ID: 1139914799

View in Genome Browser
Species Human (GRCh38)
Location 16:70421351-70421373
Sequence GTGAGAAAAACGAAGGTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 214}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139914781_1139914799 25 Left 1139914781 16:70421303-70421325 CCCAAAGTGGGCCTTTCCCTGGC 0: 1
1: 0
2: 4
3: 16
4: 149
Right 1139914799 16:70421351-70421373 GTGAGAAAAACGAAGGTTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 214
1139914786_1139914799 1 Left 1139914786 16:70421327-70421349 CCGCCTCTGAGCCTTATCCCCGG 0: 1
1: 0
2: 2
3: 12
4: 147
Right 1139914799 16:70421351-70421373 GTGAGAAAAACGAAGGTTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 214
1139914791_1139914799 -10 Left 1139914791 16:70421338-70421360 CCTTATCCCCGGGGTGAGAAAAA 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1139914799 16:70421351-70421373 GTGAGAAAAACGAAGGTTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 214
1139914784_1139914799 9 Left 1139914784 16:70421319-70421341 CCCTGGCACCGCCTCTGAGCCTT 0: 1
1: 0
2: 0
3: 14
4: 191
Right 1139914799 16:70421351-70421373 GTGAGAAAAACGAAGGTTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 214
1139914783_1139914799 14 Left 1139914783 16:70421314-70421336 CCTTTCCCTGGCACCGCCTCTGA 0: 1
1: 0
2: 8
3: 105
4: 434
Right 1139914799 16:70421351-70421373 GTGAGAAAAACGAAGGTTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 214
1139914790_1139914799 -2 Left 1139914790 16:70421330-70421352 CCTCTGAGCCTTATCCCCGGGGT 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1139914799 16:70421351-70421373 GTGAGAAAAACGAAGGTTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 214
1139914785_1139914799 8 Left 1139914785 16:70421320-70421342 CCTGGCACCGCCTCTGAGCCTTA 0: 1
1: 0
2: 0
3: 11
4: 154
Right 1139914799 16:70421351-70421373 GTGAGAAAAACGAAGGTTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 214
1139914782_1139914799 24 Left 1139914782 16:70421304-70421326 CCAAAGTGGGCCTTTCCCTGGCA 0: 1
1: 0
2: 0
3: 20
4: 203
Right 1139914799 16:70421351-70421373 GTGAGAAAAACGAAGGTTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139914799 Original CRISPR GTGAGAAAAACGAAGGTTGG GGG Intronic
900194787 1:1370752-1370774 CTGAGAAGCACGCAGGTTGGCGG - Intergenic
901617772 1:10555435-10555457 GAGGGAAAAACGAATGTTTGAGG + Intronic
902750280 1:18503836-18503858 GAGAGAGAAACGAAGGAGGGAGG + Intergenic
904083043 1:27884015-27884037 GTGAGAAAAAGGACGCTCGGAGG - Intronic
905104633 1:35557281-35557303 GTGAGGGGAGCGAAGGTTGGGGG - Exonic
906217030 1:44048171-44048193 GTGAGAAAACCAAAGCTTGGAGG + Intergenic
