ID: 1139915356

View in Genome Browser
Species Human (GRCh38)
Location 16:70424931-70424953
Sequence CTGGACCAGGCACTGTGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 560
Summary {0: 1, 1: 1, 2: 14, 3: 65, 4: 479}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139915347_1139915356 24 Left 1139915347 16:70424884-70424906 CCTGCTGGAGTCCTGGGTTCACT 0: 1
1: 0
2: 2
3: 14
4: 221
Right 1139915356 16:70424931-70424953 CTGGACCAGGCACTGTGGCTGGG 0: 1
1: 1
2: 14
3: 65
4: 479
1139915349_1139915356 13 Left 1139915349 16:70424895-70424917 CCTGGGTTCACTCTGATATGGAG 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1139915356 16:70424931-70424953 CTGGACCAGGCACTGTGGCTGGG 0: 1
1: 1
2: 14
3: 65
4: 479

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139915356 Original CRISPR CTGGACCAGGCACTGTGGCT GGG Intronic
900217839 1:1491070-1491092 CTGGACCAGGTCCCTTGGCTTGG + Intronic
900234756 1:1582925-1582947 CTGGGCCTGGAACTGGGGCTGGG - Intergenic
900417042 1:2540123-2540145 CTCCACCAGGACCTGTGGCTGGG + Intergenic
900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG + Exonic
901001523 1:6151209-6151231 CTGGCCCAGGCAGTGTGGGGTGG + Intronic
901428067 1:9196114-9196136 ATGGATCAGCCACTGCGGCTGGG - Intergenic
901435166 1:9243098-9243120 CTGGCTCAGACACTGTGGTTGGG + Intronic
901644817 1:10710711-10710733 CTTGACCTGGCACAGGGGCTGGG - Intronic
901670861 1:10855769-10855791 CTGAGCCAGGCACTGTGCCAGGG - Intergenic
902079505 1:13811592-13811614 CTGTACCAGGTCCTGTGCCTGGG + Intronic
902340193 1:15778102-15778124 CAGGGCCAGTCACTGTGGCTGGG + Intronic
902340216 1:15778225-15778247 CTGGAAAAGGCACTGTGGTGTGG - Intronic
902562565 1:17286888-17286910 AGGGACCAGGCAGTGTGGCATGG - Intergenic
902617770 1:17633154-17633176 GTGGGCCTGGCACTGGGGCTTGG + Intronic
902620672 1:17648981-17649003 CTGTGCCAGCCACTGTGGGTTGG + Intronic
902664569 1:17928374-17928396 CTGGACCAGCCATTTTGACTGGG - Intergenic
903328623 1:22585747-22585769 CTGTCCCCGTCACTGTGGCTGGG - Intronic
903404259 1:23083226-23083248 GAGCACCATGCACTGTGGCTGGG - Exonic
903625568 1:24727693-24727715 AAGGACCAGACACTGTGGGTTGG + Intergenic
904294853 1:29513567-29513589 CTGAACCAGTCACTGTGGCTGGG + Intergenic
904449176 1:30600102-30600124 CTGGAGCAGACACTGTGTCCAGG + Intergenic
904822455 1:33255101-33255123 CTGTGCCAGGCACTGTGCTTGGG + Intergenic
904864013 1:33562251-33562273 CTGGTCCAGGGCCTGTGGCTTGG - Intronic
905025776 1:34848295-34848317 ATGGAGCAGGTACTGGGGCTGGG - Intronic
906104344 1:43283040-43283062 CTGGCCCAGGCACTGGGGCTCGG - Exonic
906349220 1:45043218-45043240 CAAGGCCAGCCACTGTGGCTTGG - Exonic
907099969 1:51822391-51822413 CTAGCCTAGGCACAGTGGCTGGG + Intronic
907237264 1:53061385-53061407 GTGGAACAGGCAATGCGGCTGGG - Intergenic
908089885 1:60674869-60674891 CTGTACCAGGCGCTGAGGATTGG + Intergenic
908121433 1:60989924-60989946 CTGGACCAGGGTCTGGGGTTGGG - Intronic
911160417 1:94677911-94677933 CTGGTCCAATCACTGTGGCCAGG + Intergenic
912356815 1:109061025-109061047 CTGGACCAGTCACTATGGCCAGG - Intergenic
913087942 1:115456531-115456553 CTGGGCCAAGCATTGGGGCTTGG - Intergenic
913207649 1:116555930-116555952 CTGTGCCAGGCACTGTTGCAAGG + Intronic
913678073 1:121160957-121160979 TTGGCCTAGGCACTGTGGGTAGG + Intergenic
914029910 1:143948586-143948608 TTGGCCTAGGCACTGTGGGTAGG + Intronic
914159539 1:145119364-145119386 TTGGCCTAGGCACTGTGGGTAGG - Intergenic
914244038 1:145872774-145872796 CTGGACCTGCGCCTGTGGCTTGG + Exonic
915014344 1:152719294-152719316 CTGTACCTGGCTATGTGGCTTGG - Intergenic
915117462 1:153609687-153609709 CTGGACCAGGCAATGTGGGCTGG - Intronic
915285245 1:154848105-154848127 CGGCACCAGCCACTCTGGCTGGG - Intronic
917469796 1:175316604-175316626 CTGGAGCAGGCAGTGTAGCCAGG - Exonic
917955035 1:180086887-180086909 TTGGACCAGGCATTGTGAATAGG + Intronic
918028383 1:180777508-180777530 ATGTACCAGGCAATGTGGCAGGG - Intronic
918435915 1:184512786-184512808 CTGGTCCAGGGTCTGAGGCTTGG - Intronic
919958200 1:202439464-202439486 CTGGACCAGGCACCCTTGCCGGG - Intronic
920558001 1:206918312-206918334 CTAGCCCAGGCCCTGTGCCTTGG + Intronic
921168544 1:212525457-212525479 CTGGGCCAGGCACTGCGGAGGGG - Intergenic
921246802 1:213251821-213251843 GTGTCCCAGGCACTGTGCCTAGG + Intronic
921907902 1:220514323-220514345 CTGGACCAGGGATTGGGGCATGG + Intergenic
921951125 1:220931367-220931389 CCGGTCCAGGCACTGTGACCAGG + Intergenic
922089813 1:222385094-222385116 CTTAACCAGTCACTATGGCTGGG + Intergenic
1062843919 10:690109-690131 GTGGACCAGGCTCTGGGGCCGGG - Intergenic
1063758326 10:9041701-9041723 CTGGCCTAGGCACTGGGGGTGGG - Intergenic
1063917455 10:10897967-10897989 CTGAACCAGTCACTGTTTCTGGG - Intergenic
1064013451 10:11754890-11754912 CTGAACCAGGCACTGTAATTTGG - Intronic
1064060088 10:12129809-12129831 CTGGAGCGGGGACTCTGGCTGGG + Intronic
1065591881 10:27271344-27271366 CTTGACCAATTACTGTGGCTTGG + Intergenic
1065956012 10:30694035-30694057 CGTAACCAGGCACGGTGGCTCGG - Intergenic
1066227070 10:33393769-33393791 CTGGAGCATGCACTGGGACTTGG - Intergenic
1066351507 10:34641355-34641377 CTGGAGGAGGGACTGGGGCTTGG + Intronic
