ID: 1139939730

View in Genome Browser
Species Human (GRCh38)
Location 16:70596562-70596584
Sequence CTGAGGCAGTGGTGGGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 565
Summary {0: 1, 1: 1, 2: 4, 3: 57, 4: 502}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139939730 Original CRISPR CTGAGGCAGTGGTGGGAAAT GGG (reversed) Intronic
900001853 1:18872-18894 CTGAGGCGGTGGTCGGGACTCGG - Intergenic
900021573 1:189395-189417 CTGAGGCGGTGGTCGGGACTCGG - Intergenic
900527101 1:3134796-3134818 CTGAGGCAGAGGCGGCAAACAGG + Intronic
901387920 1:8923305-8923327 CTGATGCAGTGATGGCAGATGGG - Intergenic
901630389 1:10645155-10645177 CTGAGGCTGTGGTGGGCCCTTGG + Intronic
902821602 1:18946745-18946767 CAGAGGCAGGGGAGGGAACTGGG - Intronic
903359456 1:22767673-22767695 CTGGGCCAGTGGTGGGAAGGAGG - Intronic
904229744 1:29058670-29058692 CTGAGGGGGTGGAGGGAAAGAGG - Intronic
904482959 1:30805518-30805540 CTGAGGCGGGGGTGGGAAGGGGG + Intergenic
904607439 1:31705407-31705429 CTGTGGCAGTGGTGGGGCCTGGG + Intergenic
904881157 1:33698120-33698142 CTGAGGCAGAAGTGCAAAATAGG - Intronic
905249113 1:36636662-36636684 CTGAGGCTGGGGTGGGATAAGGG + Intergenic
905417274 1:37812668-37812690 CTGGGGCGGAAGTGGGAAATAGG - Exonic
906056699 1:42923826-42923848 CAGAGTCTGTGGTGGGAAGTGGG + Intergenic
906125083 1:43422754-43422776 CTGGGGCACTGGGGAGAAATGGG - Exonic
906336461 1:44936138-44936160 CTAAGGCTGTGCGGGGAAATGGG - Intronic
906841819 1:49147382-49147404 ATGCAGCAGTGGTGTGAAATTGG - Intronic
907212550 1:52835992-52836014 TGGAGGCAGTGGTGGGATCTTGG - Intergenic
907235937 1:53047733-53047755 CTGAGGCAGTGTGGGGAAATGGG - Intronic
907471144 1:54674239-54674261 TTAAGGCACTGGTGGGAGATGGG + Intronic
907710947 1:56880904-56880926 ATGTGGCAGAGATGGGAAATGGG + Intronic
910051719 1:82982085-82982107 CTGTAGCACTGCTGGGAAATAGG + Intergenic
910622688 1:89273685-89273707 GAGAGGCAGGGGTGGGAACTGGG - Intergenic
911176738 1:94825102-94825124 CTGGGGCAGGGGTGGGACACAGG - Intronic
911183451 1:94881352-94881374 CTGAGGAAATGGTGGGAGAGAGG - Intronic
912145948 1:106794619-106794641 CTGGGGCAGTGGGGGGAGGTGGG + Intergenic
912306747 1:108575802-108575824 CTGAGGGATTGGAGAGAAATGGG + Intronic
912684337 1:111750110-111750132 CTGAGGCAGTGGTGTTAAATGGG + Intronic
913262338 1:117010900-117010922 CTGAGGATGTGGTGGGAAAGAGG - Intronic
913794749 1:122593822-122593844 CTGAGGCCTTCGTTGGAAATGGG + Intergenic
913833666 1:123292018-123292040 CTGAGGCCTTCGTCGGAAATGGG + Intergenic
913860140 1:123767008-123767030 TTGAGGCCTTGGTTGGAAATGGG + Intergenic
913915179 1:124753438-124753460 CTGAGGCCTTCGTCGGAAATGGG + Intergenic
913935278 1:125034990-125035012 TTGAGGCATTGGTTGGAAACTGG + Intergenic
914859176 1:151372410-151372432 CAGAGGCACTGCTGGGAGATGGG - Intronic
915083266 1:153366479-153366501 TTGAGGCAGTGCTGGGAGAGTGG - Intergenic
916549570 1:165837130-165837152 ATGTGGCAGTGTTGGGAAGTGGG - Intronic
916649947 1:166825404-166825426 CTGATGCAGTGGTGGAAAATAGG - Intergenic
916898835 1:169198701-169198723 CTGAGGGTGAGGTGGGAAGTAGG + Intronic
917309191 1:173660467-173660489 AGGAGGCAGGGGTGGGACATTGG - Intronic
918012005 1:180595597-180595619 CTGAGGCACAGGTGGGAATTGGG + Intergenic
919701061 1:200631424-200631446 ATGAGGTAGTAGTGGGAAAAAGG + Intronic
920016278 1:202912230-202912252 CTGAGGCAGTGGCAAGAAAAGGG + Intronic
920150195 1:203900237-203900259 GTGAGGCACGGGTGGGAACTGGG + Intergenic
920575878 1:207059944-207059966 GGGAAGCAGTGGTGGGAAGTGGG + Intronic
921700902 1:218267450-218267472 ATGTGGCAGTGTTGGGAGATGGG - Intergenic
922655059 1:227374842-227374864 CTGGGGGAGTGGTGAGGAATTGG - Intergenic
923209311 1:231788794-231788816 AGGGGGCAGTGGTGGGAAATGGG + Intronic
923478432 1:234359259-234359281 ATGAGGCAGTGGTGTGAGATAGG - Intergenic
923745889 1:236700001-236700023 CAGAGGCAGCTGTGGGAAGTAGG - Intronic
924793785 1:247277467-247277489 ATGTGGCAGTGTTGAGAAATGGG - Intergenic
1062953239 10:1521494-1521516 TTGAGGCAATGTTGGGAAGTCGG + Intronic
1062958659 10:1557090-1557112 CTGAGGCAATGGAAGGAAAGAGG - Intronic
1063536128 10:6885438-6885460 CTGAGGCAGTGGGGAGAGAGAGG + Intergenic
1063623314 10:7667512-7667534 CTGGGGAGGTGGGGGGAAATGGG - Intergenic
1064479093 10:15721573-15721595 GTTAGGAAGTGGTGGGAAATAGG + Intergenic
1065287321 10:24198626-24198648 CTCGGGCTGTGGTAGGAAATGGG + Intronic
1065775474 10:29115699-29115721 ATGTGGCAGTGTTGGGAAGTGGG + Intergenic
1066925471 10:41581251-41581273 CTGAGGCATTCGTTGGAAACGGG + Intergenic
1066925986 10:41590758-41590780 CTGAGGCCTTCGTTGGAAATGGG + Intergenic
1068664497 10:59658717-59658739 CTAAGGCAGTGATGGGAGAAGGG - Intronic
1068726052 10:60304817-60304839 ATGAAGCAGGGGTGGGAAAGAGG - Intronic
1069087910 10:64163024-64163046 GTGAGGCAGTGGAAAGAAATTGG + Intergenic
1069667642 10:70174163-70174185 CAGAAGGAGTGGTAGGAAATGGG + Intergenic
1069760333 10:70806288-70806310 TTGGGGCAGTGGTGGGGACTTGG - Intergenic
1071225723 10:83526304-83526326 ATGAGTCTGTGGTGGGAATTTGG - Intergenic
1071880393 10:89890663-89890685 GGGAGGCACTGGTGGGAGATGGG + Intergenic