907441612 1:54481979-54482001 GTGAGAAACAAGAGTGTTGGAGG - Intergenic
909708826 1:78620279-78620301 GTGAGGAAAAAGAAAGTTAGTGG + Intronic
909708832 1:78620370-78620392 GTGAGGAAAAAGAAAGTTAGTGG + Intronic
912254140 1:108041925-108041947 GTGAGAAAATAGAGGGTGGGAGG + Intergenic
913243117 1:116847640-116847662 GAGAGAGAAATGAGGGTTGGGGG + Intergenic
914912661 1:151800087-151800109 GTGAGGAAAGTGAAGGTGGGAGG + Intergenic
916589468 1:166176338-166176360 GTGTGAAAAAAGTAGGTTAGGGG - Intergenic
918282426 1:183020417-183020439 GAGAGAAAAAGGAGGGATGGAGG - Intergenic
920904003 1:210142291-210142313 GTGAGAACTACCAAGGTTTGTGG - Intronic
922915428 1:229253236-229253258 GTGAAAAAAACGAATGGTGAGGG - Intergenic
923965190 1:239129820-239129842 GTGAGAAATAGAAGGGTTGGGGG + Intergenic
924221629 1:241881962-241881984 ATGAGATAAACGTAGCTTGGAGG - Exonic
1069112321 10:64463195-64463217 GTGAGAAAGCTGAAGCTTGGAGG + Intergenic
1069448778 10:68499103-68499125 ATGGGAAAAAGGAGGGTTGGGGG + Intronic
1071703329 10:87966511-87966533 ATGAGAAAAAAGAAGCTTGCAGG - Exonic
1074104796 10:110381316-110381338 TTGAGAAGAAAGAAGCTTGGAGG - Intergenic
1076491514 10:130864860-130864882 GTGAGACAACAGAGGGTTGGGGG - Intergenic
1079513126 11:21234419-21234441 GTGAGAAACCCCAAAGTTGGTGG - Intronic
1079950968 11:26803924-26803946 GTGAGAAAAAAGGAGCATGGTGG - Intergenic
1080942425 11:36934389-36934411 GTGTGCAAAATGGAGGTTGGAGG + Intergenic
1080952113 11:37045993-37046015 GAGAGAAACATGGAGGTTGGGGG + Intergenic
1081004110 11:37712405-37712427 GAGAGAAAAACGAAAGGAGGAGG - Intergenic
1081611680 11:44566602-44566624 GTGAGGAAACTGAAGTTTGGAGG - Intronic
1081782400 11:45722294-45722316 CTGACACAAACGGAGGTTGGAGG + Intergenic
1083224814 11:61278203-61278225 GTGTAAAACACGAAGGTTGGTGG - Intronic
1087578487 11:100021927-100021949 AGGAGAAAGATGAAGGTTGGAGG + Intronic
1088888119 11:114023527-114023549 GTGAGAAAAACTGAGGCTGATGG + Intergenic
1089855096 11:121536693-121536715 GTGATAAAGACCAAGCTTGGTGG - Intronic
1091180633 11:133601262-133601284 GTGAGAAAGATGATGGTTAGTGG - Intergenic
1091409817 12:231889-231911 GTGAGAGAAACAAAGGTGAGTGG + Intronic
1091765801 12:3119301-3119323 GTGAGAAAAACAAGGCTCGGGGG + Intronic
1091853531 12:3720365-3720387 GAGAGAGAAACGAAGGAAGGGGG + Intronic
1094140640 12:27178303-27178325 ATGAACAAAAAGAAGGTTGGAGG - Intergenic
1095265952 12:40157963-40157985 GTGAGGAGAAGGAAGGTTAGTGG - Intergenic
1100983833 12:100186370-100186392 TTGAGGGAAACAAAGGTTGGGGG + Intergenic
1101939361 12:109088572-109088594 GTGAGGAAAACGAGGGCTGGCGG - Intronic
