ID: 1139939968

View in Genome Browser
Species Human (GRCh38)
Location 16:70598158-70598180
Sequence GAAGCATCTCAGACCCTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1139939968_1139939970 -8 Left 1139939968 16:70598158-70598180 CCTTAAAGGGTCTGAGATGCTTC 0: 1
1: 0
2: 1
3: 11
4: 120
Right 1139939970 16:70598173-70598195 GATGCTTCTCCATCTTGGCATGG 0: 1
1: 0
2: 0
3: 36
4: 1346
1139939968_1139939973 27 Left 1139939968 16:70598158-70598180 CCTTAAAGGGTCTGAGATGCTTC 0: 1
1: 0
2: 1
3: 11
4: 120
Right 1139939973 16:70598208-70598230 GCCCCCCAGAACTTCCTGCCAGG 0: 1
1: 0
2: 1
3: 28
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139939968 Original CRISPR GAAGCATCTCAGACCCTTTA AGG (reversed) Intronic
902799756 1:18821841-18821863 GGAGCTTCTCAGACTCTTTAAGG - Intergenic
907371545 1:54006732-54006754 GAAGCACCTCACACCATGTAGGG - Intergenic
908138982 1:61163215-61163237 GTAGGATCTGAGACACTTTATGG + Intronic
916755848 1:167769656-167769678 GTAAAATCTCAGACCCTTCACGG + Intronic
917722358 1:177797672-177797694 GCAGCATCTCAGCCTCTTTTAGG - Intergenic
917928869 1:179810300-179810322 GAGGCTTCTCAGAACCTTGAAGG + Intronic
920874082 1:209818068-209818090 GAAGCATCTCTGTCTCTTTCTGG + Intergenic
1064272439 10:13877803-13877825 GAACCATCCCAGACACTTCATGG + Intronic
1065748225 10:28861177-28861199 GAAACATCTAATACCCATTATGG - Intronic
1072496589 10:95967228-95967250 AAAGTATCTCAGGCCCTTTTTGG - Intronic
1074834361 10:117274855-117274877 GTTGCATCTCAGTGCCTTTAAGG - Intronic
1075380359 10:122013759-122013781 GAAGCAATTCAGAGCCTGTAGGG + Intronic
1076443774 10:130498085-130498107 GAAGCATCTCAGGACCTTCCCGG - Intergenic
1085217701 11:74847157-74847179 GAAATATCTCAGAACCTTTTTGG - Intronic
1088603875 11:111510560-111510582 CAAGGATCTCATTCCCTTTATGG - Intronic
1090841411 11:130491107-130491129 GAAGGATCTCAGATCATTTAAGG + Intergenic
1091103532 11:132897645-132897667 GCAGCACCTCAGCCCCTTTCTGG + Intronic
1091990871 12:4954877-4954899 GCAGAATCACAGACCCTCTAAGG + Intergenic
1094851875 12:34385945-34385967 GAAGCATCTCTGGCCCTTAGAGG - Intergenic
1096069062 12:48764661-48764683 CTAGCATCTCACACCCTTCATGG - Intergenic
1097510603 12:60534501-60534523 AAAAAATCTCAGACCCTTCATGG - Intergenic
1106123446 13:26881166-26881188 AAAGAATCTCAGACACATTAAGG - Intergenic
1107799982 13:44096980-44097002 GAAGCATCTCAGAGCATGTTTGG - Intergenic
1108936962 13:55893480-55893502 GAAGCATCTGAGACCTTTTATGG - Intergenic
1109451388 13:62519165-62519187 GTAAAATCTCAGACCCTTCATGG - Intergenic
1111342988 13:86913009-86913031 GGAGCATGTCATTCCCTTTACGG - Intergenic
1116565973 14:46444609-46444631 GAACCACCTCAGATCCTTCAGGG - Intergenic
1125854201 15:42933448-42933470 GAAGGATCTCAGAACATTTTGGG + Intergenic
1126630190 15:50726910-50726932 GAAGCTTCTCAGATTCTATAGGG - Intronic
1127646154 15:60961537-60961559 GTAGCAGCTGAGACGCTTTATGG - Intronic
1128185471 15:65640435-65640457 CATGCATCTCAGACCCCTAAAGG + Intronic
1132346317 15:101111223-101111245 GAAGCAGCTCAGTCCCTCTGAGG - Intergenic
1133450191 16:5897403-5897425 TAAGTATGTAAGACCCTTTAAGG - Intergenic
1134645168 16:15859281-15859303 TCTGCATCTCAGACCCTTTTGGG + Intergenic
1134682449 16:16135825-16135847 GAATCTTCTAAGACACTTTAGGG - Intronic
1137526494 16:49240979-49241001 GAAGGCTTTCAGACCCTTTCTGG + Intergenic
1139939968 16:70598158-70598180 GAAGCATCTCAGACCCTTTAAGG - Intronic