1066519447 10:36199327-36199349 GTAGGCCAGGCACGGTGGCTAGG + Intergenic
1067369954 10:45673404-45673426 CTGGAGCAGGAGGTGTGGCTGGG - Intergenic
1067410581 10:46060779-46060801 TTGGCCCAGGCACTGTGGGGTGG - Intergenic
1067724556 10:48760099-48760121 ATGGGTCAGGCACTGTGCCTTGG + Intronic
1067750554 10:48968610-48968632 CTGCACCAGGCTCTGTGCCAGGG + Intronic
1067933145 10:50583502-50583524 CTGGACCAGTGGCTGTGGCCAGG - Intronic
1068090130 10:52423551-52423573 CTGAACCAGTCACTGAGGCCAGG - Intergenic
1070541516 10:77418612-77418634 CTGGACCAGCCACTTTGTCAAGG - Intronic
1070632200 10:78094610-78094632 CAGGACCAGGCACTGTAGGGTGG + Intergenic
1070890670 10:79940523-79940545 CTGGACCTGGGACTGTGGCAGGG - Intronic
1070967248 10:80536984-80537006 CAGGATTTGGCACTGTGGCTTGG - Intergenic
1070977631 10:80617945-80617967 CTGGACCAGTCACTGTGGTCAGG + Intronic
1071491390 10:86138979-86139001 CTGGACCAGGCCTCGCGGCTGGG - Exonic
1071509022 10:86249829-86249851 CTGTACCAGGAACTGGGGATTGG - Intronic
1071841286 10:89474351-89474373 CTGAACCAGGCAGTGTGTTTGGG - Intronic
1073483270 10:103800286-103800308 CTGGACCAATCAGTATGGCTGGG - Intronic
1074133576 10:110607377-110607399 CTAGGCCAGGCGCGGTGGCTCGG + Intergenic
1074435180 10:113427665-113427687 GTGGACCAATCATTGTGGCTGGG + Intergenic
1074462467 10:113650791-113650813 GTGGGCCAGGCACTGGGCCTGGG + Intronic
1074558647 10:114515315-114515337 CTAGACCATTCACTGTGGCCAGG - Intronic
1075777509 10:124998053-124998075 CTGTACCAGGCACTGCGGGAAGG - Exonic
1075806611 10:125193632-125193654 CTGAACCAGTTACTGTGGCCAGG + Intergenic
1076662268 10:132063388-132063410 GTGGAGCTGGCAATGTGGCTGGG + Intergenic
1076943327 10:133625188-133625210 CAGGACCTGGCAGTGTGGCTGGG + Exonic
1077220272 11:1412685-1412707 CTGAGCCAGGGACAGTGGCTGGG + Intronic
1077335420 11:2001421-2001443 CTGGGTCAGGCACTGAAGCTGGG - Intergenic
1077420824 11:2449094-2449116 CTGGGCATGGCCCTGTGGCTGGG + Intronic
1078144323 11:8712713-8712735 GTGGACCAGGCGCTGTGTGTGGG + Exonic
1080640266 11:34154530-34154552 CTGGGACACGCACTGAGGCTGGG + Intronic
1081483146 11:43507288-43507310 AGGGCCCAGGCACTGGGGCTGGG + Intergenic
1081664018 11:44905965-44905987 CTGGTCCAGGCTCTGGGCCTTGG + Intronic
1081815549 11:45938143-45938165 CAGGACCAGGTACTGTGGGTGGG - Exonic
1083587454 11:63870550-63870572 AGGTGCCAGGCACTGTGGCTGGG + Intronic
1083628799 11:64085458-64085480 CGGGACCAGGCCATGTGTCTGGG + Intronic
1083685548 11:64373060-64373082 CTGAACCAATCACTGTGGCCAGG + Intergenic
1083826860 11:65208844-65208866 CTGGGCCAGGCTGAGTGGCTTGG + Intronic
1083957495 11:65993172-65993194 CTTGAGCAGTCACTGTGGCCAGG - Intergenic
1084080338 11:66819485-66819507 ATGGGCTAGGCACTGTGGCTTGG + Intronic
1084383568 11:68828555-68828577 CCAGACTGGGCACTGTGGCTGGG + Intronic
1084699931 11:70779895-70779917 CAGAACCAGTCACTCTGGCTAGG - Intronic
1085632793 11:78133272-78133294 ATGTACCAGGTACTGTTGCTAGG - Intronic
1086549795 11:88042543-88042565 CTTCCCCAGGCACTGTGCCTGGG - Intergenic
1088073200 11:105814937-105814959 CTGAACCAATCACTATGGCTGGG - Intronic
1088321010 11:108554637-108554659 CATGGCCAGGCACAGTGGCTCGG + Intronic
1090386428 11:126359947-126359969 CAGGAGCAGCCACTTTGGCTGGG - Intronic
1090632207 11:128659580-128659602 CTGAACCAATCACTGTGGTTGGG + Intergenic
1090653458 11:128825381-128825403 CTGGACAATCCACTCTGGCTGGG - Intergenic
1091323971 11:134670452-134670474 CTGGGCCAGGCACAGTGCCTGGG - Intergenic
1202818403 11_KI270721v1_random:56603-56625 CTGGGTCAGGCACTGAAGCTGGG - Intergenic
1091589937 12:1836949-1836971 CAGAGCCAGGCCCTGTGGCTGGG + Intronic
1091710274 12:2735168-2735190 CTGGACCAGACGCTGTGCCAGGG + Intergenic
1093669005 12:21850098-21850120 CTGGACAACGCACTGTTGCAGGG + Intronic
1093921726 12:24866434-24866456 TGGGACCAGGCACTGTGGAGTGG - Intronic
1094053215 12:26243032-26243054 CTGGGGCAGGCAATGTGGCCTGG - Intronic
1095394453 12:41746003-41746025 CTGGGCCATGCCTTGTGGCTCGG - Intergenic
1095802198 12:46281116-46281138 CTGGACCCAGCAGTGTGGCCAGG + Intergenic
1096497026 12:52044468-52044490 CTGGGCCAGGGACTCTGGCCCGG + Intronic
1096971531 12:55670400-55670422 CTGGGGCAGGGACTGGGGCTGGG - Intergenic
1099968749 12:89478517-89478539 CAGTGCCAGGCACTGTGTCTGGG - Intronic
1100330683 12:93579123-93579145 GTCGCCCAGGCATTGTGGCTGGG - Intronic
1101053152 12:100884988-100885010 CTGGAAAAGGCACCGAGGCTGGG - Intronic
1101380252 12:104208127-104208149 GTGGAGAAGACACTGTGGCTAGG + Intergenic
1101812520 12:108120151-108120173 CTGGACCAATCACTGTGGCCAGG + Intergenic
1101857786 12:108458276-108458298 CTGGGCCAGGCACTGTTGAGGGG - Intergenic
1102474655 12:113180821-113180843 CTGGGCCCAGCACTGTGGTTGGG - Intronic
1102924761 12:116818401-116818423 CTGAACCAGGCACTGAGCCAGGG - Intronic
1103197186 12:119054948-119054970 CTGAACCAACCACTGTGGCCAGG + Intronic
1103465380 12:121138433-121138455 CTGAACCAATCACTGTGGCCAGG + Intronic
1103481486 12:121252896-121252918 TTGAACCAATCACTGTGGCTGGG - Intronic
1103555248 12:121762520-121762542 CTGAACCAGTCACTGTTGCCAGG + Intronic
