ID: 1139922590

View in Genome Browser
Species Human (GRCh38)
Location 16:70469311-70469333
Sequence CAGTACCCACCCATGGTAAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 106}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139922590_1139922603 10 Left 1139922590 16:70469311-70469333 CCCCTTACCATGGGTGGGTACTG 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1139922603 16:70469344-70469366 CCCTGGGGTGGGGAGACCATGGG 0: 1
1: 0
2: 3
3: 37
4: 400
1139922590_1139922600 0 Left 1139922590 16:70469311-70469333 CCCCTTACCATGGGTGGGTACTG 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1139922600 16:70469334-70469356 CCTCTCAGCTCCCTGGGGTGGGG 0: 1
1: 0
2: 4
3: 63
4: 427
1139922590_1139922601 9 Left 1139922590 16:70469311-70469333 CCCCTTACCATGGGTGGGTACTG 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1139922601 16:70469343-70469365 TCCCTGGGGTGGGGAGACCATGG 0: 1
1: 0
2: 6
3: 57
4: 455
1139922590_1139922598 -1 Left 1139922590 16:70469311-70469333 CCCCTTACCATGGGTGGGTACTG 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1139922598 16:70469333-70469355 GCCTCTCAGCTCCCTGGGGTGGG 0: 1
1: 0
2: 4
3: 40
4: 363
1139922590_1139922607 30 Left 1139922590 16:70469311-70469333 CCCCTTACCATGGGTGGGTACTG 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1139922607 16:70469364-70469386 GGGAGTGAGGACCCCAAGAATGG 0: 1
1: 0
2: 1
3: 26
4: 261
1139922590_1139922595 -6 Left 1139922590 16:70469311-70469333 CCCCTTACCATGGGTGGGTACTG 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1139922595 16:70469328-70469350 GTACTGCCTCTCAGCTCCCTGGG 0: 1
1: 0
2: 2
3: 37
4: 196
1139922590_1139922596 -5 Left 1139922590 16:70469311-70469333 CCCCTTACCATGGGTGGGTACTG 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1139922596 16:70469329-70469351 TACTGCCTCTCAGCTCCCTGGGG 0: 1
1: 0
2: 1
3: 31
4: 280
1139922590_1139922605 17 Left 1139922590 16:70469311-70469333 CCCCTTACCATGGGTGGGTACTG 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1139922605 16:70469351-70469373 GTGGGGAGACCATGGGAGTGAGG 0: 1
1: 0
2: 4
3: 36
4: 429
1139922590_1139922597 -2 Left 1139922590 16:70469311-70469333 CCCCTTACCATGGGTGGGTACTG 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1139922597 16:70469332-70469354 TGCCTCTCAGCTCCCTGGGGTGG 0: 1
1: 0
2: 4
3: 35
4: 323
1139922590_1139922594 -7 Left 1139922590 16:70469311-70469333 CCCCTTACCATGGGTGGGTACTG 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1139922594 16:70469327-70469349 GGTACTGCCTCTCAGCTCCCTGG 0: 1
1: 0
2: 1
3: 38
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139922590 Original CRISPR CAGTACCCACCCATGGTAAG GGG (reversed) Exonic
902719202 1:18292826-18292848 CAGTACCCACCCCTCCTCAGAGG + Intronic
905446438 1:38030956-38030978 CAGGACCCACCCAGGGAAGGAGG - Intergenic
906781408 1:48576083-48576105 CAGTACCAATCCATGGCCAGGGG - Intronic
906846674 1:49200164-49200186 CAGTACCCACACAAATTAAGTGG - Intronic
910874658 1:91867295-91867317 CAGTACGCACAGATGGTACGAGG + Intronic
912314918 1:108659421-108659443 CAGTAGCTACACATGGCAAGTGG - Intronic
918084591 1:181234948-181234970 CAGTACCCACCCCAGGGAATTGG + Intergenic
918793029 1:188855771-188855793 CAATATTTACCCATGGTAAGTGG - Intergenic
919903062 1:202058077-202058099 CAGCACCCAACCATGCTCAGTGG - Intergenic
920191390 1:204196341-204196363 CAGTGTCCACCCCTGGGAAGGGG - Intronic
924787471 1:247211517-247211539 CAGTACTCACACATGGCCAGTGG + Intergenic
1066075661 10:31873493-31873515 CAATAACCACCCATGGCCAGTGG + Intronic