1103336108 12:120190995-120191017 ATGAGAAAACTGAAGATTGGGGG - Intronic
1105046409 12:133007541-133007563 GTGAGAAAGAGGAAGGTGGGAGG + Intronic
1106958140 13:34966134-34966156 ATAAGAAAAATGAAGTTTGGTGG + Intronic
1107105259 13:36636302-36636324 GTGAGAAACATGAGGTTTGGAGG - Intergenic
1108561147 13:51645523-51645545 GAGAGAAAAGGGAAGGCTGGGGG - Intronic
1109862131 13:68213676-68213698 GTGAGAAATGCTAAGGTTGTAGG - Intergenic
1110860301 13:80340083-80340105 GTGAGAAAAAGGCAGGGTGCCGG - Intronic
1115199836 14:30841091-30841113 GTGAGCAACGGGAAGGTTGGTGG - Intergenic
1116122693 14:40741010-40741032 GGGAGAAAGATGAAGGCTGGAGG + Intergenic
1118225199 14:63892366-63892388 GAGGGAAAAAAAAAGGTTGGGGG - Intronic
1119999524 14:79286728-79286750 GTGGGAACAACTATGGTTGGAGG + Intronic
1120145179 14:80971206-80971228 GTAAGAAATCTGAAGGTTGGGGG - Intronic
1120387780 14:83867479-83867501 GTGAGAAAAAAGCTGGGTGGAGG - Intergenic
1122518886 14:102328662-102328684 GACAGAAAGTCGAAGGTTGGGGG - Intronic
1124133681 15:27013796-27013818 GGGAAAAAAAAGAAAGTTGGAGG - Intronic
1124864383 15:33474658-33474680 GTGAGAAAAACTGAGCTTAGAGG - Intronic
1125298887 15:38233283-38233305 GTGAGAAAAACGAAGCTGTTTGG + Intergenic
1126608279 15:50502986-50503008 GTGGGGAAGACGAAGGTTGAAGG - Exonic
1126928044 15:53612903-53612925 GTGAGGGAAAGGAAGGTTGAGGG + Intronic
1128670319 15:69569925-69569947 TTGAGAAACAGGAAGGTAGGAGG - Intergenic
1138263109 16:55639785-55639807 GAGAGAAAAAGAAAGATTGGAGG + Intergenic
1138610737 16:58121901-58121923 GCCAGAAAAATGAAAGTTGGGGG - Intronic
1138810330 16:60141471-60141493 TTGAAAAAAAAGAAGGATGGAGG + Intergenic
1139538474 16:67595217-67595239 GTGAGTCAAAGGAAGGGTGGGGG - Intronic
1139914799 16:70421351-70421373 GTGAGAAAAACGAAGGTTGGGGG + Intronic
1141268354 16:82517111-82517133 GTGACAAATCCGAAGGTTGATGG + Intergenic
1144055782 17:11539314-11539336 GTGAGTCAAAGGAAAGTTGGGGG - Intronic
1145837755 17:27967586-27967608 GTGTAACAAAAGAAGGTTGGGGG - Intergenic
1147162563 17:38576694-38576716 GAGAGAAATAGGAGGGTTGGAGG - Intronic
1147201685 17:38806508-38806530 GTGAGAAAAACAAAGGTATAGGG + Intronic
1148562011 17:48611689-48611711 GGGAGAGAAAGGAAGGGTGGAGG + Intronic
1148685596 17:49499035-49499057 GTGAGAAAAACTGAGGTTTAGGG + Intronic
1151558118 17:74857119-74857141 TTTAGAAAAAAGGAGGTTGGAGG - Intronic
1154506485 18:15045454-15045476 AGGAGAAAGACGTAGGTTGGAGG - Intergenic
1156074875 18:33262369-33262391 ATGAAAAAAAGGAAGGTTGGAGG - Intronic
1159063497 18:63542155-63542177 GTGGGAAAAACACAGGTTAGGGG - Intergenic
1159675771 18:71282993-71283015 GTGAGACAATCGAAGTTGGGAGG - Intergenic