1104549195 12:129740376-129740398 ATGGCCCAGGTACTGTTGCTGGG + Intronic
1104989631 12:132618553-132618575 CTGGACCAAGAGCTGGGGCTGGG + Intergenic
1105746718 13:23383897-23383919 CTGTGCCAGGCACTGGGGTTGGG - Intronic
1105883105 13:24620830-24620852 CTGCACAAGGCACTGTGGTGCGG - Intergenic
1106240427 13:27907867-27907889 CTGTGCCAGGCACTGTTGCCAGG - Intergenic
1107114136 13:36728200-36728222 CTGTACCAGGCACTGTGTCAGGG - Intergenic
1107708067 13:43126510-43126532 CTGGACCAGGCTCTGCAGCCTGG + Intergenic
1107813767 13:44225475-44225497 GTGGCCCAACCACTGTGGCTGGG + Intergenic
1110730872 13:78877234-78877256 CTGGAACAGGCACTGGGAGTGGG + Intergenic
1112362171 13:98728064-98728086 CTGGTCCAGGCAGTGTGCTTTGG + Intronic
1112717746 13:102205925-102205947 GTGGACCAGTCACTGGGACTTGG + Intronic
1112817968 13:103295709-103295731 CTAGATTAGGCCCTGTGGCTGGG + Intergenic
1114268223 14:21085340-21085362 CTGGATCAGGCAGTGTGGAATGG + Intronic
1114317449 14:21522122-21522144 TTGGCCTAGGAACTGTGGCTGGG - Exonic
1114429532 14:22648509-22648531 TTGGATCAGTCACTGTGGTTGGG - Intergenic
1115594208 14:34893689-34893711 ATGGACCAGACACTGTGCTTAGG - Intergenic
1116806125 14:49495477-49495499 CTTGACCAAAAACTGTGGCTTGG + Intergenic
1117036820 14:51738948-51738970 CTCCACCTGGCACTGGGGCTGGG + Intergenic
1118336299 14:64856047-64856069 CTGAACCAGGCAAGGAGGCTTGG - Intronic
1119122707 14:72094244-72094266 CTGTTCCAGGCACTGCAGCTGGG - Intronic
1119170990 14:72536446-72536468 CTGGACCTTGCAGTGGGGCTGGG - Intronic
1119443459 14:74645359-74645381 CTGAACCAATCACTGTGGCTAGG - Intergenic
1120871195 14:89338916-89338938 CTGGGCCAGGCACAAGGGCTAGG + Intronic
1121227750 14:92333862-92333884 CGGGAGCTGACACTGTGGCTGGG + Intronic
1121340137 14:93100140-93100162 CTGAACCAGTCTCTGGGGCTGGG - Intronic
1121456553 14:94042414-94042436 CTGTGCCAGGCACTGGGGCACGG - Intronic
1121782711 14:96632117-96632139 ATGCACCAGGCACTGGGGCAGGG + Intergenic
1122283115 14:100635953-100635975 CTGGAGCAGGCACCCTGGGTTGG - Intergenic
1122816058 14:104314676-104314698 CTGCACCAGGCACCCTGCCTTGG + Intergenic
1122846661 14:104503991-104504013 CTGGGCCCAGCACTGTGGCTCGG - Intronic
1122958972 14:105085906-105085928 CTGCCCCAGGCACTGGAGCTTGG - Intergenic
1123064395 14:105609331-105609353 TTGCACCAGGCACTGTGGCAAGG - Intergenic
1123073698 14:105654969-105654991 TTGCACCAGGCACTGTGGCAAGG - Intergenic
1202839901 14_GL000009v2_random:111832-111854 CTGGACAGGGCAGTGTGGGTTGG - Intergenic
1202909284 14_GL000194v1_random:102030-102052 CTGGACAGGGCAATGTGGGTTGG - Intergenic
1202863654 14_GL000225v1_random:101205-101227 CTTGTCTAGGCACTGTGGATGGG + Intergenic
1124177340 15:27438820-27438842 CTGGGCCAAGCACCCTGGCTGGG - Intronic
1124220101 15:27843846-27843868 CTGCACCAGGCACTGCTGCCTGG - Intronic
1124371899 15:29108680-29108702 CTTCACCAGCCACTGTAGCTTGG + Intronic
1124421740 15:29529033-29529055 CTGGACTAGCCACAGTGGCTGGG - Intronic
1125111514 15:36039777-36039799 CTGAATTTGGCACTGTGGCTTGG + Intergenic
1126009540 15:44289169-44289191 CTGGACCTGGCCCTGCAGCTCGG - Exonic
1126331135 15:47532684-47532706 CTTTACCAGCCACTGTGGATTGG - Intronic
1126515907 15:49537900-49537922 CGGGACCAGGCAAGGTGGGTGGG + Intronic
1127666478 15:61152863-61152885 CTGGACAAAGCACTGTGGACAGG + Intronic
1128288264 15:66456697-66456719 CTGGACCATTCACTGTGTCCAGG + Intronic
1128575992 15:68775569-68775591 TTGTACCAGTCACTGTGGTTAGG + Intergenic
1128687360 15:69696698-69696720 CTGCATCAGGCACTGTGTTTGGG + Intergenic
1128945070 15:71814257-71814279 CGGGGCCTGGCACTGTGCCTGGG - Intronic
1129052575 15:72795026-72795048 CTAGTCCAGGCACTGTGGTCTGG + Intergenic
1129522818 15:76196460-76196482 CTTGACCAGGAACTGTGTCCAGG + Intronic
1129666376 15:77581862-77581884 CTGGGCCAGGGCCTGGGGCTGGG - Intergenic
1130043276 15:80424111-80424133 CTGAACCAGGCCCTGTTGCCAGG + Intronic
1131155038 15:90069723-90069745 CTAAACTAGGCACAGTGGCTCGG + Intronic
1132110484 15:99099154-99099176 CTGGGCCAGGCACAGTGGTGTGG - Intronic
1132385896 15:101399618-101399640 CTGGGGGAGGCACTGTTGCTGGG - Intronic
1132410299 15:101572800-101572822 CAGGTCCAGGCTCTGGGGCTGGG - Intergenic
1132436786 15:101812453-101812475 CTGGAGTCTGCACTGTGGCTTGG + Intronic
1132875598 16:2135631-2135653 CTGGGCCTGGGCCTGTGGCTCGG - Exonic
1132878984 16:2152966-2152988 CTGGCCCAGGCACAGGGTCTTGG - Intronic
1132958380 16:2608687-2608709 CTGGACCCTGCACTGTGGGGAGG + Intergenic
1132970992 16:2688783-2688805 CTGGACCCTGCACTGTGGGGAGG + Intronic
1133257126 16:4523866-4523888 CTGGAACAAACCCTGTGGCTGGG - Intronic
1133559171 16:6934182-6934204 CTAGACCAGGAACTGCAGCTAGG - Intronic
1134079363 16:11314448-11314470 CTGTTCCAGGCCCTGGGGCTAGG + Intronic
1134295649 16:12943138-12943160 CTGCACCAGTCACTGTGACGAGG + Intronic
1134459806 16:14421327-14421349 CTTGACCAGTATCTGTGGCTGGG + Intergenic
1134519388 16:14911722-14911744 CTGGGCCTGGGCCTGTGGCTCGG + Intronic
1134534705 16:15016597-15016619 TTGAACCAGCCACTGTGGCCAGG + Intronic
1134554545 16:15154506-15154528 CTGGGCCTGGGCCTGTGGCTCGG - Intergenic
1134707058 16:16310377-16310399 CTGGGCCTGGGCCTGTGGCTCGG + Intergenic
