGGG - Intronic
1027147890 7:75710612-75710634 GCATGGTGGCACATGTCTGTAGG + Intronic
1027666214 7:81045082-81045104 GCGTGGTGGCAGGCGCCTGTAGG + Intergenic
1028596989 7:92556167-92556189 GTGTGGTGGCACATGTCTGTAGG + Intergenic
1029564533 7:101327135-101327157 GCATGGTGGCATGTACCTGTGGG - Intergenic
1030095812 7:105898498-105898520 CGGGGGTGGCATTTTTCTGTGGG + Intronic
1031442161 7:121807954-121807976 GCCTGGTGCCATGTTTCTCTTGG + Intergenic
1032829162 7:135605161-135605183 GCGTGGTGGCATGCACCTGTAGG - Intronic
1032861374 7:135883075-135883097 GTGTGGTGGCACATGTCTGTAGG + Intergenic
1034050405 7:147978094-147978116 GGGTTGTGTGATGTTTCTGTAGG - Intronic
1034484311 7:151348712-151348734 GCATGGTGGCGTGTGCCTGTAGG - Intronic
1035074467 7:156169050-156169072 GCGGGGTGGGATGTTTCTAGAGG + Intergenic
1035643669 8:1202182-1202204 GTGTGGTGTGATGTATCTGTTGG + Intergenic
1036981978 8:13479925-13479947 GTGTGGTGGCGTGTGTCTGTAGG + Intronic
1037132605 8:15424739-15424761 GCGTGGTGGCACATGCCTGTGGG + Intronic
1037506322 8:19533253-19533275 GTGTGGTGGTATGTACCTGTAGG - Intronic
1038264353 8:26026198-26026220 GCCTGGGGCCAGGTTTCTGTGGG + Intronic
1038455277 8:27668725-27668747 GCATGGTGGCATGCGCCTGTTGG + Intronic
1038767085 8:30438910-30438932 GTGTGGTGGCATGCGCCTGTAGG - Intronic
1038807288 8:30806184-30806206 GCGTGGTGGCAGGCGCCTGTAGG - Intronic
1039041757 8:33415121-33415143 CTGTGGTGGCATGTGCCTGTAGG + Intronic
1039135924 8:34322771-34322793 GCGTGGTGGCGGGTGCCTGTAGG - Intergenic
1039619791 8:38986033-38986055 GTGTGGTGGCAGGTGCCTGTAGG + Intronic
1040543822 8:48381605-48381627 GCTTGGTGGCATGTGCCTGTAGG - Intergenic
1041052724 8:53953380-53953402 GCGTGGTGGCACGTGCCTGCAGG + Intronic
1041249689 8:55922224-55922246 GCGTGGTGGCACATGCCTGTAGG - Intronic
1042126099 8:65538433-65538455 GCATGGTGGCATGAGCCTGTAGG + Intergenic
1042277822 8:67024451-67024473 GCATGGTGGCATGAGCCTGTAGG - Intronic
1042603758 8:70525782-70525804 GCATGGTGGCATGTGCCTGTAGG - Intergenic
1042711110 8:71718634-71718656 CTGTGGTGGCATGTGCCTGTAGG + Intergenic
1042848114 8:73188333-73188355 GCATGGTGGCATGTGCCTATAGG + Intergenic
1043840136 8:85093211-85093233 GCATGGTGGCATGCACCTGTAGG + Intergenic
1044264708 8:90167646-90167668 GCGTGGTGGCACATGCCTGTAGG + Intergenic
1044761411 8:95521326-95521348 GCATGGTGGCATGTGCCTGTAGG - Intergenic
1044832682 8:96265632-96265654 GCGTGGTGGCATGCACCTGGAGG + Intronic
1044871284 8:96622329-96622351 CCGTGGTGGCATGCGCCTGTAGG - Intergenic
1044887814 8:96798266-96798288 GTGTGGTGGCATGCACCTGTGGG - Intronic
1045486182 8:102633478-102633500 GCGTGGTGGCAGGCGCCTGTAGG - Intergenic
1045747132 8:105436378-105436400 GTGTGGTGGTATGTGCCTGTGGG + Intronic
1045872878 8:106946239-106946261 GCGTCGTGGCATGCGTCTGTAGG - Intergenic
1045960565 8:107963383-107963405 GCATGGTGGTATGTGCCTGTTGG + Intronic
1046147321 8:110177936-110177958 GCTTGGAGGCATGTGCCTGTTGG - Intergenic
1046625807 8:116575855-116575877 GCATGGTGTCATGTGCCTGTAGG - Intergenic
1047051155 8:121115014-121115036 GTGTGGTGGCATGCACCTGTAGG - Intergenic
