ID: 1139919352

View in Genome Browser
Species Human (GRCh38)
Location 16:70449545-70449567
Sequence CAGTGTGAGGAGAAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139919342_1139919352 28 Left 1139919342 16:70449494-70449516 CCAAGTGTAGATGGAGAATGACT No data
Right 1139919352 16:70449545-70449567 CAGTGTGAGGAGAAGGTGGGTGG No data
1139919347_1139919352 5 Left 1139919347 16:70449517-70449539 CCAGTGGGAGAAGACTGAGGGAA No data
Right 1139919352 16:70449545-70449567 CAGTGTGAGGAGAAGGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139919352 Original CRISPR CAGTGTGAGGAGAAGGTGGG TGG Intergenic
No off target data available for this crispr