1072100243 10:92222768-92222790 TTGAGGCAGAGGTGGGTAAAAGG - Intronic
1074983212 10:118635985-118636007 CTGAGGCTGGGGTGGCAGATGGG - Intergenic
1076159722 10:128234384-128234406 CTGAGGCAGTGATGAGGAATGGG + Intergenic
1076388423 10:130076325-130076347 GTGAGGCATTGGTGGGACACAGG - Intergenic
1077366286 11:2162608-2162630 CTGAGGCCAGGGTGGGACATAGG - Intergenic
1078639016 11:13078091-13078113 CGGAGGCACAGGTGGGAAAAAGG + Intergenic
1079283147 11:19106002-19106024 ATAAGGCACTGGTGGGAAATTGG + Intergenic
1080434060 11:32223641-32223663 CTGAGTCAGTGCTGGGAATGAGG - Intergenic
1080528521 11:33151085-33151107 CTTAGGGATTGGAGGGAAATGGG - Intronic
1080578615 11:33623123-33623145 CTGGGGCAGGTGTGGGAAGTGGG - Intronic
1080959692 11:37144494-37144516 CTGAGTCAGTGGAGGGGCATGGG + Intergenic
1081145566 11:39559216-39559238 CTGGGGTAGAGGTGGGAAATAGG - Intergenic
1081469378 11:43355772-43355794 ATGTGGCAGTGTTGGGAGATGGG + Intergenic
1081906641 11:46674557-46674579 CTGGGGCAGGGGTGGGGAAGGGG - Intronic
1082077745 11:47987452-47987474 CAGAGGCCGTGGTGGGGAACAGG + Intronic
1082321008 11:50811741-50811763 TTGAGGCATTTGTTGGAAATGGG + Intergenic
1082321713 11:50819650-50819672 TTGAGGCACTCGGGGGAAATGGG + Intergenic
1083471233 11:62885416-62885438 CAGAGGCAGAGGTGGGTTATGGG + Intronic
1084230974 11:67752604-67752626 ATGGGGCAGTGATGGCAAATGGG + Intergenic
1084321736 11:68377141-68377163 CTGAGGTTGTGGTGGGGCATGGG + Intronic
1084920922 11:72469067-72469089 CTGGGGAAGTGGTGGCAATTAGG + Intergenic
1085161831 11:74354860-74354882 CCGAGGCAGTGGCAGGAAAAGGG + Intronic
1085277472 11:75309298-75309320 CCAAGGCAGGGGTGTGAAATAGG - Intronic
1085503304 11:77041269-77041291 CTGGGGTAGTGGTGGGAAGAAGG - Exonic
1085773648 11:79346788-79346810 TTGAGGCAGTTGGGGGAAAATGG - Intronic
1085845387 11:80059108-80059130 CTTAGGAAGAGGTGGGAATTTGG + Intergenic
1088164261 11:106913556-106913578 GTGTGGCAGTGCTGGGAGATGGG - Intronic
1088410941 11:109533853-109533875 CTGAGGAGGTGATGGGAATTAGG - Intergenic
1088630863 11:111772716-111772738 CTGAGGAAGTGGGAGCAAATAGG + Intergenic
1088680311 11:112235935-112235957 CTGAATCAGTGGTGGGAACAAGG - Intronic
1089016920 11:115172909-115172931 CTGAGGGGATGGTGGGAAAAGGG + Exonic
1089092194 11:115887417-115887439 CTGAGGTAGTGGTGAGAAGGTGG + Intergenic
1089176642 11:116553313-116553335 GGGAGGGAGTGGTGGGATATTGG - Intergenic
1089754513 11:120676724-120676746 ATGTGGCAGTGCTGGGAAGTGGG - Intronic
1090248749 11:125236520-125236542 CTGAGAGCGTGGGGGGAAATAGG + Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091764911 12:3113412-3113434 CTGAGGCCATGATGAGAAATTGG + Intronic
1091936724 12:4440767-4440789 ATGAGGAAGTGCTGGGAGATGGG - Intronic
1092085793 12:5758416-5758438 GTGGGGCTGTGGAGGGAAATAGG - Intronic
1092516324 12:9218126-9218148 GTGAGGAAAGGGTGGGAAATGGG + Intergenic
1092943945 12:13436027-13436049 CAGAGGGAGTGGGGGGAAAAGGG - Intergenic
1093177695 12:15931677-15931699 GTGTGGCAGTGTTGGGAGATGGG + Intronic
1094441712 12:30485427-30485449 CTGTGGCAGGGCTGGGAAAATGG - Intergenic
1094971202 12:36252721-36252743 CTGAGGCCATCGTTGGAAATGGG + Intergenic
1095000972 12:36733935-36733957 CTGAGGCCATCGTTGGAAATGGG + Intergenic
1095029817 12:37258168-37258190 CTGAGGCCTTCGTTGGAAATGGG - Intergenic
1095029910 12:37259583-37259605 CTGAGGCCTTTGTTGGAAATGGG - Intergenic
1095030492 12:37269055-37269077 TTGAGGCATTCGTTGGAAATGGG - Intergenic
1095030608 12:37271141-37271163 TTGAGGCATTCGTTGGAAATGGG + Intergenic
1095038016 12:37414395-37414417 CTGAGGAATTCGTTGGAAATGGG + Intergenic
1098008981 12:66030490-66030512 CTGAGGGAGTGTTCAGAAATAGG + Intergenic
1098925199 12:76341884-76341906 CGGTGGCAGTGGTGAGAAACGGG + Intergenic
1100589429 12:96012051-96012073 CATAGGCTGTGGTGGGAAACAGG - Intronic
1100849706 12:98696473-98696495 CTGTGGCAGTGTTGGGAAGTAGG - Intronic
1101268786 12:103120499-103120521 CAGAGGCAGAGGTGAGAAAGAGG + Intergenic
1101528931 12:105556924-105556946 CTGAGGTAGAGGAAGGAAATGGG - Intergenic
1102558849 12:113747840-113747862 ATGAGGCAATGATGGGAACTGGG - Intergenic
1103682032 12:122701840-122701862 CTGAGGCAGATGTGGGAAGAAGG + Exonic
1103683780 12:122715301-122715323 CTGAGGCAGATGTGGGAAGAAGG + Exonic
1103776370 12:123369564-123369586 CTAAGACAGTGTTGGGAAGTTGG + Intergenic
1105643520 13:22291072-22291094 CGGAGGCTGAGGTGGGAAAATGG + Intergenic
1105774040 13:23639752-23639774 CTGAGGCAGTGGTGGGAGGGAGG + Intronic
1107808189 13:44174496-44174518 CTGAGGCAGTGGTGGCCATAGGG - Intergenic
1107955159 13:45504510-45504532 ATGAGGCAGTGATGGGTTATTGG + Intronic
1108099297 13:46936765-46936787 CTGGGGCAGTGGTGGTAAAGGGG + Intergenic
1108148148 13:47501327-47501349 CAGTGGCAGTGGGGAGAAATGGG - Intergenic
1109372234 13:61437725-61437747 CTGAGTCAATCGTTGGAAATAGG + Intergenic
1109985629 13:69980359-69980381 CTGAGGAACTGGTTGGCAATGGG - Intronic
1110661213 13:78060964-78060986 CTGTGGCTGTTGTGGGGAATGGG + Intergenic
1111076861 13:83248562-83248584 CTGGAGCAGTGGTGGCAAAAAGG - Intergenic
1111198970 13:84909288-84909310 GTGAGGCTGTGGAGAGAAATAGG + Intergenic