1047502356 8:125452089-125452111 GCCTGGTGGGGTGTTTCTCTTGG + Intergenic
1047539890 8:125754512-125754534 CCATGGTGGCATGTGCCTGTGGG + Intergenic
1048042427 8:130744245-130744267 ACGTGGTGGCATGTGCCTATAGG + Intergenic
1049035492 8:140072391-140072413 GTGTGGTGGCATGTGCCTGTAGG + Intronic
1049107063 8:140620728-140620750 GCATGGTGGCATGCATCTGTGGG + Intronic
1049711976 8:144068887-144068909 GCGTGGTGGCCTGCTTCTCCCGG - Intergenic
1049891694 9:75603-75625 GCGTGGTGGCATGTACCTGTAGG - Intergenic
1051417090 9:16853269-16853291 CCGTGGTGGCATGCAGCTGTAGG + Intronic
1053733121 9:41076694-41076716 GCGTGGTGGCATGTACCTGTAGG - Intergenic
1054695302 9:68354869-68354891 GCGTGGTGGCATGTACCTGTAGG + Intronic
1055835939 9:80441947-80441969 GCATGGTAGCATGCATCTGTAGG + Intergenic
1055985612 9:82055082-82055104 GCGTGGTGGCAGGCACCTGTAGG + Intergenic
1056557924 9:87705358-87705380 GTGTGATGGCTTGTGTCTGTAGG - Intronic
1057253289 9:93521441-93521463 ACATGGTGGCATGTGCCTGTGGG + Intronic
1057666513 9:97050058-97050080 GCATAGTGGCATGTGCCTGTAGG + Intergenic
1058797767 9:108515237-108515259 ATGTGGTGGTATGTTTCTGTTGG + Intergenic
1059095003 9:111403219-111403241 GCATGGTGGCTTGTGCCTGTAGG + Intronic
1059116372 9:111603477-111603499 GCGTGGTGGTGTGTGCCTGTAGG - Intergenic
1059122314 9:111652377-111652399 GCGTGGTGGCATGCTCCTGTAGG + Intronic
1059228742 9:112697443-112697465 GCTTGGTGGCATGTGCCTGTAGG + Intronic
1061075154 9:128336766-128336788 GCGTGGTGGCATGCATCCATAGG - Intergenic
1061097251 9:128465600-128465622 GCATGGTGGCACGCTCCTGTAGG + Intronic
1061165569 9:128920206-128920228 GCGTGGTGGCAGGCGCCTGTAGG + Intergenic
1061378313 9:130239210-130239232 GCGTGGTGGCAGGTGCCTGTGGG + Intergenic
1186659041 X:11649363-11649385 ACTTAGTGGCATGATTCTGTGGG - Intronic
1188210872 X:27421685-27421707 GCTTGGTGGCTTGTGCCTGTAGG + Intergenic
1188298243 X:28476610-28476632 GCATGGTGGCATGCACCTGTAGG - Intergenic
1188355442 X:29184637-29184659 GTGTGGTGGCATGAGCCTGTAGG - Intronic
1189684160 X:43546380-43546402 GCGTGGTGGCATGTGTCTGTAGG - Intergenic
1189835378 X:45015407-45015429 GCCTGGTGTAAAGTTTCTGTAGG + Intronic
1190778159 X:53571460-53571482 GCGTGGTAGCATGTGCCTATAGG + Intronic
1190809872 X:53872763-53872785 GTGTGGTGGCACGTGTTTGTAGG + Intergenic
1192445270 X:71206447-71206469 GCGTGGTGGCGTGGGCCTGTAGG + Intergenic
1197229153 X:123984774-123984796 GTGTGGTGGCGTGTGCCTGTGGG - Intronic
1197940720 X:131786009-131786031 GCGTGGTGGCATGCACCTGTGGG + Intergenic
1198074730 X:133183495-133183517 GTGTGGTGGTATGTACCTGTAGG + Intergenic
1198136104 X:133751992-133752014 GCATGGTGGCATGCTACTGGGGG - Intronic
1198187522 X:134268003-134268025 GCATGGTGGCGTGTGCCTGTGGG - Intergenic
1199184389 X:144898151-144898173 GCATGGTGGCGTGTTTCTCTTGG + Intergenic
1199301382 X:146218223-146218245 GCGTGATGGCATGCACCTGTAGG - Intergenic
1199835023 X:151581449-151581471 GCATGGTGGCATGCACCTGTAGG + Intronic
1200110709 X:153739510-153739532 GCATGGTGGCGTGCATCTGTAGG + Intronic
1201355804 Y:13096084-13096106 TCGTGGTACCATGTTTTTGTTGG + Intergenic