1144373998 17:14620766-14620788 GAAGCTTCTCAGAGCCTGCAGGG + Intergenic
1144798286 17:17907401-17907423 GAAGCCTCTCTGAGCTTTTAGGG - Intronic
1147612550 17:41810637-41810659 CAAGCTTCCCAAACCCTTTAGGG + Intronic
1161223816 19:3133058-3133080 GAAGTAGCTCAGCCCGTTTAGGG + Intergenic
1162335704 19:10058959-10058981 GAAGCATCCCACACCCACTAGGG - Intergenic
1162625792 19:11883917-11883939 AAAGTATCTCTGCCCCTTTAAGG + Intergenic
1164557637 19:29265968-29265990 GAAGAAGCTCAGACTCTTTGGGG - Intergenic
1164780007 19:30884522-30884544 GAAGCTTCTGAGACCCTGTGAGG - Intergenic
1165323560 19:35100764-35100786 GAAGCAGCTCTGAGCCTTTTAGG - Intergenic
1167672565 19:50861879-50861901 GAAGCCTTTGAGACCCTTTAGGG + Intronic
1168344936 19:55645647-55645669 ACAGCATCTCAGACCCTCTTTGG + Intronic
925623963 2:5823823-5823845 GAATCATCTGAGACTTTTTAAGG - Intergenic
925626591 2:5847439-5847461 GAATCATCTGAGACTTTTTAAGG - Intergenic
925757524 2:7148015-7148037 GAAGCATTTGAGACACTTTAGGG - Intergenic
926772474 2:16390774-16390796 CAAGCATCTCACACCTTGTATGG - Intergenic
927572427 2:24171528-24171550 CAGGCATCTCAGACCCTTCTAGG + Intronic
929443914 2:41988211-41988233 GCAGCATCTCAGTGCCTTTATGG - Intergenic
930442291 2:51424663-51424685 GCAGCATGTCAGACCATTTGTGG - Intergenic
931525399 2:63147081-63147103 GAAGTAACTCAGACTCTTTGAGG + Intronic
934458293 2:94193361-94193383 GCAGCATCTCAGTCTCTGTAAGG - Intergenic
935215518 2:100972499-100972521 GAAGCATCTCTCACCCCTGAAGG + Intronic
938154048 2:128913609-128913631 GAAGAATCTCAAAAGCTTTATGG + Intergenic
940293483 2:152099174-152099196 GAAGCGCCTCGGTCCCTTTAAGG - Intergenic
941419622 2:165266702-165266724 GTAGCATCTGAAACCTTTTACGG - Intronic
943051405 2:182917908-182917930 GAAGCAACTTAGACCCATGAAGG + Intronic
945055405 2:205864420-205864442 GAGGCATTTCTGACCCTTTCTGG + Intergenic
945384424 2:209180061-209180083 ACAGCATCTCAGCCCCTTTGGGG - Intergenic
946391117 2:219417670-219417692 AAAGCTTATCAGACCCTTTCTGG + Intergenic
947087272 2:226467421-226467443 GAAGCACGTCAGATCATTTAGGG - Intergenic
947677430 2:231995503-231995525 GAAAAAACTCAGACCCTTGAAGG - Intronic
949041125 2:241850403-241850425 GCAGCACCTCAGGCCCTTTGTGG - Exonic
1171386789 20:24775005-24775027 AAAGCATAACAGACCCTGTAGGG + Intergenic
1172766307 20:37352871-37352893 GAAGCATCTCAGCCACTGGAGGG - Intronic
1174463497 20:50699559-50699581 GAACAATCTCAGTCCTTTTAAGG + Intergenic
1175113068 20:56662677-56662699 GAAACATCACAAACCCTGTAAGG - Intergenic
1175161501 20:57011427-57011449 AAAGCATCTCAGAAGCTTGATGG + Intergenic
1175480100 20:59304635-59304657 GCAGCATCTCAGATCCTCGAAGG - Intronic
1175748484 20:61478158-61478180 GTAGCATCTGGAACCCTTTAGGG - Intronic
1177085016 21:16692961-16692983 GAAATATGTCAGACCCCTTAAGG + Intergenic
1182421709 22:30251649-30251671 GTAGCATCTCAGAACCTTGTGGG + Intergenic
1182801993 22:33039034-33039056 GAGGCATCTCAAAGGCTTTATGG - Intronic
951156947 3:19367005-19367027 GAAGCATAGAAGACCCTTCAGGG + Intronic
954918270 3:54167051-54167073 GAAGCATCTTACTCCCTTTGCGG + Intronic
954943245 3:54393986-54394008 GAAGCATCCTAGACCCTGTATGG - Intronic
958132848 3:89451568-89451590 GAAGCATTTCAGACCTATTTGGG + Intronic
959674454 3:109019051-109019073 GAAGCTTCTCTGAACATTTAGGG - Intronic
962887354 3:139639789-139639811 GTAAAATTTCAGACCCTTTATGG + Intronic
963128379 3:141835814-141835836 GACGCATGTCACTCCCTTTACGG + Intergenic