1134960482 16:18401747-18401769 CTGGGCCTGGGCCTGTGGCTCGG - Intergenic
1135329761 16:21551302-21551324 CTGCACCTGGCACTGTGCCATGG - Intergenic
1135417970 16:22283650-22283672 CTGGACCAATCGCTGTAGCTTGG + Intronic
1135665734 16:24334326-24334348 AGGTTCCAGGCACTGTGGCTGGG + Intronic
1136254307 16:29028191-29028213 CTGGGGCAGGCCCTGTGGCTGGG + Intergenic
1136340101 16:29637272-29637294 CTGCACCTGGCACTGTGCCATGG - Intergenic
1136599493 16:31275362-31275384 CTGCACAAGGCACTGTGCCAAGG - Intronic
1136640729 16:31563205-31563227 AGGGACCAGGGAGTGTGGCTGGG + Intergenic
1137272590 16:46912113-46912135 CTGGACCACACACTGTGACCAGG + Intronic
1137538068 16:49342428-49342450 CTGGACCAGGGGCTGGGGGTGGG + Intergenic
1137699711 16:50488836-50488858 CTGGACCAATCACTGTGGCCAGG + Intergenic
1138398526 16:56727056-56727078 CTGAACCAGTCCCTGTGGCCAGG + Intronic
1138697523 16:58829251-58829273 CTGGAACTGTCACTGTGGCCAGG + Intergenic
1138984573 16:62312534-62312556 CTGAACCAATCACTGTGGTTAGG - Intergenic
1139240999 16:65392365-65392387 CTGGACAATTCACTCTGGCTAGG + Intergenic
1139427838 16:66894258-66894280 CGGGACTAGCCATTGTGGCTAGG + Intronic
1139442180 16:66973885-66973907 GAGGACCCGGCACTGGGGCTGGG - Exonic
1139861340 16:70024180-70024202 TTGAACCAGCCACTGTGGCCAGG - Intergenic
1139908660 16:70383123-70383145 CAGGACCAGGCACACAGGCTGGG + Intronic
1139915356 16:70424931-70424953 CTGGACCAGGCACTGTGGCTGGG + Intronic
1140871674 16:79112405-79112427 CTGGACCAAGAACTGTTGCCAGG + Intronic
1140903370 16:79390793-79390815 CTGGACCAAGCACTGTGGCCCGG - Intergenic
1141461892 16:84182638-84182660 GTGAACCAGTCACTGTGGCAAGG - Intronic
1141691431 16:85598946-85598968 ATGGAGCAGGGCCTGTGGCTTGG - Intergenic
1141767946 16:86071079-86071101 CTTGACCGGGCACTGTGCTTTGG - Intergenic
1142042779 16:87905843-87905865 CTGCACCTGGCACTGTGCCATGG - Intronic
1142181112 16:88670901-88670923 CAGGATCAGGCTCTGTTGCTCGG - Intergenic
1142355579 16:89600082-89600104 CTGGAGCAAGCACTGTGGCCAGG - Intergenic
1142421256 16:89972079-89972101 CTGGGCTAGGCAGTGGGGCTGGG - Exonic
1143070867 17:4292031-4292053 CTGGGCCGGGCACAGTGGCTCGG + Intronic
1143518605 17:7432602-7432624 CTGGACCAGGCACCCAGGCAGGG + Intergenic
1143636007 17:8163878-8163900 TTGGCCCAGGCCCTGTGCCTGGG - Intergenic
1143878790 17:10013942-10013964 CTGGGCCACCCTCTGTGGCTGGG + Intronic
1144383668 17:14728362-14728384 CTAGACGAGGAACTGAGGCTTGG - Intergenic
1144836765 17:18160598-18160620 CTGGGCCAATCACTGTGGCCAGG + Intronic
1145919759 17:28601495-28601517 GTGGGCCAGGCACAGTGGTTTGG + Intronic
1146663864 17:34683615-34683637 CAGGCCCAGGCCTTGTGGCTGGG - Intergenic
1146905697 17:36616505-36616527 CTGGGTCAGGCACTGTGCATGGG + Intergenic
1147382915 17:40066069-40066091 CAGAACCAGGCCCTGAGGCTGGG - Intronic
1148491557 17:48026775-48026797 CTGGACGTGGCACTGTGGGCGGG - Intronic
1148782386 17:50129472-50129494 GTGGACCGGGAACTGGGGCTAGG - Intronic
1150411048 17:64940858-64940880 CTGGTTCAGGCACTGTGACGTGG + Intergenic
1151018661 17:70586785-70586807 GTGGACCAAGAACTATGGCTGGG + Intergenic
1151296374 17:73189489-73189511 CCGGGCCAGGCACTGTGCCGGGG - Intergenic
1151342527 17:73481114-73481136 CTGGAGCAGGCACTGGGGAGGGG + Intronic
1151363181 17:73600753-73600775 ATGGACCAGGCACTGGGGAGGGG - Intronic
1152237951 17:79148241-79148263 CTGGAGAAGGGACTGTGGGTGGG - Intronic
1152431227 17:80249157-80249179 CAGGACCAGGCAGCGTGGCGGGG - Exonic
1152695526 17:81741940-81741962 CTGCACCCGGCACCGTCGCTGGG + Intergenic
1152782909 17:82234301-82234323 CTGTCCCAGGCACTGTGGTGGGG + Exonic
1152796307 17:82309276-82309298 CTGGTCCAGGCTTTGGGGCTGGG + Intergenic
1203161550 17_GL000205v2_random:56936-56958 CTGTACCAGGCACTGAGGGAAGG - Intergenic
1153711519 18:7804329-7804351 CTGAGCCAGTCACTGTGGCCAGG + Intronic
1153959390 18:10127735-10127757 CAGGACCAGTCCCTGTGGCCTGG - Intergenic
1154410565 18:14139236-14139258 TGGGACCAGGCAGTGTGACTGGG - Intergenic
1156807816 18:41208188-41208210 CTGATCCGGGCACTGTGGTTAGG + Intergenic
1158503871 18:58028729-58028751 CTGAACCCATCACTGTGGCTGGG + Intergenic
1158591318 18:58781178-58781200 CTGGGCCAGGCACAGTGCCTGGG - Intergenic
1159004243 18:62998632-62998654 CTAGACCAGTCACTGTAACTGGG - Intergenic
1160348217 18:78152092-78152114 CGGGTCCAGGGACTGGGGCTGGG - Intergenic
1160911452 19:1475740-1475762 CTGGGAGAGGCACAGTGGCTGGG + Intronic
1161630990 19:5355351-5355373 CTGTTCCAGGCACTGTTCCTGGG + Intergenic
1161933521 19:7356919-7356941 GTGTACCAGGCACTGTGCCGGGG + Intronic
1162488420 19:10976452-10976474 GTGGGTCAGGCACTGTGGCTTGG + Intronic
1162914627 19:13867531-13867553 TTGGGCCAGGCATGGTGGCTCGG - Intronic
1162921039 19:13903266-13903288 CTGGATCATTCTCTGTGGCTGGG + Intronic
1162986989 19:14277312-14277334 CCGGGCCAGGCCCTGTGCCTGGG + Intergenic
1163113391 19:15175130-15175152 GTGGACCAGGAATTGTGGCCGGG - Intronic
1163284632 19:16338649-16338671 CACGAGCAGGCACTCTGGCTCGG + Intergenic
1163644379 19:18480139-18480161 CTGGACCACACGCCGTGGCTTGG - Intronic
1163710816 19:18845727-18845749 ATGGACATGGCTCTGTGGCTAGG + Intronic