1111458071 13:88509104-88509126 CTGAGGCTGTGCAGGGCAATGGG + Intergenic
1113597701 13:111546358-111546380 CTGAGGCAGGGCTGGGAAACTGG + Intergenic
1113942660 13:114026496-114026518 CACAGGCAGAGGTGGGAACTTGG - Intronic
1113949946 13:114066330-114066352 GTGAGGCCCTGGTGGGAAAAGGG + Intronic
1114002094 14:18266045-18266067 TTGAGGCATTCGTTGGAAATGGG - Intergenic
1114933626 14:27506650-27506672 CTGAGGCAGCGTTGGCACATGGG + Intergenic
1114990717 14:28284985-28285007 ATGTGGCAGTGTTGGGAAGTAGG - Intergenic
1115879272 14:37896614-37896636 GGGAAGCAGTGGTGGGAAACGGG + Intronic
1117814467 14:59582865-59582887 CTGTCACAGAGGTGGGAAATTGG + Intergenic
1118889275 14:69894466-69894488 CTGTGGCAGCGGTGGGAGATAGG + Intronic
1119875714 14:78057496-78057518 TTTAGGCAGTGGTTTGAAATTGG + Intergenic
1120731095 14:88002373-88002395 GTGTGGCAGTAGTGGGAAGTGGG - Intergenic
1121042750 14:90762290-90762312 CAGAGGCACTGGTAGGAAATTGG - Intronic
1121218133 14:92264336-92264358 TGGAGGCAGTGGTGGGAGATTGG - Intergenic
1121321516 14:92994351-92994373 CTGAGGCAGGGGCGGGAGAGTGG + Intronic
1121576600 14:94993984-94994006 TGGAGGAAGTGGTGGGACATTGG - Intergenic
1122082515 14:99275113-99275135 CTGAGGCAGGGGTGGGTACATGG - Intergenic
1122257858 14:100492262-100492284 CTTAGGCAGAAGTGGGCAATTGG + Intronic
1123035277 14:105469391-105469413 CTGAGGCCGTGGTGGGCGGTGGG + Intronic
1202844711 14_GL000009v2_random:158059-158081 CTGGGGCAGTGGTGGGGAAGTGG - Intergenic
1202914108 14_GL000194v1_random:148304-148326 CTGGGGCAGTGGTGGGGAAGCGG - Intergenic
1202878563 14_KI270722v1_random:34395-34417 CTGGGGCAGTTGTGGGGAAGTGG + Intergenic
1123433437 15:20237494-20237516 CGGTGGCAGTGGTGGGAGCTTGG - Intergenic
1123726905 15:23112277-23112299 CTGGAGCAGTGGTGGGAACGTGG + Intergenic
1125102135 15:35926463-35926485 GGGAGGCAGTGGTGGGAAGATGG + Intergenic
1126113621 15:45189337-45189359 CTGAGGCAGTGGGGGAAAGGGGG - Intronic
1126154763 15:45555634-45555656 CAGCGACAGTGGTGGGACATAGG - Intergenic
1126846478 15:52765171-52765193 AAGGGGTAGTGGTGGGAAATGGG + Intronic
1126925265 15:53578354-53578376 CTCAGGCAATAGTGGGAAAGGGG + Intronic
1126986833 15:54321245-54321267 CTGAGGCAGTGGCAAGAAAAGGG - Intronic
1128328000 15:66737603-66737625 AGGAGGAAGTGGTGGGAAAGGGG - Intronic
1128332402 15:66764058-66764080 CTGAGTGAGTGGTGGGTGATTGG + Intronic
1128421903 15:67499955-67499977 CTGAGGGAGTGGGATGAAATGGG + Intronic
1129739254 15:77982039-77982061 CTGCGGCAGAGGTGAGAAGTGGG + Intergenic
1129846700 15:78771150-78771172 CTGCGGCAGAGGTGAGAAGTGGG - Exonic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130255199 15:82322741-82322763 CTGTGGCAGAGGTGAGAAGTGGG + Intergenic
1130599775 15:85267265-85267287 CTGTGGCAGAGGTGAGAAGTGGG - Intergenic
1130874297 15:87999018-87999040 CTAAGGCACTGCTTGGAAATGGG - Intronic
1130905814 15:88240337-88240359 CTGTGGCAGTGATGGGACACAGG + Intronic
1131012568 15:89031206-89031228 CCGAGGCAGTAGTGGCAAACCGG - Intergenic
1131035940 15:89222018-89222040 CTGGGGGAGGGGTGGGCAATAGG - Intergenic
1131074695 15:89487574-89487596 TGGAGTCAGTGGTGGGATATGGG - Intronic
1131774877 15:95784155-95784177 CTCAGGCAGAGGAGGGAACTTGG - Intergenic
1132451656 15:101972068-101972090 CTGAGGCGGTGGTCGGGACTCGG + Intergenic
1132538683 16:497006-497028 CTGAAGGAGTGTTGGGAAAGGGG + Intronic
1133137211 16:3720438-3720460 CTGAGGAGGTGCCGGGAAATCGG - Intergenic
1133834119 16:9351300-9351322 CTGGGGCAGTGGTGGCCAAGGGG - Intergenic
1133851690 16:9510517-9510539 AGGAGGCTGGGGTGGGAAATGGG + Intergenic
1134084785 16:11348904-11348926 CTGGGGCAGTGGTGGAAGGTAGG + Intronic
1134186710 16:12090379-12090401 CAGAGGCAGTGGGAGGGAATGGG + Intronic
1134199724 16:12187895-12187917 CTGATGCAGCTGAGGGAAATCGG + Intronic
1134419196 16:14070808-14070830 CTGAGCCAGTGTTGGGATCTGGG - Intergenic
1135180272 16:20267355-20267377 CTGGGACTGTGCTGGGAAATAGG + Intergenic
1136034865 16:27531465-27531487 CTGAGCCAGTAGAGGGAAAGGGG - Intronic
1137837043 16:51602436-51602458 TTGAGGCAGGGGTGGGGAGTGGG - Intergenic
1138346046 16:56320831-56320853 CTGGGACAGTGGTGGGAAGAGGG + Intronic
1138493092 16:57388355-57388377 CTGAGGCGGGGGTGGGAGAATGG - Intergenic
1138601440 16:58057238-58057260 AAGAGGCTGTGGTAGGAAATTGG - Intergenic
1139475763 16:67201891-67201913 CTGAGGCAGGGGTGGGGAGTTGG - Intronic
1139924560 16:70479013-70479035 CTCAGGCAGTCCTGGGAAGTGGG + Intronic
1139939730 16:70596562-70596584 CTGAGGCAGTGGTGGGAAATGGG - Intronic
1140050919 16:71480286-71480308 CTGAGGCAGTGCTGGGATGAGGG - Intronic
1141611958 16:85186953-85186975 CTGAGGGGCTGGTGGGAAAGAGG - Intergenic
1141683079 16:85555351-85555373 CTGAGTCAGTGGTGGGACGCCGG + Intergenic
1141970947 16:87482086-87482108 GTGCGGCAGTGTTGGGACATGGG - Intronic
1142756060 17:2017087-2017109 ATGAGGCCCTGGGGGGAAATTGG - Intronic
1142878050 17:2864183-2864205 CTGAGGCGGAGGTGGGGAGTGGG + Intronic
1145246515 17:21273255-21273277 CTGAGGCTGTGGTGGCAGGTAGG - Intergenic
1145272555 17:21412606-21412628 CTGAGGCTGTGCTGGGAAGGGGG - Intronic
1145310766 17:21700069-21700091 CTGAGGCTGTGCTGGGAAAGGGG - Intronic