1068161237 10:53267503-53267525 AAGATCCCACCCATGGCAAGTGG - Intergenic
1073111327 10:101064634-101064656 CAGTGCTCACACCTGGTAAGGGG + Exonic
1073810803 10:107150666-107150688 CAGTTCCCTCCCATGGCACGTGG - Intronic
1074146246 10:110720009-110720031 CTGTACCCTCCTATGGCAAGAGG + Intronic
1074714703 10:116207463-116207485 GAGTAGCCACCCATGGCAAATGG + Intronic
1075088858 10:119431618-119431640 CGGTCCCCACCCCTGGGAAGGGG + Intronic
1081325268 11:41737005-41737027 CAGTTTCCACACATGGTGAGAGG - Intergenic
1081641057 11:44754872-44754894 CAATGCCCACCGATGGCAAGAGG + Intronic
1084443271 11:69188280-69188302 CAGATCCCTCCCATGATAAGTGG + Intergenic
1085251411 11:75146395-75146417 CAGAACCCATCCATGGTCGGTGG - Intronic
1086844669 11:91733677-91733699 CAGTTCCCTCCCATGGAATGTGG + Intergenic
1090110503 11:123902817-123902839 CAGTAGCCACCTATGGCTAGTGG - Intergenic
1093697858 12:22182676-22182698 CAGGTCCCTCCCATGGTATGTGG + Intronic
1101471185 12:104998839-104998861 CAGTGGCCACTCAGGGTAAGGGG + Intronic
1102550391 12:113687484-113687506 CAGTACCCACCCATAGCCACTGG + Intergenic
1102784788 12:115595668-115595690 CTGAACCCTCCCATGGTCAGTGG - Intergenic
1103365443 12:120379225-120379247 CAGTAGCCACACGTGGTGAGTGG - Intergenic
1106121894 13:26866789-26866811 CAATACCCACCTATGGCTAGTGG - Intergenic
1110809476 13:79795685-79795707 CATTACCCAACCAGGGCAAGTGG - Intergenic
1113751675 13:112780844-112780866 CAGAACCCACCCACGGCCAGAGG - Intronic
1122970473 14:105150149-105150171 CAGTACCAACAGATGGTCAGAGG + Intronic
1126744762 15:51814796-51814818 CATTACTCACCCATGTTCAGAGG - Exonic
1129197376 15:73977293-73977315 CACTAGTCAGCCATGGTAAGTGG + Intergenic
1133286387 16:4692780-4692802 CAGTACAAACACAAGGTAAGTGG + Intergenic
1139922590 16:70469311-70469333 CAGTACCCACCCATGGTAAGGGG - Exonic
1141967200 16:87453454-87453476 CAGTGCCCAGCCCTGGGAAGAGG + Intronic
1141995568 16:87634664-87634686 CCGTGCCCACCCATGGGAAACGG + Intronic
1143576915 17:7799075-7799097 CAGAAGCCACCCAGGGTCAGAGG - Intronic
1145105335 17:20110672-20110694 CAGTTCCGGCCCAGGGTAAGTGG - Intronic
1146483763 17:33227100-33227122 CAGTAGCCACACATGGCCAGTGG + Intronic
1147993646 17:44349997-44350019 TAATACCAACCCATGGTCAGTGG + Intronic
1148434623 17:47673182-47673204 CAATTCCCACCCATAGTCAGGGG - Intronic
1149006906 17:51815502-51815524 CTCTACCAATCCATGGTAAGAGG - Intronic
1149450078 17:56743221-56743243 CAGAACTGATCCATGGTAAGAGG + Intergenic
1151297893 17:73199013-73199035 CAGTACCCACCCTTCCTGAGTGG - Intronic
1156700093 18:39815251-39815273 CTGTACACACCCCTGGGAAGAGG - Intergenic
1156769025 18:40697380-40697402 CAGGTCCCTCCCATGGCAAGTGG - Intergenic
1157684607 18:49632099-49632121 CAGTAAGGACCCATGGCAAGAGG - Intergenic
1163084219 19:14967869-14967891 CAGAACCAGCCCATGGTCAGTGG - Intronic
1164823573 19:31267992-31268014 CAGGACCCTCTCATGGCAAGTGG - Intergenic
932447909 2:71791896-71791918 CAGTGCCCACCCATGTGGAGAGG + Intergenic
933870253 2:86559117-86559139 CAGCCCCCACCCAATGTAAGTGG + Intronic
934575527 2:95398291-95398313 CAGAACCAGCCCATGGTCAGTGG + Intergenic
936919613 2:117674285-117674307 CAGTAGCCACTCCTGGGAAGGGG - Intergenic
939569308 2:143821688-143821710 CAGTACCCTACCCTGATAAGAGG - Intergenic
946330430 2:219005924-219005946 CAGACCCAACCCATGGTGAGGGG - Intronic
946623915 2:221590852-221590874 CAGTAACCACATATGGTAAGTGG + Intergenic
948808470 2:240463043-240463065 CAGTTCCCACCCAGGGCATGTGG - Intronic
1172129935 20:32648863-32648885 TATTACCTAACCATGGTAAGTGG + Intergenic
1173055843 20:39611904-39611926 TAGTATCCTCCCATGGTAAGTGG + Intergenic