1164539755 19:29113971-29113993 CTGTACGAGGCAGTGGGGCTGGG + Intergenic
1164743484 19:30594329-30594351 CTGGGACAGGCCCTGTGGCCTGG - Intronic
1165394410 19:35556515-35556537 CTGAGCCAGTCACTGGGGCTGGG - Intronic
1165474388 19:36021814-36021836 ATGGACCAGGAACTGAGGCATGG - Intronic
1165541754 19:36497780-36497802 CTGTACCAGACACTGTGGGAAGG - Intergenic
1165732849 19:38157580-38157602 CTGGGCCAGGCACAGTCTCTGGG - Intronic
1166043351 19:40215923-40215945 CTGGCCCAGGCCCTGATGCTGGG + Intergenic
1166736175 19:45086391-45086413 CTGCACCACTCCCTGTGGCTTGG - Intronic
1166820264 19:45574949-45574971 CTGGAACTGGCACTGGGACTGGG - Intronic
1166929816 19:46295806-46295828 CTGAACCAATCACTGTGGCCAGG + Intergenic
1167456133 19:49597406-49597428 CTGGATCAGGCCCAGCGGCTCGG - Exonic
1168089806 19:54075078-54075100 CTGGGCCAGGCACTGAGGGACGG + Exonic
1168470175 19:56633482-56633504 CTGTGCCAGGCACTGTTGCAGGG + Intergenic
926036385 2:9639084-9639106 CAGGATCAGGGAGTGTGGCTGGG - Intergenic
926218685 2:10921117-10921139 CTGGCCCAGCCACTGTGCCGCGG - Intergenic
927234251 2:20855936-20855958 CTTGCCCAGGCACTGGGTCTGGG - Intergenic
927388235 2:22561496-22561518 CTGCACCAGGCACTGTGGTACGG + Intergenic
927475452 2:23411085-23411107 CTGTGCCAGGCACAGTGGCATGG + Intronic
927721800 2:25387852-25387874 CTGTAACAGGCACTGTAACTGGG - Intronic
928053799 2:28029809-28029831 CTGAACCATGCACTGTTGATGGG - Intronic
928072576 2:28232086-28232108 CCTGACCAGGCACAGTGGCTTGG - Intronic
928300027 2:30116852-30116874 CAGGGCCAGGGACTGTGTCTGGG - Intergenic
928419817 2:31129696-31129718 TTGGACCAGTCTCTATGGCTGGG + Intronic
930520236 2:52456768-52456790 CAGGACTAGGCAGTGTGTCTTGG - Intergenic
931274666 2:60733962-60733984 CTTTGCCAGGCACAGTGGCTTGG + Intergenic
931285013 2:60824822-60824844 CTGTACCAAGCACTGTGCCAAGG + Intergenic
932417781 2:71584142-71584164 CTGGGCCTGGCCCTGGGGCTGGG + Intronic
933051670 2:77609859-77609881 CTGGAGGAGGCACTGTGATTAGG + Intergenic
933714390 2:85349551-85349573 ATGGAAAAGGCACTGTGGTTGGG + Exonic
934617828 2:95785856-95785878 CTTGACCAATCCCTGTGGCTAGG - Intergenic
934643065 2:96038703-96038725 CTTGACCAATCCCTGTGGCTAGG + Intronic
934699750 2:96430114-96430136 CTGGAACTGGAACTGTGTCTTGG - Intergenic
935002756 2:99036381-99036403 ATGTTCCAGTCACTGTGGCTAGG + Intronic
935587725 2:104816790-104816812 ATGGGCCAGGCACTGTGCCGGGG - Intergenic
936142008 2:109948593-109948615 CTGTGCCAGGCACTGTGCCAGGG - Intergenic
936178696 2:110246541-110246563 CTGTGCCAGGCACTGTGCCAGGG - Intergenic
936202682 2:110422891-110422913 CTGTGCCAGGCACTGTGCCAGGG + Intronic
936288659 2:111200854-111200876 CAGGACCAATCACTGTGGCAGGG - Intergenic
936403257 2:112182076-112182098 CTGGACCAGGTTCTGAGGCGGGG - Intronic
936949676 2:117965425-117965447 CTGGCCCAGGCAATGTCCCTGGG + Intronic
937061733 2:118985060-118985082 CTGGGCCAGGCACTGTGCCTGGG + Intronic
937469525 2:122163277-122163299 CTGGTCAAGGCACTGTAGCTTGG + Intergenic
937725657 2:125162516-125162538 CTGGGGCAGGGATTGTGGCTTGG - Intergenic
938166224 2:129029308-129029330 GGGGACAGGGCACTGTGGCTGGG + Intergenic
938339072 2:130523354-130523376 CTGGAAGATGCACTGTGGATCGG - Intronic
938350766 2:130597396-130597418 CTGGAAGATGCACTGTGGATCGG + Intronic
939801799 2:146720371-146720393 CTGGAGCAGGCACTGGGAGTGGG - Intergenic
940977379 2:159961192-159961214 CAGGAGAAGGCACTGTGGGTGGG + Intronic
941006423 2:160251739-160251761 CAGGCCCATGCACTGTGGCCAGG + Intronic
943482735 2:188441585-188441607 CTGGAAGATTCACTGTGGCTAGG - Intronic
944742528 2:202626347-202626369 GTGTACCAGGCACTGTGGTAAGG + Intergenic
945516174 2:210765746-210765768 CTGAACCAGTCACTGTGGCAGGG + Intergenic
946378222 2:219327160-219327182 CTAGACCACACAGTGTGGCTGGG + Intergenic
947872938 2:233449796-233449818 CTGGTCCTGGCACTGGGGCAGGG - Intronic
947919340 2:233855643-233855665 CTGGATCAGTCACTGGTGCTGGG - Intergenic
948440020 2:237980764-237980786 CAGTACCTGGCACTGGGGCTGGG - Intronic
948619220 2:239223532-239223554 CTGGTTCAGGAACTGAGGCTGGG - Intronic
948643526 2:239389879-239389901 CTGAACCAGTCACTGTGACCGGG - Intronic
948821891 2:240554143-240554165 CTGGCCCAGGCACTGGGGCTGGG - Intronic
948834581 2:240620009-240620031 CTGCACAAGGCTCTGTGACTGGG - Intronic
1169045007 20:2528159-2528181 CAGGCCTAGGCACTGAGGCTGGG + Intergenic
1169409461 20:5355226-5355248 GTGAACCAGTCACTGTGGCCGGG - Intergenic
1170060824 20:12257044-12257066 CTGAACCAATCACTGTGGCCAGG + Intergenic
1170111491 20:12808708-12808730 CTGAACCCAGCAGTGTGGCTGGG + Intergenic
1170427233 20:16247074-16247096 CTGAACCAATTACTGTGGCTGGG + Intergenic
1170555738 20:17513457-17513479 CTGGCCCAGGCACTGTTCCCAGG + Intronic
1170617141 20:17962870-17962892 CTAGAACAGGAACTGAGGCTTGG + Intronic
1171780704 20:29415351-29415373 CAGGACCAGGCAGTGTGGCTGGG + Intergenic
1172145527 20:32755200-32755222 CTGTGCCAGGCACTGTGGTAAGG - Intergenic
1173220648 20:41130074-41130096 CTTGGCCAGGTACGGTGGCTGGG - Intergenic
1173499055 20:43539268-43539290 CTGGACCATGGACAGAGGCTGGG + Intronic
1173551638 20:43936957-43936979 GTGTGCCAGGCACTGTGGCAGGG + Intronic