1145496951 17:23915350-23915372 CTGAGGAATTCGTTGGAAATGGG + Intergenic
1145508935 17:24090071-24090093 CTGAGGAATTCGTTGGAAATAGG + Intergenic
1145509125 17:24092787-24092809 CTGAGGAATTCGTTGGAAATGGG + Intergenic
1145517528 17:24214606-24214628 CTGAGGAATTCGTTGGAAATGGG + Intergenic
1145537442 17:24504536-24504558 CTGAGGAATTCGTTGGAAATGGG + Intergenic
1145569055 17:24964198-24964220 CTGAGGAATTCGTTGGAAATGGG + Intergenic
1145599504 17:25407493-25407515 CTGAGGAATTCGTTGGAAATGGG + Intergenic
1145605600 17:25496410-25496432 CTGAGGAATTCGTCGGAAATGGG + Intergenic
1145614730 17:25629270-25629292 CTGAGGAATTCGTTGGAAATGGG + Intergenic
1145653598 17:26193522-26193544 CTGAGGAATTCGTTGGAAATAGG + Intergenic
1145934243 17:28705685-28705707 GTGAGGCAGTGGTGGTAGACCGG - Intronic
1146550681 17:33777907-33777929 CTGAGTCAGTGCAGGGCAATGGG - Intronic
1147381685 17:40060078-40060100 CTGAAGCAGAGGTGGGGAATGGG + Intronic
1148517406 17:48233171-48233193 CTGTGGCAGTTGTGGCTAATGGG + Intronic
1149028408 17:52056437-52056459 CTGAGGCTGGGCTGGGAAAGAGG + Intronic
1149232148 17:54546951-54546973 CTGGGGCAGGGGTGGGAAAATGG - Intergenic
1150016835 17:61565574-61565596 GTCAGGCAGTGGGGGGAAAGGGG + Intergenic
1150822920 17:68450247-68450269 CTGAGGACGTGGTGGGAGAAGGG + Intronic
1151231096 17:72685719-72685741 CTGATGCAGAGGTTGGAAATTGG - Intronic
1151413827 17:73948464-73948486 CTGGGGCAGTGGTGGGGTGTCGG + Intergenic
1151481079 17:74370316-74370338 CTGAGGGAGTGGGGTGACATGGG + Intronic
1151768071 17:76142217-76142239 CAGAGGCAGTGGTGGGGGCTGGG + Intergenic
1152013326 17:77734408-77734430 CTGGGGAGGTGGTGGGAGATGGG - Intergenic
1152023614 17:77794924-77794946 CTCAGACAGTGGTGGAAATTGGG - Intergenic
1152627110 17:81392962-81392984 CGGAGGCAGTGATGGGAACTCGG + Intergenic
1152823899 17:82451650-82451672 CTCAGGCAGTGATGGGAAGGGGG + Intergenic
1152988487 18:341015-341037 ATGAGGGAGTGGTTGGCAATGGG + Intronic
1153084727 18:1271398-1271420 ATGAGGATGTGGTGAGAAATTGG - Intergenic
1153753835 18:8260595-8260617 GTGTGGCAGTGTTGGGAGATGGG - Intronic
1154353090 18:13603421-13603443 CTGATGCAGTGGTGAGGAACAGG + Intronic
1154945359 18:21157217-21157239 CACAGGCAGTGGTGGTGAATGGG + Intergenic
1154948224 18:21183349-21183371 CTGAGGCAGTGGTGGCAGTGAGG - Intergenic
1155009415 18:21760731-21760753 ATGAGGCAGTGGTTGCAAACTGG + Intronic
1155553037 18:26987070-26987092 ATGGGGCAGTGTTGGGAGATGGG + Intronic
1156551470 18:38023627-38023649 CTGAGGCTGTGGTGGGAGTGGGG - Intergenic
1156622003 18:38864039-38864061 CTGAGGCTGTGCTGGGAAGCAGG - Intergenic
1156877466 18:42032215-42032237 GTGTGGCAGTTGTGAGAAATAGG + Intronic
1157118101 18:44881332-44881354 CTAAGGCAGGGGTGGGTAAGAGG + Intronic
1157147509 18:45179351-45179373 CTGAGGCCATGGTGGGAGAGAGG - Intergenic
1157627560 18:49063198-49063220 CTGTGTCAGGTGTGGGAAATTGG - Intronic
1157879361 18:51305197-51305219 CTGAGGCAGTGGTGGCCATGGGG + Intergenic
1158036618 18:53039578-53039600 CTGTGGCAGAGGTTGGAAAGAGG + Intronic
1158082742 18:53613799-53613821 CTAAAACAGTGGTGGCAAATAGG - Intergenic
1159305623 18:66638525-66638547 CAGAGTCAGTGCTGGCAAATTGG - Intergenic
1159519771 18:69504838-69504860 CTGAGATATTGGTGGAAAATAGG - Intronic
1160633605 19:60480-60502 CTGAGGCGGTGGTCGGGACTCGG - Intergenic
1160799366 19:960660-960682 CTGAGGCCCTGGTGGGAAGAGGG - Intronic
1161471744 19:4460724-4460746 CTGAGGCAGAGGTGGAAAGGTGG - Intergenic
1161664379 19:5565943-5565965 CTGGGGCAGCTCTGGGAAATGGG - Intergenic
1162864005 19:13530098-13530120 GTCAGGCAGTGGTGGGGAAGGGG + Intronic
1163421913 19:17218408-17218430 CTGGGGCAGTAGTGGCAATTGGG + Intronic
1164756244 19:30691892-30691914 CTGTGGCAGTGGTGGGCACCCGG + Intronic
1165742073 19:38210649-38210671 CTGAGGCTGGGGTGGGGAACGGG - Intergenic
1165953299 19:39486687-39486709 GTGTGGGAGTGGGGGGAAATGGG + Intronic
1166704602 19:44901630-44901652 CTGAGGCTGAGGCGGGAAAATGG + Intronic
1167251215 19:48399226-48399248 CTGAGGGAGGGGTGGGACCTAGG + Intronic
1167344145 19:48934946-48934968 CTGAGGCAGGCGTGGAAACTGGG - Intronic
1167581657 19:50347738-50347760 CTGAGGCCATGTTTGGAAATTGG - Intronic
1167723517 19:51195472-51195494 CTGAGGCTGATGTGGCAAATGGG - Intergenic
1168311515 19:55463314-55463336 CTGAGGCAGTGGTCTGAAGTGGG + Intergenic
1168342996 19:55636347-55636369 GTGAGGGAGTGGGTGGAAATGGG + Intronic
1168399436 19:56076297-56076319 CTGAGGCAAAGGTGGGAATGGGG + Intergenic
1168547536 19:57266069-57266091 CTGGAGCAGTGGTGCGAACTCGG + Intergenic
1202654183 1_KI270708v1_random:3443-3465 CTGGGGCAGTGGTGGGGAAGTGG + Intergenic
924963619 2:56925-56947 CAGGGGCTGTGGTGGGAAGTGGG + Intergenic
925387443 2:3472040-3472062 CTGCAGGAGTGGTGGGAAGTTGG + Intronic
925428447 2:3770837-3770859 TTGAGGCAGTGGAGTGAATTCGG + Intronic
925705548 2:6681531-6681553 CTGCGGCTGTTGTGGGAGATGGG - Intergenic
925868416 2:8248518-8248540 CTGAGTAAGTGCTGGGATATGGG - Intergenic
927176816 2:20415680-20415702 CTGTGGCTGTTGTGGGAGATGGG + Intergenic
927356747 2:22182187-22182209 GTGGGGCAGTGTTGAGAAATGGG - Intergenic