1160001878 18:75032496-75032518 GAGAGAAGAGAGAAGGTTGGTGG - Intronic
1161170920 19:2812185-2812207 GTGAGGAAACTGGAGGTTGGAGG - Intronic
1162361360 19:10222522-10222544 GTGAGAAAAACGAGTTTGGGTGG - Intronic
1163194356 19:15704144-15704166 GTAAAAAAAAAAAAGGTTGGGGG + Intergenic
1163865192 19:19767643-19767665 GAAAGAAAAACGGGGGTTGGGGG + Intergenic
1164693105 19:30225671-30225693 GTAAGGAAAACAAAGGTGGGGGG + Intergenic
1165920942 19:39297664-39297686 GTGAGGAGAAAGCAGGTTGGGGG - Intronic
1167024007 19:46901204-46901226 GTGAGAAAAAGGCAGAATGGTGG + Intergenic
1167327828 19:48836269-48836291 GTGTGAGAAAGGAAGGATGGGGG - Intronic
1167671806 19:50857906-50857928 GTGAGAAAAACACAGGGTTGGGG - Intronic
1202669974 1_KI270709v1_random:40934-40956 GTGAGGAAACCGAAGGTCTGAGG + Intergenic
926365070 2:12125598-12125620 GTGAGAATAAGGAAGGGTAGGGG - Intergenic
927084828 2:19664447-19664469 ATGGGAAAAACGAAGTTTAGAGG - Intergenic
927798550 2:26074829-26074851 ATGAGAAAAACGAAGGCAGAAGG - Intronic
928036409 2:27828303-27828325 AAAAGAAAAAGGAAGGTTGGAGG + Intronic
928124370 2:28605634-28605656 GGGTCAAAAAGGAAGGTTGGGGG + Intronic
928166156 2:28973478-28973500 GGGAGAAGAACGAAGGAGGGAGG - Intronic
930089262 2:47520081-47520103 GTGAAAGAAAGGACGGTTGGGGG + Exonic
930395873 2:50824119-50824141 GTGAAAAAAATGTAGTTTGGTGG - Intronic
931859516 2:66339941-66339963 AGGAGAAAAACGAGTGTTGGAGG - Intergenic
931869065 2:66440146-66440168 GAGAGAAAATCTGAGGTTGGAGG - Intronic
936784653 2:116079579-116079601 GTCAGAAAAATAATGGTTGGAGG - Intergenic
942391393 2:175497399-175497421 CTGAGAAAAAAGAAAATTGGAGG - Intergenic
944256944 2:197632666-197632688 GTGAGAAAAGAGGAGGGTGGTGG + Intronic
944349406 2:198709188-198709210 GAGAGAAAAAAGAAGGGAGGAGG - Intergenic
944481894 2:200165715-200165737 GTGAGAAAGGGGAAGGTTTGAGG - Intergenic
945768528 2:214010868-214010890 GTGAGTAAAAAGAAAGTGGGAGG + Intronic
946031086 2:216705753-216705775 GTGAGAAAAAGGTAGGTAGGTGG - Intergenic
946577908 2:221096203-221096225 ATGGGAAAAATGAAGGTAGGTGG - Intergenic
947642434 2:231714532-231714554 GTGTGAAACACAAAGGTCGGGGG - Intergenic
1169100725 20:2946275-2946297 GGGAGAAAAATGGGGGTTGGGGG - Intronic
1170443722 20:16403838-16403860 GTGAGAAATCCCAGGGTTGGGGG + Intronic
1172794867 20:37529610-37529632 TTGGGAATAAAGAAGGTTGGTGG + Intergenic
1173131233 20:40395616-40395638 GAGAGAAAACAGAAGATTGGAGG + Intergenic
1174571251 20:51503437-51503459 GTGAGAACAACTCAGGCTGGAGG + Intronic
1175944760 20:62553542-62553564 GCGAGAAAGACGATGCTTGGAGG - Exonic
1175967072 20:62665089-62665111 GTGAGAAAACTGAATCTTGGGGG + Intronic
1178145032 21:29729310-29729332 GTCAAAAAAAGGAAGGTAGGAGG + Intronic