1173895648 20:46548812-46548834 CTGCACCAGTCACGGTGGCCAGG - Intronic
1173903341 20:46607029-46607051 CTGTACCAGGCACCATGGCAAGG + Intronic
1174357307 20:50007083-50007105 CTGAGCCAGGCACAGTGGCTGGG - Intergenic
1174707779 20:52674776-52674798 CTGGACCCATCACTGTGGCCAGG + Intergenic
1174786589 20:53438523-53438545 CTGGACCAATCACTGTGGCTAGG + Intronic
1175393721 20:58644185-58644207 CGGGACCTGCCACTGTGGTTAGG + Intergenic
1175412077 20:58777058-58777080 GTAGACCTGGCACAGTGGCTTGG - Intergenic
1175468497 20:59208984-59209006 CTGGACTCGGCACTGTGACAGGG + Intronic
1176341179 21:5697385-5697407 CTGTACCAGGCACTGTGGGAAGG + Intergenic
1176473433 21:7129538-7129560 CTGTACCAGGCACTGTGGGAAGG + Intergenic
1176503648 21:7627071-7627093 CTGTACCAGGCACTGTGGGAAGG - Intergenic
1176628636 21:9116742-9116764 CTGGACAGGGCAATGTGGGTTGG - Intergenic
1176862503 21:14019175-14019197 TAGGACCAGGCAGTGTGGCTGGG + Intergenic
1177193334 21:17876007-17876029 ATGGACCAGGCACTGTGCTGTGG + Intergenic
1178372606 21:32038588-32038610 CTGGAGGAGGCACTGTGCATTGG - Intronic
1179368131 21:40778391-40778413 CTGGGCCAGGCACGGTGGCTGGG - Intronic
1179524005 21:41963959-41963981 CTGGAGCAGGCACAGTGCCATGG - Intergenic
1179594155 21:42430920-42430942 CTGGGCCTGGCTCTGGGGCTGGG + Intronic
1179599056 21:42463696-42463718 GTGTGCCAGGCACTGTGCCTGGG - Intergenic
1179639403 21:42737190-42737212 CTGGCCCAGGCCCTGTGCATCGG - Intronic
1179930611 21:44568684-44568706 CTGGCCCAGGCTGAGTGGCTGGG + Intronic
1180065756 21:45411389-45411411 GTGGACCAAGAACAGTGGCTGGG - Intronic
1180672862 22:17566692-17566714 CTGGGCCAGGCACGGTGGCTCGG - Intronic
1181735803 22:24880644-24880666 CTGCATTAGGCACTGTGGATGGG - Intronic
1182295903 22:29311175-29311197 CTGGGGCGGGCCCTGTGGCTGGG + Intronic
1182779681 22:32857910-32857932 TTAGCCCAGGCACTGTGGCTGGG - Intronic
1183212119 22:36457653-36457675 CTGCACCAGGCCCTGGGCCTGGG + Intergenic
1183327239 22:37200881-37200903 CTGGACTAGGAACTGTGTTTTGG + Intergenic
1183360883 22:37382829-37382851 CAGGGCCAGGTACGGTGGCTGGG - Intronic
1183630570 22:39030132-39030154 CTGGGCCAGTCACTGTGGGCTGG + Intronic
1183634026 22:39050224-39050246 CTGGGCCAGTCACTGTGGGCTGG + Intronic
1183975782 22:41511465-41511487 CTGGCCTAGGCGCAGTGGCTGGG - Intronic
1184019062 22:41808461-41808483 CTGGGTGAGGCACTGTGCCTGGG - Intronic
1184023357 22:41835608-41835630 CTCGGCCAGGCACGGTGGCTCGG - Intronic
1184377492 22:44123902-44123924 CTGTGCCAGGCACTGTGCCAGGG - Intronic
1184749202 22:46474465-46474487 CGGGACCAGACACTGGGGCAGGG - Intronic
1185037496 22:48487417-48487439 TTGGGCCAGGCACTGGGACTGGG - Intergenic
1185039932 22:48498650-48498672 CTGGGCCATGCTCTGTGGCAGGG + Intronic
1185399935 22:50610503-50610525 ATGGCCCAGGCACTCTGGCAGGG + Intronic
1203240444 22_KI270733v1_random:11849-11871 CTGTACCAGGCACTGTGGGAAGG + Intergenic
949341425 3:3034837-3034859 CTGGACACAGCACTGTGGCAAGG + Intronic
950407914 3:12816114-12816136 CTTGACCAGGGACTGAGCCTGGG - Intronic
952125060 3:30290689-30290711 CTGGACCTGGCACGGACGCTGGG + Intergenic
952828668 3:37545113-37545135 CTGGAGCAGGAACTGGGGCCTGG + Intronic
953368284 3:42366037-42366059 CTGTTCCAGGCACTGGGGTTAGG + Intergenic
953485874 3:43295135-43295157 CTGGTCCAGGTCTTGTGGCTTGG + Intronic
953748689 3:45594012-45594034 CTGCACCCGGCAGCGTGGCTGGG - Intronic
954461718 3:50630601-50630623 CTGGACCAGGCCCTGCTACTCGG - Intronic
954663896 3:52240294-52240316 CTTGTCCAGGGACTTTGGCTGGG + Intergenic
955822078 3:62907204-62907226 CTGGACCAAACACTGTGCCAGGG - Intergenic
956374354 3:68598326-68598348 CTGCACCAGTCACTGTGGCTAGG - Intergenic
956450499 3:69370305-69370327 CTGCACCCGGCCCTGTGGTTGGG - Intronic
956687783 3:71847105-71847127 GTGGGCCAGACACAGTGGCTCGG - Intergenic
956767851 3:72499163-72499185 CTGAACCAATCACTGTGGCTAGG - Intergenic
956782366 3:72614092-72614114 CTGAACCAATCACTGTGACTAGG - Intergenic
957084303 3:75665921-75665943 CAGGACCAGGCAGTGTGGCTGGG - Exonic
959356420 3:105335087-105335109 CTGGACCAGTCACTGTGTCAGGG - Intergenic
959663632 3:108897188-108897210 CTGTATCAGCCACTGTGCCTAGG - Intergenic
960520954 3:118654757-118654779 CTGAGCCAGTCACTGTGGCCAGG - Intergenic
961038158 3:123657530-123657552 CAGGACCAGGGACTTTGGATTGG - Intronic
961384011 3:126514306-126514328 CTGGCACAGGCGCTGTGGGTGGG + Intronic
961572312 3:127808492-127808514 CTGAACCAATCACTGTAGCTGGG + Intronic
962200911 3:133400359-133400381 CTGGAGCCGGCACGGTGGCCAGG - Exonic
962407051 3:135109440-135109462 ATGAACCAGGCACTGTGCCAAGG - Intronic
963038866 3:141054102-141054124 CTGCACTGGCCACTGTGGCTTGG - Intronic
963049554 3:141129301-141129323 CTGGATCAGGCTCTGCAGCTGGG + Intronic
963648699 3:147948950-147948972 CTGGACCAAGCACAATGGCCAGG + Intergenic
964130888 3:153285271-153285293 CTCGACCAGTCACTGTGTCCAGG - Intergenic
964704609 3:159604496-159604518 CTGTGCCAGGCACTGTGCCAGGG + Intronic
964726545 3:159819749-159819771 CTAGACCAGGCAGTGTATCTAGG + Intronic
965464419 3:169010276-169010298 CTGAACCAATCACTGTGGCCAGG - Intergenic
966146048 3:176813340-176813362 CTTGACCAAGCACTGAGGGTGGG - Intergenic