969579100 4:8053621-8053643 GAGGCATCTAAGAGCCTTTGTGG - Intronic
972480448 4:39491415-39491437 GTAGAACCTCAGACCCTTTCTGG + Intergenic
979790074 4:124768672-124768694 GAAGCATTTGAGACTCTTTCTGG - Intergenic
981264219 4:142762210-142762232 TAAGCATCTTAGAGCCTTCAGGG + Intronic
986106374 5:4663251-4663273 TAATCATCCCAGATCCTTTATGG + Intergenic
988330898 5:29838505-29838527 GTAGCATCTCAGATACTATAAGG - Intergenic
988973762 5:36495143-36495165 GATGCATCCCACCCCCTTTAAGG + Intergenic
991281858 5:64923417-64923439 GATGCATCTCAAGCCCTTAATGG - Intronic
991697701 5:69288449-69288471 GAAGCTCCCCAGACCCTTTTGGG - Intronic
996644784 5:125800267-125800289 GAAGCAGCTTAAACCTTTTATGG + Intergenic
1000377032 5:160592312-160592334 GATGCATCTCAGAGCCTGGAGGG + Intronic
1003724455 6:8744697-8744719 GAATCATCTCACACACTGTAAGG + Intergenic
1003890112 6:10556530-10556552 TAAATATCTCAGACCCTTTGAGG + Intronic
1007117011 6:39349981-39350003 AAAGCATCTCATTCCCTTTCGGG + Intronic
1007444693 6:41895686-41895708 GGAGCGTCTCTGGCCCTTTAAGG - Intergenic
1009697436 6:67125518-67125540 GCAGCTTCTGAGACCCTATATGG - Intergenic
1014297836 6:119642294-119642316 GAAGCATCTCAGATACAGTAGGG - Intergenic
1014383527 6:120774053-120774075 GAAGCATCTCAGAAAATTTAGGG + Intergenic
1014825504 6:126045316-126045338 GCAAAATCTCAGACCCTTCATGG + Intergenic
1017686571 6:156919549-156919571 GAAGCATCTCAGACACTGTTGGG + Intronic
1018311021 6:162508669-162508691 AAGGCCTCTCAGACTCTTTAAGG + Intronic
1018900215 6:168048106-168048128 GGAGCATCTCAGAACCTGTGGGG - Intergenic
1020563468 7:9765792-9765814 AAAAAATCTCAGACCCTTCACGG + Intergenic
1027888376 7:83938125-83938147 GAACAAGCTCAAACCCTTTATGG - Intergenic
1028126978 7:87124517-87124539 AAAAAATCTCAGACCCCTTAGGG - Intergenic
1028805267 7:95018906-95018928 GTAAAATCTCAGACCCTTCATGG + Intronic
1031355235 7:120780896-120780918 GCAGCAACTGAGACGCTTTACGG - Intergenic
1033426676 7:141251014-141251036 GGAGCATAGCTGACCCTTTAGGG - Intronic
1035550209 8:517386-517408 GAAGCATCTGACACCGTTTAAGG + Intronic
1036443606 8:8802899-8802921 GCAGCAACTCAGCCCCTTTAAGG - Intronic
1038371426 8:26995803-26995825 GAAGAATCTCAGAAACATTACGG - Intergenic
1039538289 8:38339748-38339770 GAAGTTTCTAAAACCCTTTAGGG + Intronic
1039810866 8:41047277-41047299 GCAGCATCTCAGATGATTTAGGG - Intergenic
1040039186 8:42898311-42898333 GTTGCATATCAGACCATTTAGGG + Intronic
1045312667 8:101016771-101016793 CAAGCATCTCACACCATTTGGGG + Intergenic
1047487325 8:125343324-125343346 AAAGCTTCTCAAATCCTTTAAGG - Intronic
1049677163 8:143895445-143895467 TAAGCACCTCAGTCCCTTCAGGG + Intergenic
1053825769 9:42022765-42022787 AAAGCCTTTCAAACCCTTTAAGG - Intronic
1054604794 9:67164628-67164650 AAAGCCTTTCAAACCCTTTAAGG + Intergenic
1056804814 9:89720278-89720300 GAAGCATCTCAGCCCCCTGTGGG + Intergenic
1057503961 9:95617679-95617701 GAAGTGTCTCAGACACTTTTTGG + Intergenic
1060136273 9:121158046-121158068 GAAGCACCTCAGATTCTTTAAGG - Exonic
1186599994 X:11026662-11026684 GAAGCAGCTCAGACTCTGGAAGG - Intergenic
1187621493 X:21061209-21061231 GTGGCAGCTCAGACCCTGTAGGG + Intergenic
1188844631 X:35058229-35058251 GAGGCATCCTAGCCCCTTTAAGG + Intergenic
1190988299 X:55520937-55520959 GAAGGTGCTTAGACCCTTTAAGG + Intergenic
1197674997 X:129319798-129319820 GTAAAATCTCAGACCCTTCAAGG - Intergenic
1199712076 X:150476772-150476794 AAAGCATATCAGACCCAGTAGGG - Intronic