927689235 2:25196001-25196023 GTGTGGTAGTGGTGGGGAATAGG - Intergenic
928142345 2:28740671-28740693 CAGAGGAAGTGGTAGGAAATAGG - Intergenic
928234799 2:29530187-29530209 CTGAGGCAGAGAGAGGAAATAGG - Intronic
928411838 2:31060394-31060416 CTGTGGCAGGAGTGGGACATTGG - Intronic
931199297 2:60081650-60081672 CTGAAGCATTGATAGGAAATAGG - Intergenic
931922637 2:67037723-67037745 CTGAGAAAGGGGTGGGAAACAGG + Intergenic
931926068 2:67073899-67073921 CTGAGGCAGTGGCAAGAAAAGGG - Intergenic
932614858 2:73225536-73225558 ATGGGGCAGTGGTTGGAGATAGG + Intronic
932693094 2:73930148-73930170 CAGAGGGTGTGGTGGGAACTTGG + Intronic
932702967 2:74003458-74003480 CAGAGGCAGGGGTGGGGAGTGGG - Intronic
933271250 2:80235482-80235504 CTGAGGAAGTTGTGGGAAGCAGG + Intronic
933538691 2:83610621-83610643 CTGAGGCTGGGGTGGGGAAAAGG + Intergenic
933819234 2:86094814-86094836 CAGTGGCAGTGGTGGGAGAGTGG - Intronic
934472186 2:94558192-94558214 TTGAGGCATTTGTTGGAAATGGG - Intergenic
935903535 2:107818165-107818187 ATGTGGCAGTGTTGGGAAGTGGG + Intergenic
937684021 2:124676448-124676470 CTGAGGCAGTGATGCCAATTGGG - Intronic
938083823 2:128385242-128385264 CTCAGGCACTGGTGGGCACTGGG - Intergenic
938250985 2:129815571-129815593 CTGAGGCTGTGGGGGGCAGTGGG - Intergenic
938534534 2:132225634-132225656 TTGAGGCATTCGTTGGAAATGGG + Intronic
940703435 2:157074761-157074783 AGGAGACAATGGTGGGAAATTGG - Intergenic
940800181 2:158124396-158124418 GAGAGGCAGTGGTGGAGAATGGG + Intronic
940839607 2:158564623-158564645 GTGAGGAACTGGGGGGAAATGGG - Intronic
940891867 2:159042983-159043005 CTGAGATAGTGGTGGTAAACCGG + Intronic
942068408 2:172293674-172293696 CTCAGGCAGGGGTGGCAAATGGG - Intergenic
943256911 2:185606058-185606080 CAGAGTCAGTGGTGGGGAACAGG + Intergenic
944290709 2:198001458-198001480 ATGAGGTAGTGATGGGAAAAGGG - Intronic
945326326 2:208486708-208486730 CATAGGCAGTGGTGGGAAGGGGG + Intronic
945377301 2:209094161-209094183 CTGAGGCTGCTGTGGGTAATGGG + Intergenic
945899710 2:215524148-215524170 GTGTGGCAGTGTTGGGACATGGG + Intergenic
945920225 2:215748233-215748255 CTGAGGAGGAGGTGGGAAAACGG + Intergenic
946078151 2:217092989-217093011 CAGAGGCAGTGCTGAGAGATAGG - Intergenic
946738425 2:222777362-222777384 CGATGGAAGTGGTGGGAAATGGG - Intergenic
946856196 2:223952189-223952211 TGGAGGCAGTGGTGGGACATTGG + Intergenic
947726023 2:232401321-232401343 CTGAGGCAGAGGTGGAAGGTTGG - Intergenic
948337577 2:237222699-237222721 CTGAGGAAGCAGTGGGAAATGGG - Intergenic
948513750 2:238489951-238489973 CTGAGGCTGCAGAGGGAAATAGG - Intergenic
948757947 2:240170032-240170054 CTGGGGCAGAGGTGGGAGAAGGG - Intergenic
948912821 2:241013235-241013257 CAGGGGCTGAGGTGGGAAATGGG - Intronic
1169087440 20:2836130-2836152 CTGGGGCAGGGGTGGGAAGAGGG + Exonic
1169165759 20:3422165-3422187 CTGAGGGAGTGGAGGGACAATGG + Intergenic
1170156138 20:13271355-13271377 CTGATGAAGCAGTGGGAAATGGG + Intronic
1171324653 20:24280815-24280837 CTGAGGCAGTGTTGTAAAATCGG - Intergenic
1171807731 20:29699087-29699109 TTGAGGCCGTCGTTGGAAATTGG - Intergenic
1171836566 20:30157294-30157316 TTGAGGCATTCGTTGGAAATGGG - Intergenic
1171913871 20:30993864-30993886 CTGAGGCCTTCGTTGGAAATGGG - Intergenic
1172026101 20:31949861-31949883 CTGTGGCAGTGGAAGCAAATGGG - Intronic
1172086233 20:32385461-32385483 TTGATGCAGTGGTGCTAAATGGG + Intronic
1172758849 20:37307965-37307987 CTCCGGAAGTGGTGGGAACTGGG + Intronic
1173558216 20:43982897-43982919 CTAAGGCAAGGCTGGGAAATAGG + Intronic
1173565625 20:44036301-44036323 CTGAGGCTGTGCTGGGCAAGTGG + Intronic
1173835380 20:46121997-46122019 GTGAAGCAGGGCTGGGAAATGGG - Intronic
1174296813 20:49551243-49551265 TTCAGGCCGTGGTGGGAAGTGGG + Intronic
1174883674 20:54308005-54308027 TTGAGGATGTGGTGGGAAACTGG + Intergenic
1175896110 20:62336195-62336217 TGGAGGGAGTGGTGGGATATGGG - Intronic
1175936786 20:62517796-62517818 GGGAGGCTGTGGTGGGGAATGGG - Intergenic
1176041506 20:63068348-63068370 CAGAGGCAGAGGTGGGAGCTGGG + Intergenic
1176235334 20:64051118-64051140 CTGAGCCAGTGCTGGCTAATGGG + Intronic
1176633462 21:9162978-9163000 CTGGGGCAGTGGTGGGGAAGCGG - Intergenic
1176639865 21:9291836-9291858 CTGGGGCAGTGGTGCGGAAGCGG + Intergenic
1176939884 21:14911606-14911628 CTGGGGCAGTGGTGGCCACTGGG - Intergenic
1177162512 21:17563407-17563429 CTGAGGGAGGGGTGAGAGATGGG + Intronic
1177966669 21:27736215-27736237 AAAAGGAAGTGGTGGGAAATTGG + Intergenic
1178272987 21:31210329-31210351 CGGAGGCAGTGGTGGGAGGCAGG + Intronic
1178353683 21:31892855-31892877 CTGCGGCAGAGGTGGGCAAGAGG - Intronic
1180373166 22:12064663-12064685 CTGGGGCAGTGGTGCGGAAGCGG + Intergenic
1180389315 22:12210990-12211012 CTGGGGCAGTGGTGGGGAAGTGG - Intergenic
1180416624 22:12723486-12723508 CTGGGGCAGTGGTGGGGAAGTGG + Intergenic
1180423912 22:12899303-12899325 CTGGGGCAGTGGTGCGGAAGCGG + Intergenic
1180426600 22:15196837-15196859 TTGAGGCATTCGTTGGAAATGGG - Intergenic
1181022887 22:20112789-20112811 CAGAGGCTGTGGGGGGAAAAGGG + Exonic
1182110525 22:27719861-27719883 CACAGGGAGGGGTGGGAAATGGG + Intergenic
1183238485 22:36638160-36638182 CATAGGCAGTGATGAGAAATGGG - Intronic