966731950 3:183158790-183158812 CTGTACCAGGCACTGGGGGTAGG + Intronic
966775551 3:183540106-183540128 CTGAACCAATCATTGTGGCTTGG - Intronic
967229130 3:187320919-187320941 CTGGGTCAGGCTCTGTGTCTGGG + Intergenic
967925059 3:194639449-194639471 GTGGCGCAGGCACTGGGGCTTGG - Intergenic
968322006 3:197777992-197778014 GAGGGCTAGGCACTGTGGCTCGG - Intronic
968483623 4:848436-848458 CTTGTCCAGGCAGGGTGGCTGGG + Intergenic
968765219 4:2464811-2464833 CTGAAGCAAGCACTGTGGCAAGG + Intronic
968964304 4:3761759-3761781 CTGGACCAGGCAGTGGGGATGGG + Intergenic
969453190 4:7286524-7286546 CTGGGCCTGGCACTGGAGCTGGG + Intronic
969625325 4:8301996-8302018 ATGTGCCAGGCCCTGTGGCTGGG - Intronic
969876736 4:10141052-10141074 CTGGACCATGGACTGGGGATAGG + Intergenic
972702539 4:41508068-41508090 CTGGAACAAGCTCTGTGTCTTGG + Intronic
973614458 4:52664705-52664727 CTGAACCAGTCACTCTGGCTGGG - Intergenic
973765475 4:54157642-54157664 CTGGACCAATCTCTGAGGCTAGG - Intronic
973844910 4:54901838-54901860 GAGGAGCAGGGACTGTGGCTTGG + Intergenic
976482257 4:85558128-85558150 CTGGGCCAGTCACTGTTGCTAGG + Intronic
976595755 4:86893282-86893304 ATGGGCCAGGCACGGTGGATGGG + Intronic
977807572 4:101320754-101320776 CTGGATCAGGCAATGTGTCCAGG - Intronic
978739414 4:112120160-112120182 CTGGACCAATCACTGTAGCTAGG - Intergenic
979679197 4:123441071-123441093 TTGGACCAATCACTGTGGCTAGG - Intergenic
979813113 4:125064638-125064660 CTGGACCCAGCAATGTGGCTGGG + Intergenic
981821345 4:148890566-148890588 CAGCACCTGGCACTGTGCCTGGG + Intergenic
981934723 4:150227473-150227495 CTGGAGCAGGAACAGTGGGTAGG + Intronic
982137662 4:152287351-152287373 CTGAACCAGTGACTGTGGCCAGG - Intergenic
984843576 4:184091206-184091228 CTGGCCCAGCCACTGTGCCCTGG - Exonic
985446683 4:190025650-190025672 CAGGACCTGGCAGTGTGGCTGGG + Exonic
985742619 5:1627621-1627643 CTGTTCCAGGCACTGGGGATAGG - Intergenic
985927339 5:3028430-3028452 CTGGAACAGGCACTCAGGCCTGG - Intergenic
986416194 5:7530587-7530609 CTGGATGAGGTACTGGGGCTGGG - Intronic
986959252 5:13192941-13192963 CTGAACCAGTCACTGGGGATGGG + Intergenic
989730873 5:44646986-44647008 CTGGATCAGGCACATTGCCTAGG + Intergenic
989826809 5:45866368-45866390 CAGGGTCAGGCAGTGTGGCTGGG + Intergenic
994022244 5:95040741-95040763 CTGAATCAGTCACTGTGGCCAGG - Intronic
994336763 5:98576377-98576399 CTGTACCAGGCACTGTGGGAAGG + Intergenic
994382286 5:99085490-99085512 CTGAACCATTCACTGTGGCTGGG + Intergenic
996918340 5:128736877-128736899 CTGTGCCAGGCACTGTAACTTGG - Intronic
997618602 5:135270481-135270503 CTGGAGCAGCCACTGTTTCTGGG + Intronic
997872090 5:137515260-137515282 AGGGAACAGGCTCTGTGGCTAGG - Intronic
998133323 5:139661928-139661950 CTGGCCCAGGCAGAGTGGGTTGG + Intronic
998526172 5:142845252-142845274 CTGTACCAGGAACTGTGTCTAGG + Intronic
999740064 5:154543067-154543089 CTGAACCAGTCACTGTGGGAGGG - Intergenic
1000056776 5:157614043-157614065 CTGGGCCAGTCACTGTGACCGGG + Intergenic
1001276800 5:170357201-170357223 CCGGACCCTGCACTGTGGCTCGG + Intronic
1002139871 5:177132419-177132441 CTGGGCCTGGCACGGGGGCTCGG - Intergenic
1003502727 6:6715583-6715605 CAGGACCAGGCCCCATGGCTGGG + Intergenic
1003524389 6:6885859-6885881 CAGGTCCAGGCCCAGTGGCTGGG + Intergenic
1005390972 6:25332909-25332931 CTGGACTAATCACTGTGGCCAGG - Intronic
1005725559 6:28644220-28644242 CTGGGCCGGGCCCGGTGGCTGGG + Intergenic
1006507784 6:34501432-34501454 CTGGACCAGGCAGCCTAGCTAGG + Intronic
1006625262 6:35393093-35393115 CAGGACCAGGGCCAGTGGCTTGG + Intronic
1006952089 6:37831188-37831210 CATGACCAGGCTCTGTGGCAAGG - Intronic
1007032610 6:38641600-38641622 CTGGAGCAGGGCCTGTGGGTAGG + Intergenic
1007259240 6:40551119-40551141 CTGGACTAGTCTCTGTGGCCAGG - Intronic
1007709036 6:43810055-43810077 CTGGATCAGGCACTGTGTTTAGG - Intergenic
1009874671 6:69490936-69490958 TTGGACCTCTCACTGTGGCTTGG - Intergenic
1011721123 6:90157662-90157684 CTGGATCAGGAACTGGGGCTGGG + Intronic
1013059831 6:106622761-106622783 CTGGATCAGGGTCTGTGGGTTGG + Intronic
1013067288 6:106696058-106696080 ATGGATCAGGCACTGTGGCTGGG + Intergenic
1013355003 6:109338976-109338998 CTGGCCCAGGCACTGTAGTCTGG - Intergenic
1013588953 6:111604363-111604385 CTGGACCAGTCACTGTGTGTGGG - Intronic
1015259181 6:131215285-131215307 CTGGGCCAGTCTATGTGGCTGGG - Intronic
1015386653 6:132632454-132632476 CTGTACCAGGCTCTGTGGCAGGG + Intergenic
1016502989 6:144743638-144743660 CTGGACCAGGAACAGAGACTAGG - Intronic
1016770166 6:147840298-147840320 GTGTACAAGGCACTGTGCCTGGG + Intergenic
1019369416 7:653148-653170 CTGGGCCTGGCTGTGTGGCTGGG - Intronic
1019447445 7:1078762-1078784 CTGGAGCAGGCACTGTCCCGGGG - Intronic
1021223731 7:18004164-18004186 AAGGACCAGGAACTGTGGCCAGG - Intergenic
1022158530 7:27684588-27684610 CTGTACCAGTCACTGTGGCAAGG - Intergenic
1022283032 7:28929794-28929816 GTGCACCTGGCACTGTGCCTGGG - Intergenic
1022345010 7:29506172-29506194 ATAGGCCAGGCACGGTGGCTAGG + Intronic
1022403687 7:30065941-30065963 CTGAATCAGACACTGAGGCTGGG + Intronic
1022703163 7:32780164-32780186 CTGGGCCAGGCACTGTACCAGGG - Intergenic