1179518466 21:41926192-41926214 GTCAAAAAAATGCAGGTTGGGGG - Intronic
1180616889 22:17134325-17134347 GTGAGAAAATGGAAGCTTGGAGG + Intergenic
1181387948 22:22558479-22558501 GTAAGAAAAACAAAGGGTTGGGG + Intronic
1182011145 22:27001712-27001734 GAGAGAAAAAAAAAGGTGGGAGG - Intergenic
1182627987 22:31662296-31662318 ATGAGAAAAGCGCGGGTTGGGGG + Intronic
952271694 3:31839112-31839134 GTGATAAAAATTGAGGTTGGGGG - Intronic
953176418 3:40557407-40557429 TGGAGAAAAAGGAATGTTGGTGG - Intronic
956501960 3:69896617-69896639 TTAAGAAAAAAGAAGATTGGGGG - Intronic
956604651 3:71061811-71061833 TTGGCAAAAACGAAGGTTGGAGG - Intronic
956629069 3:71296874-71296896 AAGAGAAAAAGGAAGCTTGGAGG - Intronic
956896897 3:73670436-73670458 TTGAGAAAACCTAAGGTTGTGGG + Intergenic
956927614 3:74005975-74005997 GTAAGAAACTGGAAGGTTGGAGG - Intergenic
958258704 3:91354174-91354196 GGGAGAAAGACGTAGGCTGGGGG + Intergenic
958484501 3:94686666-94686688 GTGAGAGAAATGACGGTGGGGGG - Intergenic
958501928 3:94922116-94922138 GTAGGAAAAAGGAATGTTGGTGG + Intergenic
959327897 3:104961005-104961027 TTTAGAGAAAGGAAGGTTGGGGG + Intergenic
959497525 3:107068763-107068785 GTGAGGAAAAAGAAGGTAGGGGG - Intergenic
960218215 3:115069590-115069612 GAGAAAAAAAGGTAGGTTGGAGG + Intronic
962377790 3:134873160-134873182 GAGAGAAAAAGGAAGGAGGGAGG + Intronic
962804653 3:138918050-138918072 GTGGCAGAAACCAAGGTTGGTGG + Intergenic
963605119 3:147406658-147406680 GTGAGAAAAAAAAAAGTTGTGGG - Intronic
964469526 3:157037963-157037985 GTGATAGAAACCAAGGTTGAAGG + Intronic
966071731 3:175886057-175886079 GTGAGAAAAAGCAAGGTAGAGGG - Intergenic
967880203 3:194296600-194296622 GGAAGAAAAACGAAGGCAGGGGG + Intergenic
968220165 3:196931573-196931595 GTGAGAAAAAGCAACCTTGGAGG + Exonic
968810206 4:2796348-2796370 GGGAGAAGAGAGAAGGTTGGGGG - Intronic
970369871 4:15395813-15395835 ATGAGAAAAATGAAGCTGGGAGG + Intronic
970500624 4:16673047-16673069 GTGAAAGAAAAGAAGGATGGAGG - Intronic
971663626 4:29453792-29453814 GTTAGAGAAACGAAAGTTGGAGG + Intergenic
973112369 4:46412051-46412073 GTGGGAAAACTGAAGGTTGTTGG + Intronic
977082873 4:92555508-92555530 GTGAGAAAAATGAAGGCAGCTGG + Intronic
977281912 4:95050276-95050298 GTCAGAAACATGGAGGTTGGTGG - Intronic
977915028 4:102582550-102582572 CTGAGAAACACGAACGATGGTGG - Intronic
977996872 4:103505151-103505173 GTGAGAAGGACAGAGGTTGGGGG - Intergenic
982783338 4:159513853-159513875 GGGAGAAAGATGAAGGCTGGAGG + Intergenic
987184552 5:15402292-15402314 GTGACAAAAAACAAAGTTGGAGG + Intergenic
987209821 5:15669555-15669577 GTGGGAGAAAGGAAGGTAGGAGG - Intronic