1173429412 20:42972870-42972892 CAGTAGCCACACATGGCTAGTGG - Intronic
1173896366 20:46553999-46554021 CAGTAGCCACACATAGCAAGTGG + Intergenic
1174099735 20:48118230-48118252 CAGCACCAACCCATTGTGAGAGG + Intergenic
1175592017 20:60200710-60200732 CAGGAGCCACCCAAGGCAAGGGG - Intergenic
1178961445 21:37070262-37070284 CATCACCTACCCAAGGTAAGCGG + Intronic
1179151131 21:38809259-38809281 CTGTAGCCACACATGGCAAGTGG + Intronic
1180883086 22:19220308-19220330 CAGTAGCCTCCCATGGCTAGTGG - Intronic
1182444260 22:30380941-30380963 CACTTCCCACCCACGGTCAGAGG + Intronic
949129286 3:482103-482125 CAGTAACCCCTCATGGCAAGTGG - Intergenic
950452238 3:13071992-13072014 CAGGCCCCTGCCATGGTAAGGGG + Intronic
952548685 3:34450629-34450651 CTGTACCTACCCCTGGGAAGGGG - Intergenic
952677919 3:36055306-36055328 CAGGTCCCACCCATGATATGTGG - Intergenic
962601033 3:136990962-136990984 CACTACCCACCTTTGGTAACTGG + Intronic
963575964 3:147060666-147060688 CAGTACCCACCTAAGGCCAGAGG + Intergenic
963952217 3:151215258-151215280 CAATACCCACACATGGCTAGTGG - Intronic
968818817 4:2835227-2835249 CAGAACACACCCAGGGGAAGGGG - Exonic
975798564 4:78034951-78034973 CAGTAGCAATCCATTGTAAGAGG + Intergenic
976396271 4:84559113-84559135 CAGTAGCCACATATGGTTAGTGG + Intergenic
978034009 4:103972359-103972381 CAGTGCCCACCTAAGGTCAGAGG + Intergenic
978771770 4:112464730-112464752 CAGTAGCCACACATGGAAACAGG + Intergenic
985524804 5:396364-396386 CAGACCCCAGCCATGGTATGCGG - Intronic
986263171 5:6166938-6166960 CACTACCCACCCAGGGCATGTGG + Intergenic
987236636 5:15949259-15949281 CAGTAACCACACATGGCAAGTGG - Intergenic
988824787 5:34924961-34924983 CAGTCACCAAACATGGTAAGCGG + Exonic
995933500 5:117480813-117480835 CTGTGCCCTCACATGGTAAGGGG - Intergenic
998667265 5:144312194-144312216 CAGTTCCTACCCATGTCAAGAGG - Intronic
1000733429 5:164866482-164866504 CAGTAACCACACATGGATAGTGG + Intergenic
1005479074 6:26238263-26238285 CAGTAGCCACATATGGTTAGTGG - Intergenic
1010890403 6:81302039-81302061 CAGTAGCCACACATGGCTAGTGG + Intergenic
1011133795 6:84077913-84077935 CAGTAACCACACATGGCCAGTGG - Intronic
1015813559 6:137185338-137185360 CGGTTCTCACCCATGGTAACAGG + Intergenic
1026663463 7:72322431-72322453 CAGTACCCATCCATGGCCAAGGG + Intronic
1028952577 7:96653524-96653546 CAGGACCCAGCAATGGGAAGAGG + Intronic
1035234217 7:157485749-157485771 CTGAGCCCACCCATGGTCAGCGG - Intergenic
1039463239 8:37763079-37763101 CTGTGCCCACGGATGGTAAGGGG + Intronic
1040805309 8:51389541-51389563 TAGTACCCACACAGGGTAAGGGG - Intronic
1040988753 8:53326384-53326406 CAGATGCCACCCATGGGAAGGGG - Intergenic
1041030133 8:53728286-53728308 CAGTAGCCACCCATGCCGAGTGG - Intronic
1048354876 8:133645239-133645261 CAGGCCCCACCCATGGAAGGTGG + Intergenic
1050943175 9:11485752-11485774 CTGTACACTCCCATGGAAAGGGG - Intergenic
1051097247 9:13480789-13480811 CAGTACACAGCCATGCTTAGGGG - Intergenic
1052792376 9:32887586-32887608 CAGTATCCATCCATGGTCATAGG - Intergenic
1059171209 9:112126925-112126947 AAATACCCATCCATGTTAAGGGG + Intronic
1061743680 9:132724825-132724847 CAATAGCCACCCATGGCTAGTGG + Intergenic
1187189024 X:17015180-17015202 CAATAGCCACACATGGCAAGTGG - Intronic
1189174345 X:38939990-38940012 CAGTTCACACTCAAGGTAAGAGG - Intergenic
1190096802 X:47487879-47487901 CAGTACCCACATATGGCTAGTGG + Intergenic
1192484499 X:71513480-71513502 CTGTACCCACCCAACGTTAGAGG + Intronic
1196176478 X:112644228-112644250 TAATACCCACCCATGGAAGGAGG - Intronic
1201735066 Y:17250870-17250892 CAGTACCCACCCATGACATGTGG + Intergenic