1183379792 22:37485234-37485256 CTGAGGCAGTGGTGGGCCGGAGG - Intronic
1183453750 22:37910520-37910542 CTGAGGCAGTGGCAGAAAAGGGG + Intronic
1183505945 22:38208938-38208960 AGGTGGCAGTGGTGGGAAATGGG + Intronic
1184011338 22:41750971-41750993 TGGGGGCAGTGGTGGGGAATAGG + Intronic
1184173123 22:42771142-42771164 CTCAGGCAGTGGTGCGGAAAAGG - Intergenic
1184409722 22:44319545-44319567 ATCTGGCACTGGTGGGAAATGGG - Intergenic
1203330971 22_KI270738v1_random:88726-88748 TTGAGGCATTCGTTGGAAATGGG - Intergenic
949862102 3:8515352-8515374 CTGAGGAAGGGGTGGGATTTGGG - Intronic
950526649 3:13528362-13528384 CTGAAGTAGGGGTGGGAAAGAGG + Intergenic
952306628 3:32152659-32152681 CTGTGGCAGTGTTGGGAGGTGGG - Intronic
953556886 3:43953034-43953056 CTGAGGCAGTGGGGTGAGATCGG + Intergenic
953732693 3:45463892-45463914 CTGAGGAAGTGGTGAAAGATGGG + Intronic
953932513 3:47012771-47012793 GTGAGGCAGTTCTGGGAAAGGGG - Intergenic
954961715 3:54571350-54571372 TTCAGGCCGTGATGGGAAATGGG - Intronic
957047528 3:75387669-75387691 ATGGGGCAGTGATGGCAAATGGG + Intergenic
958586123 3:96090571-96090593 GTGAGGATATGGTGGGAAATTGG + Intergenic
959012057 3:101089105-101089127 GTGAGGCACTGTTGGGAAAAGGG + Intergenic
959328911 3:104976903-104976925 TTGAGGAAGTGTTGGGAAGTGGG + Intergenic
960333636 3:116391735-116391757 CTGAGCCCGGGGTGAGAAATGGG + Intronic
961404221 3:126667371-126667393 CTGGGACAGGGGTGGGAGATGGG - Intergenic
961698263 3:128721874-128721896 CTGAGGCAGAGATGGGAGTTGGG - Intergenic
962582496 3:136810878-136810900 CTGAGGCTGGGGTGGAGAATGGG - Intergenic
963830243 3:149999991-150000013 CTGAGGCAGTGGCAAGAAAAAGG + Intronic
964195704 3:154062185-154062207 CTGAGGCAGTCAAGAGAAATTGG - Intergenic
965020055 3:163217807-163217829 CTGAGGCAGTAGTGGCAATGGGG - Intergenic
965874386 3:173299459-173299481 CTGAGGCTGTTGTGGGAGATGGG + Intergenic
966085124 3:176061648-176061670 CTGAGTCAGTGAAGGGAGATAGG - Intergenic
966288531 3:178326686-178326708 CTGAAGGAAGGGTGGGAAATAGG - Intergenic
967123907 3:186407585-186407607 CTGAGGCAAGGGTGGAAAAATGG - Intergenic
967310343 3:188100120-188100142 ATGAGCTAGTGCTGGGAAATCGG + Intergenic
967721341 3:192819628-192819650 CTCAGGCAGAATTGGGAAATAGG - Intronic
967912927 3:194556842-194556864 CTGAGTCATGGGTGGGAAATGGG - Intergenic
967999622 3:195195910-195195932 CTGAGGCAGTGAGGAGAAAGAGG - Intronic
968347728 3:198025031-198025053 CTGAGGAAGTAATGGTAAATAGG + Intronic
1202747028 3_GL000221v1_random:113193-113215 CTGGGGCAGTGGTGCGGAAGCGG - Intergenic
968434942 4:579564-579586 CTCAGGAAGTGATGGGAAAAGGG - Intergenic
968991809 4:3918687-3918709 ATGGGGCAGTGATGGCAAATGGG + Intergenic
969525383 4:7701544-7701566 CTGAGGCCGTGGTAGGATTTGGG + Intronic
969526974 4:7708813-7708835 CTGAGGGAGTGGTGGGAGGATGG + Intronic
969704730 4:8785534-8785556 CTGAGGCTGTGGGTGGACATGGG - Intergenic
969823531 4:9738801-9738823 ATGGGGCAGTGATGGCAAATGGG - Intergenic
970147200 4:13048455-13048477 CAAAGGCAGGGATGGGAAATGGG - Intergenic
970147389 4:13051215-13051237 CTGAAGGAGAGGTGGGAAGTGGG + Intergenic
970291955 4:14582511-14582533 CTGAGGCAGCTGTGGGCAAAAGG - Intergenic
971452152 4:26810239-26810261 CTGGGGGAGTGAGGGGAAATGGG - Intergenic
972048815 4:34702599-34702621 CTGCGGCTGCTGTGGGAAATGGG - Intergenic
973110299 4:46390048-46390070 CTGGGGCCGGGGGGGGAAATTGG + Intronic
973135223 4:46698868-46698890 GAGAGGCACGGGTGGGAAATAGG + Intergenic
974800914 4:66816972-66816994 CTGGGACAGAGGTGGGAAATAGG - Intergenic
975570127 4:75808058-75808080 CTGAGTAAGTGGTGGGACAATGG - Intronic
975724046 4:77275109-77275131 CTCAGGCATTGGTTGGACATAGG + Intronic
975794155 4:77988382-77988404 CTGAGGCAGTGGCAAGAAAAGGG - Intergenic
977222241 4:94351770-94351792 CTGAGGTAGGGGTGGGGAATTGG + Intergenic
978206898 4:106090321-106090343 CTGAGGCTGTGCAGGGAAGTGGG + Intronic
978342598 4:107734336-107734358 CTGAGCCAGTGGCGGGGCATTGG - Intergenic
979791073 4:124781562-124781584 CTGTGGTAGGGGTGGGAAATGGG + Intergenic
981884550 4:149658224-149658246 CATACACAGTGGTGGGAAATTGG - Intergenic
981977449 4:150748024-150748046 CTGAGGTAGTGATGGGGAAGAGG - Intronic
982427998 4:155288709-155288731 CTGAGGCAGACGTGGGACATTGG + Intergenic
983112177 4:163765664-163765686 CTGAGGCAGTGGTGTTTAACAGG - Intronic
983667979 4:170203797-170203819 GTCAGGCAGTGGCGGGAAAGGGG - Intergenic
984882964 4:184426389-184426411 CTGAGGCAGAGACTGGAAATAGG - Intronic
1202754757 4_GL000008v2_random:50225-50247 CTGGGGCAGTGGTGCGGAAGCGG + Intergenic
986306933 5:6523030-6523052 CTGAGGCAGGGATGGGAGGTCGG + Intergenic
986745318 5:10738698-10738720 TTGTGGCAGTAGTGGGAAAATGG + Intronic
987773815 5:22338433-22338455 CTGAGAGGGTGGTGGGAAACTGG + Intronic
988121977 5:26975915-26975937 CTGAGACAGTGGTAAGAAATTGG + Intronic
988399742 5:30747516-30747538 CTGTGGCAATAGAGGGAAATAGG - Intergenic
988798377 5:34673746-34673768 CAGAGGCAGGGGTGGGAATGGGG - Intronic
988927487 5:36004256-36004278 TTGAGGCAGGGGTGGGGGATTGG - Intergenic
989405917 5:41060529-41060551 CTGAGGCAGAGGTTGAAAATGGG - Intronic