987249954 5:16089871-16089893 GTGAGAAAACAGAAGTATGGAGG + Intronic
988464040 5:31470601-31470623 GTGAGAAAATCAAACGTTTGAGG + Intronic
989228888 5:39064851-39064873 GTGAGAATTACAAAGGTAGGAGG + Intronic
991246131 5:64510101-64510123 GTGAGAAAAGCAAAGGTTTTTGG + Intronic
993942609 5:94078490-94078512 GTGAGAAAAACGTTGGTGTGTGG + Intronic
994170769 5:96657719-96657741 GGGAGAAAAATGAAAGTTAGTGG + Intronic
994287633 5:97989584-97989606 GGGAGGAAAAAGAAGGTAGGAGG - Intergenic
996546621 5:124685862-124685884 GTGAGGAAAATGAAGTATGGGGG - Intronic
996742659 5:126815473-126815495 GTTAGAAAAACAAAAGTTAGAGG - Intronic
997254987 5:132421650-132421672 ATGAGAGAAAAGAAGGTGGGTGG + Intronic
998552668 5:143092547-143092569 TTGAGAAAAAAAAAGGTGGGGGG - Intronic
998955049 5:147430193-147430215 GGAAGAAAAAAGAAGGATGGGGG + Intronic
999307189 5:150527221-150527243 GTGTGAAAACCGAGGCTTGGAGG - Intronic
1001742370 5:174064682-174064704 ATGAGAAAAACAAAGGTGGGGGG + Intronic
1002860139 6:1072959-1072981 GTAAGAGAAACCAAGTTTGGGGG + Intergenic
1003796302 6:9609085-9609107 GTGAGCGAATCGAAGGGTGGTGG + Intronic
1005436845 6:25821228-25821250 GAGAGAAAAAAGAAGAATGGAGG - Intronic
1006395954 6:33788081-33788103 GGGAGAAAACCAGAGGTTGGAGG + Intronic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1007587792 6:43002532-43002554 GTAAGAGAAAAGCAGGTTGGGGG - Intronic
1008742636 6:54627968-54627990 GTGGGAAAAATGATGGTGGGTGG + Intergenic
1010088414 6:71949527-71949549 GTGAGAAAACTGAAGTTTAGAGG - Intronic
1012533556 6:100268065-100268087 GAGAGGAAAAGGAAGGCTGGTGG - Intergenic
1014195504 6:118553876-118553898 GTGAGAAAAATGAGGCTTAGAGG - Intronic
1014206119 6:118657124-118657146 GTGAGGAAGATGAAGATTGGGGG + Intronic
1014758707 6:125330469-125330491 GTGAGAAAAACCAAGATGGATGG - Intergenic
1017393005 6:153961385-153961407 GTAAGAAAAGGGAAGCTTGGAGG - Intergenic
1018137069 6:160789125-160789147 GTGAGAAATACCCAGGGTGGGGG + Intergenic
1018137279 6:160789944-160789966 GTGAGAAATCCCCAGGTTGGGGG + Intergenic
1019762473 7:2823971-2823993 GTGAGCAAAAAGAATGGTGGTGG - Intronic
1021679203 7:23112843-23112865 GGGAGTCAAACGAAGGTTGCTGG + Intronic
1022355647 7:29612091-29612113 GTGAGAGAGTCGTAGGTTGGAGG + Intergenic
1022421440 7:30227040-30227062 AGGAGAAAAACCACGGTTGGAGG - Intergenic
1023180789 7:37481126-37481148 GTGAGAGGAAGGAAGGATGGAGG + Intergenic
1024498992 7:50081513-50081535 GTGAGAAAAAGTAACTTTGGGGG + Intronic
1024742533 7:52370630-52370652 GTGAGAAAAGGGAAGGGTGAAGG + Intergenic
1025561546 7:62378327-62378349 GTGAGGAAAACGAAGGCCTGAGG + Intergenic
1027158083 7:75782528-75782550 GGGAGAAAAAGGAAGAATGGAGG - Intronic