1022907395 7:34870298-34870320 CTGGGCCAGGCACTGTACCAGGG - Intronic
1023841036 7:44097514-44097536 CTGCACCTGGCACTCTGACTAGG - Intergenic
1023938743 7:44757032-44757054 CTGTCCCAGGCACTGTGGGGAGG - Exonic
1024579179 7:50788037-50788059 CAGCACCAGGCACTGTCCCTGGG + Intronic
1024948471 7:54834562-54834584 CTGGACCAGGCACTGGGAGGCGG - Intergenic
1025141277 7:56468860-56468882 CTGGCCCAGGAACTGTGGATTGG + Intergenic
1025192515 7:56906905-56906927 AGGGACCTGGCCCTGTGGCTTGG - Intergenic
1025241224 7:57277769-57277791 CTGGCCCAGGAACTGTGGATTGG + Intergenic
1025679431 7:63670017-63670039 AGGGACCTGGCCCTGTGGCTTGG + Intergenic
1026151176 7:67789252-67789274 CTGTTCCAGGCACTGTTCCTTGG + Intergenic
1027829759 7:83162721-83162743 CTGGACCAGGCACTGCCGCCCGG + Exonic
1028144940 7:87311065-87311087 ATGGACCAGGCTCTTTGGGTTGG - Intergenic
1028505526 7:91566196-91566218 CTAGAGCTGGCCCTGTGGCTTGG - Intergenic
1028738806 7:94248799-94248821 CCTTTCCAGGCACTGTGGCTGGG - Intergenic
1029237195 7:99130877-99130899 CTGAACCAACCGCTGTGGCTGGG - Intronic
1029669685 7:102020995-102021017 AGGGACCTGGCCCTGTGGCTTGG - Intronic
1031411899 7:121449275-121449297 CTGAACCAATCACTGTGGCCAGG + Intergenic
1031420110 7:121541724-121541746 CTATACCAGGCACTGTACCTTGG + Intergenic
1032216794 7:129963673-129963695 CTGAACCAGGCACTGTACCAAGG + Intergenic
1033719290 7:144040493-144040515 CTGAGCCAGGCACTCTGGATAGG + Intergenic
1034460916 7:151197625-151197647 CTGGAGCAGGCATTGTGGCTGGG - Intronic
1035277071 7:157754047-157754069 GAGGACCAGGCGTTGTGGCTGGG + Intronic
1035976738 8:4320947-4320969 CTGGACCTGGCAGAGTGGCTAGG - Intronic
1036775425 8:11608726-11608748 CGGGACCAGGCTCTGTGTCAGGG - Intergenic
1036785576 8:11683811-11683833 CTGGCCCAGGCATTGTGGGGAGG - Intronic
1043172307 8:76980563-76980585 CTGAACCAGCCACTATAGCTAGG - Exonic
1043348846 8:79334497-79334519 CTGGAGCAAGAGCTGTGGCTGGG + Intergenic
1043695118 8:83208092-83208114 CTGGAGCAGGCACTGGAGGTAGG - Intergenic
1045009055 8:97942053-97942075 CTGGACTAGGCACTGTGATGGGG - Intronic
1045135226 8:99209687-99209709 AAGGGCCAGGCACAGTGGCTTGG - Intronic
1045211425 8:100104033-100104055 CTGGGCCTGGAACAGTGGCTCGG + Intronic
1045252491 8:100493526-100493548 GTGAGCCAGGCACTGTGCCTGGG + Intergenic
1045389738 8:101703659-101703681 CTGCTCCTGGCACTGTGGCTTGG - Intronic
1047312040 8:123700130-123700152 CTGGAGCAGCCACTGTGGGGCGG - Intronic
1047931078 8:129728676-129728698 CTGGTGCAGCCAGTGTGGCTGGG - Intergenic
1048179970 8:132185447-132185469 CTCAACCAGGCACTGAGACTGGG + Intronic
1048553229 8:135453394-135453416 CTGGACCAGGCACTGGGGCTGGG + Intergenic
1049364759 8:142231826-142231848 CAGCAGCAGGCTCTGTGGCTGGG - Intronic
1049553317 8:143270564-143270586 CTGCAGCACACACTGTGGCTGGG + Intronic
1050309505 9:4338797-4338819 CTGGAAAAAGCACTGTTGCTTGG + Intronic
1051199066 9:14597326-14597348 CTGGACTCAGCAGTGTGGCTGGG + Intergenic
1051547661 9:18294429-18294451 CTTGCCCAGGTTCTGTGGCTGGG + Intergenic
1052691377 9:31820671-31820693 CTGGAGCAGGCACTGGGGGTGGG - Intergenic
1053144642 9:35704220-35704242 CTGGACCAGGCACCTTGGACGGG - Intronic
1053441629 9:38121036-38121058 ATGGCACATGCACTGTGGCTAGG - Intergenic
1053753695 9:41280783-41280805 CTCTACCAGGCACTCTGACTAGG - Intergenic
1054259218 9:62845143-62845165 CTCTACCAGGCACTCTGACTAGG - Intergenic
1054332561 9:63774894-63774916 CTCCACCAGGCACTCTGACTAGG + Intergenic
1055030610 9:71768877-71768899 CTGGGCCGGGAACTGTGGATTGG + Exonic
1056622246 9:88224220-88224242 TTAGACCAGCCACTGTGGCCAGG - Intergenic
1058608035 9:106744371-106744393 CTCGACCAGGCGTAGTGGCTGGG + Intergenic
1058667633 9:107335310-107335332 CTGGATCAGGCCCTTTTGCTTGG - Intergenic
1202799569 9_KI270719v1_random:163205-163227 CTCTACCAGGCACTCTGACTAGG + Intergenic
1203421888 Un_GL000195v1:608-630 CTGTACCAGGCACTGTGGGAAGG - Intergenic
1203751483 Un_GL000218v1:84421-84443 CTGGACAGGGCAATGTGGGTTGG - Intergenic
1187507455 X:19888363-19888385 CTGGCCCAGGCACTGGGGCGGGG - Intergenic
1190010633 X:46781476-46781498 CTGAACCAATCACTGTGGCTGGG + Intergenic
1190030747 X:46970507-46970529 GTGCACCAAACACTGTGGCTTGG - Intronic
1192110496 X:68359026-68359048 CTGGAAGAGCCAGTGTGGCTAGG + Intronic
1192189668 X:68983219-68983241 CTGGCCCAGGCACTGAGGTCAGG + Intergenic
1192319412 X:70077386-70077408 GTGAACCAGTCACTGTGGCCAGG - Intergenic
1192536578 X:71933690-71933712 TTGTGCCAGGCACTGTGGCAAGG - Intergenic
1195353763 X:104018904-104018926 CTGGATCAGGCAGTGTGTATGGG + Intergenic
1195465775 X:105177039-105177061 CTGGACCACAGACTGTGGCCTGG + Intronic
1195466411 X:105183744-105183766 CTGGGCCTGGCAGTGTGGCAGGG - Intronic
1195594281 X:106670680-106670702 CTGTACCAAGCACTGTGCCTGGG + Intronic
1198740122 X:139833419-139833441 CTGGACCTGGCACAGTGGCTTGG + Intronic
1198750732 X:139933819-139933841 TTGTACCAGGCACTGTGCCAGGG + Intronic
1198792685 X:140362731-140362753 CTGGACCAGGCTCTGTGGAGGGG - Intergenic
1198968425 X:142251816-142251838 CTGAACCAATCACTGTGGATAGG + Intergenic
1201392529 Y:13513510-13513532 CTGGATCAGGCCTTGTCGCTGGG - Intergenic