989863537 5:46416221-46416243 TTGAGGCACTGGTTGGAAACGGG + Intergenic
990332229 5:54739518-54739540 ATGAGGCAGTGGAGAGAGATGGG - Intergenic
992667448 5:79025165-79025187 CTCTGGCACTGCTGGGAAATCGG + Intronic
995250178 5:109984202-109984224 CAGGGGTAGTGGTGGGAAATGGG + Intergenic
995400536 5:111736020-111736042 CTGAGGGAGGGGCGGGAGATAGG + Intronic
995910389 5:117179793-117179815 AAGAGGCAGGGGTGGGAAGTGGG + Intergenic
997641186 5:135449850-135449872 CTGCAGCCGTGGTGGGACATTGG + Exonic
998146691 5:139733329-139733351 CTGAGGCAGCGGAGGGAAGGGGG - Intergenic
998181987 5:139952370-139952392 ATGAGGCAAGGGTGGGAAACAGG + Intronic
998588622 5:143454144-143454166 GGGAGGCAGTGGTGGAAAATTGG + Intergenic
999135204 5:149314094-149314116 CTGAGGCAGAGGTGGGCCAAGGG + Intronic
999186040 5:149709699-149709721 CTGTGGCAGTGGAGGTAAGTGGG + Intergenic
999407406 5:151319029-151319051 CTGAGGAAGGGGTGGGACTTGGG - Intronic
999514616 5:152288509-152288531 TTGAGGCAAGGGTAGGAAATAGG + Intergenic
999634900 5:153611563-153611585 TTGAGGCAGAGGTGGAAAACTGG + Intronic
999715617 5:154357722-154357744 CTAAGGCATATGTGGGAAATGGG - Intronic
999776177 5:154814541-154814563 ATGAGACAGTGCTGGGCAATGGG - Exonic
1000297856 5:159927782-159927804 CTGAGGCTCTGGTGTGAAACTGG - Intronic
1000438106 5:161238471-161238493 CTGAGGCAAGGGTGGCAAGTTGG + Intergenic
1000694247 5:164360246-164360268 CTTAGGCAGTCATTGGAAATGGG + Intergenic
1001058862 5:168471273-168471295 CTGGGCCAGTGGTGAGAAATCGG - Intronic
1001419497 5:171575752-171575774 CTGAGACAATGGTGGCAATTGGG - Intergenic
1002513272 5:179737056-179737078 CTGAGTCAGTGGGGGAAACTGGG + Intronic
1004620203 6:17324929-17324951 CTGATGCAGTGATGGCAGATGGG + Intergenic
1004776123 6:18846918-18846940 CTAAGGCAGTGGTCCTAAATGGG - Intergenic
1005662635 6:28014667-28014689 CTGATCCAGAGGTGGGAAAAGGG + Intergenic
1005759442 6:28954263-28954285 CTGGGGCAGGGGTGGGAACAAGG - Intergenic
1006618072 6:35343045-35343067 CAGAGGCAGGGGAGGGGAATGGG - Intronic
1007115596 6:39341016-39341038 CTGATGCTGTGGTGGGAGAGGGG - Intronic
1007460111 6:42011746-42011768 CTGAGGCAGTGGAGGGAGAGGGG + Intronic
1008042284 6:46815261-46815283 CTGTGGCTGTTGTGGGGAATGGG + Intronic
1008131570 6:47725301-47725323 CAGAGGAAGTTGTGGGAATTGGG - Intergenic
1008231221 6:48986787-48986809 CTGTGGCTGTGGTGGGGGATAGG - Intergenic
1010027811 6:71239976-71239998 CTGTGGCTGTGGTGGGGGATGGG - Intergenic
1010787026 6:80015528-80015550 CTGAGGCATTCTTGGGATATTGG - Intronic
1010816352 6:80362154-80362176 CTGAGGCAGCCCTGGGAAAGCGG + Intergenic
1013169356 6:107622289-107622311 CTGAGGCACTGATTGAAAATTGG + Intronic
1015103787 6:129512196-129512218 ATGATGCAGTGGTGGAAGATAGG + Intronic
1015121783 6:129708238-129708260 CTAATTCAGTGGTGGGAAGTTGG + Intronic
1015348680 6:132191043-132191065 CTGAGGAAGTGGGTGGTAATTGG - Intergenic
1017089667 6:150748042-150748064 CTGAGGCTGGGGTGGGGAATGGG - Intronic
1017408696 6:154147066-154147088 CTGAGGGAGAGGTGGGGAAGGGG + Intronic
1017578311 6:155831259-155831281 CTGAGGCAGTGGCGAGATCTTGG - Intergenic
1017630540 6:156392534-156392556 CTGAGTTGTTGGTGGGAAATGGG - Intergenic
1018088027 6:160321676-160321698 CTGAGGCAGTGGTGTGTATGTGG + Intergenic
1018612749 6:165661107-165661129 CTGAGGCAGAGGTGGCAGAAAGG - Intronic
1018840008 6:167509768-167509790 CTGACCCAGTGGTGAGAACTGGG - Intergenic
1018841152 6:167518092-167518114 CTGAGGCTGTGGGAGGAACTAGG - Intergenic
1019059224 6:169243217-169243239 CAGAGGGAGTGGTGGGAATGTGG - Intronic
1019682198 7:2356747-2356769 CCCAGGCAGTGGTGGGATCTAGG - Intronic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1021378192 7:19934889-19934911 CTGTGGCATGGGTGGGAATTGGG - Intergenic
1021496578 7:21281416-21281438 GTGAGGCTGTGGTTGGAGATGGG + Intergenic
1021610591 7:22454237-22454259 CTGAGGCAGGGGTTGGAGGTGGG - Intronic
1021826835 7:24561901-24561923 TTGAGACAGTGGTGAGAACTGGG - Intergenic
1022190487 7:28012927-28012949 CTTAGGTTGTGGTGGGAAAAAGG - Intronic
1023083330 7:36545874-36545896 CGGAGGCAGTGGTGGGAAATGGG - Intronic
1024229903 7:47355847-47355869 CTGAGGCTCTGCTGGGAAGTGGG + Intronic
1025923706 7:65939145-65939167 CTGAGGCAGTGGCAAGAAAAGGG + Intronic
1027514497 7:79125148-79125170 CAGAGGCAGTGGTAAGAAAAGGG + Intronic
1027842267 7:83328073-83328095 ATCAGTCAGTGGTAGGAAATAGG + Intergenic
1028529632 7:91824636-91824658 CTGAGGCTGCTGTGGGGAATGGG + Intronic
1028993571 7:97075964-97075986 CTGAGGCTGCTGTGGGAGATAGG + Intergenic
1029234188 7:99099595-99099617 CTGTGGCAGCGGTGGGAGGTGGG + Intronic
1029459557 7:100687133-100687155 CTGAGGCAGTGGAGGGAGGAAGG + Intronic
1030504171 7:110398754-110398776 CTGAAGTTGTTGTGGGAAATGGG + Intergenic
1031211933 7:118840352-118840374 CTGGGGCAATGGTGTGATATGGG - Intergenic
1031697623 7:124878018-124878040 GGGTGGCAGTGGTGAGAAATGGG + Intronic
1031736466 7:125368390-125368412 CTGAGGCACTGGTGGGAGTAGGG + Intergenic
1032321391 7:130889344-130889366 CGGAGGCAGTGGTGCGATCTAGG + Intergenic
1032891908 7:136205805-136205827 CTGAGAAAGAGGTGGGAAGTAGG + Intergenic