1028274977 7:88844383-88844405 GTCACAAAAAAGAAGGTTGGGGG - Intronic
1028805158 7:95017658-95017680 TTTAAAAAAAAGAAGGTTGGAGG + Intronic
1030644477 7:112044726-112044748 ATGAGAAAAAAAAAGGTTTGGGG - Intronic
1031012590 7:116539203-116539225 GAGATAAAAACAAAGGATGGCGG - Intronic
1031988343 7:128178484-128178506 GTGAGCAGAATGAAGGTGGGTGG + Intergenic
1032285072 7:130533534-130533556 GTGAGAGGAAGGAAGGTCGGGGG + Intronic
1032679409 7:134166897-134166919 GTGAGCAAAAGGAACTTTGGGGG + Intronic
1032997079 7:137459204-137459226 CTGAGAAAAAGGGAGGTTGATGG + Intronic
1033039014 7:137901503-137901525 ATGAGGAAAAGGAGGGTTGGGGG + Intronic
1038522182 8:28243182-28243204 CTAAGAAAAAAAAAGGTTGGGGG - Intergenic
1039129226 8:34242667-34242689 GTGAGAAAAGGGAGGGGTGGGGG + Intergenic
1039359684 8:36862728-36862750 GTTAAAAAAATGAGGGTTGGGGG - Intronic
1042214827 8:66420305-66420327 GGGAGATAAATGAAGGCTGGAGG - Intergenic
1042360393 8:67876374-67876396 GTGAGAGAAAAGAAGGTAGGGGG + Intergenic
1042801785 8:72726225-72726247 GTGAGAACATAGCAGGTTGGTGG + Intronic
1042967464 8:74370295-74370317 ATGAAAAACACAAAGGTTGGAGG + Intronic
1043045848 8:75323888-75323910 GTGAGAAAAATGAAGGTTTAAGG + Intergenic
1044100137 8:88124898-88124920 GAGAGAAAAAGGAAGCTTGCTGG + Intronic
1048519134 8:135137702-135137724 GTGAGAAAGACAAATTTTGGGGG - Intergenic
1048533297 8:135270425-135270447 CTGGGAAAAGAGAAGGTTGGAGG + Intergenic
1048842279 8:138576649-138576671 GTGAGAAAAACACAGTGTGGAGG + Intergenic
1051218726 9:14826507-14826529 GTGAGAAAGACTCAGGTTGCTGG - Intronic
1051818398 9:21135772-21135794 GTGAGGAAAGTGGAGGTTGGGGG + Intergenic
1052561258 9:30087420-30087442 GGGAGAAAAATGGAGGCTGGAGG + Intergenic
1052888581 9:33674385-33674407 ATGAGAAAAAAGAAGCTTGCAGG + Intergenic
1055406194 9:75976149-75976171 GTTAGAAAATGGAAGGTTTGGGG + Intronic
1056774013 9:89498281-89498303 GGGAGGAAAAGAAAGGTTGGGGG - Intergenic
1059705437 9:116819006-116819028 GTGAGAAAATGGAAGGTCAGGGG + Intronic
1060555104 9:124504067-124504089 GAGAGAGAAACGAGGGGTGGGGG + Intronic
1060610060 9:124955683-124955705 GTGAAAAAAACGAAAGTTAATGG + Intronic
1188128479 X:26400221-26400243 GTGAGAAAAACATAAGTTTGGGG + Intergenic
1188788699 X:34381597-34381619 GTGAGGAGAAGAAAGGTTGGGGG + Intergenic
1189239274 X:39513146-39513168 GTGAGAAAAACAAATGTCTGTGG - Intergenic
1190006223 X:46741333-46741355 TTGAGAAAGAGTAAGGTTGGAGG + Intronic
1196581508 X:117384589-117384611 GTGAGAAAAAGAAAGGCAGGAGG - Intergenic
1197761407 X:130030876-130030898 GGGAGAGAAAGGAAGGTGGGAGG - Intronic
1199269512 X:145866092-145866114 CTGAGAAACAGGAAAGTTGGTGG - Intergenic