1032901191 7:136310479-136310501 CTGAGGCAATGGTGGGCATTTGG + Intergenic
1033186980 7:139236034-139236056 CTGAGTCAGTTGTCTGAAATTGG + Intronic
1033448679 7:141443664-141443686 CCGAGGAAGTCATGGGAAATGGG - Intronic
1034165082 7:149019325-149019347 GTGTGGCAGTGTTGGGAGATGGG + Intronic
1034296622 7:149978479-149978501 CTTAGGATGTGGTGGAAAATTGG - Intergenic
1034299005 7:149998890-149998912 CTGAGGGAGTGGTGGGAGGGAGG - Intergenic
1034807011 7:154097883-154097905 CTGAGGGAGTGGTGGGAGGGAGG + Intronic
1034809409 7:154118352-154118374 CTTAGGATGTGGTGGAAAATTGG + Intronic
1035040531 7:155923632-155923654 CTAATCCAGTGGTGGGAGATTGG + Intergenic
1035420628 7:158726704-158726726 CTGAGGCAGTGGTAGCAGTTGGG - Intergenic
1036579617 8:10061896-10061918 CTGCAGCAGTGGTGGGGAAGAGG + Intronic
1037580036 8:20239630-20239652 TTGAGGCAGTGGGGGGCAAGGGG + Intergenic
1037844428 8:22270568-22270590 CTGGGGCTGGGGTGGGAATTAGG - Intergenic
1039145829 8:34445626-34445648 ATGAAGCAGTGGTGGGATATAGG + Intergenic
1039264100 8:35805892-35805914 TTCAGGCAGTGGTGGAAGATGGG + Intergenic
1039311291 8:36321087-36321109 CTGAGGCACTGATGGGAGCTGGG - Intergenic
1040474628 8:47765015-47765037 CAAAGGCAGTAGTGGGAAGTGGG - Intergenic
1041134125 8:54737587-54737609 ATAAGGAAGTGGGGGGAAATTGG + Intergenic
1041157679 8:55004975-55004997 CTAACGCAGTGTTGGGAAAAAGG - Intergenic
1041309930 8:56506266-56506288 CTGAGCCAGTGGAGGGAAAAGGG - Intergenic
1041782170 8:61589087-61589109 CAGAGGCTGTGGTGGGAAAAGGG + Intronic
1043511379 8:80953523-80953545 CTGAGGCAGTGGCGCGAACCCGG - Intergenic
1046227812 8:111307968-111307990 GTGTGGCAGTGTTGGGAAGTGGG - Intergenic
1046272010 8:111909114-111909136 CAGAGGCAATGGTGGGAATTGGG - Intergenic
1046580451 8:116086261-116086283 TTGAGGCAAAAGTGGGAAATAGG + Intergenic
1047291492 8:123534597-123534619 CTGAGGCAGATGTGTGACATGGG + Intronic
1047550906 8:125871261-125871283 CTGAGGCAGAGATGGGATAGGGG + Intergenic
1048240652 8:132738462-132738484 CTAAGGAAGTGGCAGGAAATAGG - Intronic
1048500454 8:134970387-134970409 CAGAGTCAGTGAAGGGAAATAGG + Intergenic
1049248820 8:141577364-141577386 CTGAGGCAGTAGTAGGAGCTGGG + Intergenic
1049884661 9:18985-19007 CTGAGGCGGTGGTCGGGACTCGG - Intergenic
1049939579 9:532528-532550 TGGAGGGAGTGGAGGGAAATGGG - Intronic
1051325164 9:15958980-15959002 CTGAGGCAGTGGAGAGAGACAGG - Intronic
1051346299 9:16153798-16153820 CTGGGTAGGTGGTGGGAAATGGG + Intergenic
1051726185 9:20089692-20089714 CTGTGGCAGTGGTGGGCAGGGGG - Intergenic
1052199552 9:25761678-25761700 CTGTGGCAGTGGTGGCTACTAGG - Intergenic
1052453282 9:28661018-28661040 TAAAGGCAGTGGTGAGAAATTGG - Intronic
1053067068 9:35076314-35076336 ATGAGGCAGTGGCAGGACATAGG - Intronic
1055688643 9:78806252-78806274 CTGAGGTGGTTGGGGGAAATGGG - Intergenic
1057035957 9:91811727-91811749 CTGAGGGAGTGCAGGGAAACAGG - Intronic
1057040219 9:91842618-91842640 CTGAGGCAATGAGGAGAAATGGG + Intronic
1058270738 9:102968353-102968375 CTGAGTCTGTGGGGGGAGATGGG + Intergenic
1058726563 9:107810279-107810301 CTGAGGCAGGACTGGGATATGGG + Intergenic
1059164863 9:112068031-112068053 CTGCGGCAGAGGTGGCTAATGGG - Intronic
1059192952 9:112344281-112344303 TTGTGGCAGTGTTGGGAGATGGG + Intergenic
1060294110 9:122331605-122331627 GTGAGGCAGGGGTTGGAAACAGG + Intergenic
1060877860 9:127096141-127096163 CTGAGGGAGTGGTGGGGGAAAGG - Intronic
1061603914 9:131694053-131694075 CTGAGGCAGAGGTGGGAGAGGGG - Intronic
1062265015 9:135683049-135683071 CTGAGGCAGGGGCGGGAAATGGG + Intergenic
1203756302 Un_GL000218v1:130604-130626 CTGGGGCAGTGGTGGGGAAGTGG - Intergenic
1203715664 Un_KI270742v1:143280-143302 CTGGGGCAGTGGTGCGGAAGCGG - Intergenic
1203535551 Un_KI270743v1:34946-34968 CTGGGGCAGTGGTGCGGAAGCGG + Intergenic
1186923949 X:14311606-14311628 CTGGGGGAGAGGTGGAAAATGGG + Intergenic
1187095688 X:16145516-16145538 GGGAGGCAGTGGTGGTTAATGGG + Intronic
1188801830 X:34541720-34541742 CTGAGAGAGTGGAGGGAAGTTGG - Intergenic
1189218162 X:39345023-39345045 CTGAGGCTGCGGTGGGGGATGGG - Intergenic
1190021504 X:46882425-46882447 GTGTGGCAGTGTTGGGAGATGGG + Intergenic
1190030085 X:46963674-46963696 CTGGGGCAGTGGTAGGAGGTAGG + Intronic
1190862889 X:54360196-54360218 GTGTGGCAGTGGTGGGAATAGGG - Intergenic
1191274559 X:58526028-58526050 CTGAGGCCTTCGTTGGAAATGGG + Intergenic
1192343989 X:70286227-70286249 CTGAGGCAGCAGTAAGAAATTGG - Intergenic
1192801882 X:74473508-74473530 CTGAGGCAGTGGTAAGAAAAGGG - Intronic
1194926919 X:99836524-99836546 CTGCGGCAGCTGTGGGGAATGGG + Intergenic
1195023869 X:100855946-100855968 CTGAGGCAGTGGCAAGAAAAGGG - Intronic
1195027071 X:100888157-100888179 CTGAGGCAGTGGCAAGAAAAGGG - Intergenic
1195970394 X:110466900-110466922 CTGGGGAGGTGGTGGGGAATGGG - Intergenic
1196301988 X:114058379-114058401 TTGAGGCTGTGATGGGAAGTGGG + Intergenic
1197572157 X:128163152-128163174 CTGCAGCTGTTGTGGGAAATGGG + Intergenic
1199558919 X:149141634-149141656 CAAAGACAGTGGTGGTAAATTGG - Intergenic
1201169891 Y:11248228-11248250 CTGGGGCAGTGGTGGGGAAGTGG - Intergenic
1201680140 Y:16636805-16636827 CTGAGGCCATGTTTGGAAATTGG - Intergenic