ID: 1139942205

View in Genome Browser
Species Human (GRCh38)
Location 16:70613385-70613407
Sequence CATGGCGGCCACACTGGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 7, 3: 24, 4: 142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1139942205 Original CRISPR CATGGCGGCCACACTGGATG GGG Intronic
900387582 1:2417562-2417584 AATGGCGTCCACTCTGGATGTGG + Intergenic
900656590 1:3761830-3761852 CATGGAGGCCACCCTGCAGGCGG + Intronic
901314395 1:8296084-8296106 CATGGTGGCCCCACAGGCTGAGG + Intergenic
901630663 1:10646713-10646735 CATGGGCGCCACCGTGGATGTGG + Intronic
905324428 1:37140740-37140762 CATGCCGAAGACACTGGATGGGG - Intergenic
905740357 1:40364959-40364981 CATGGTGGCCAAAGTGGATGAGG + Intronic
906566512 1:46804888-46804910 CAGGGCTGCCACTATGGATGGGG - Intronic
909906988 1:81208994-81209016 CATGGCGGCCAAAGCGGATGAGG + Intergenic
911274777 1:95848259-95848281 CATTGCGGCCATTCTGGCTGAGG + Intergenic
913220290 1:116654564-116654586 CAGGGAGGCCACACTGCAGGAGG + Intronic
914342334 1:146770828-146770850 CATGGCATCCAGACTGGATAGGG - Intergenic
918437159 1:184527252-184527274 CATAGCTGCCACACTTGATAAGG - Intronic
919666506 1:200297886-200297908 CAGGGTGGTGACACTGGATGAGG - Intergenic
921067676 1:211634107-211634129 CCTGGGGGCCACACTGCCTGTGG - Intergenic
922339548 1:224644413-224644435 CATAGCTGCCACCTTGGATGGGG - Intronic
1067753125 10:48984936-48984958 AATGGAGGGCACACGGGATGAGG + Intergenic
1068725002 10:60290944-60290966 CATAGTGGACAGACTGGATGAGG - Intronic
1071514928 10:86291108-86291130 CATGGTGGCCACACTCTCTGGGG - Intronic
1074355839 10:112782322-112782344 CTTGGAGGCCACACTGGAAAAGG + Intronic
1076869676 10:133187213-133187235 CGTGGCCTCCACACAGGATGGGG + Intronic
1077102760 11:829451-829473 CACGGCGGGCTCTCTGGATGAGG + Exonic
1077327507 11:1970073-1970095 CCTGGCGGCCTCACTGGGGGAGG - Intronic
1081692323 11:45086827-45086849 TATGGCCACCACACAGGATGGGG - Intergenic
1083240527 11:61384657-61384679 CATGGTGTCCACACAGGATATGG + Intergenic
1084791591 11:71478400-71478422 CCTGACGGCCACGCTGGATCTGG + Exonic
1085309637 11:75508682-75508704 CATGGGGGCCACAGTGGGGGAGG - Intronic
1088879812 11:113964569-113964591 AATGGGGGCCTCACTGGATCAGG - Intergenic
1089607900 11:119652226-119652248 CATGGTGACCACACCGGGTGGGG - Intronic
1104920376 12:132287567-132287589 GCCGGCGGCCACACGGGATGAGG - Intronic
1112140479 13:96635810-96635832 CTGGGAGCCCACACTGGATGTGG + Intronic
1115530984 14:34326970-34326992 GATGGGGGCCACACTGAATAAGG - Intronic
1121312315 14:92941806-92941828 CATGGCAGCCACAGGGGACGTGG - Exonic
1122101093 14:99410110-99410132 CAGGGCAGCCACGCTGGAGGAGG + Intronic
1122675799 14:103412320-103412342 CACGGTGGCCAAAGTGGATGAGG - Intronic
1122848765 14:104515355-104515377 AATGGCTGTCACACTGGCTGGGG - Intronic
1122981390 14:105193779-105193801 CATGGAGCCCACAGTGGCTGGGG + Intergenic
1128450806 15:67804982-67805004 CATGGAGGCCAGGCTGGGTGTGG - Intronic
1128505939 15:68272788-68272810 CATAGGAGCCACACTGGGTGTGG - Intergenic
1128666021 15:69538974-69538996 CATGGGGGCCACTCTGGACATGG - Intergenic
1129458559 15:75688625-75688647 CCTGGAGGCCACCCTGGAGGAGG - Exonic
1129725234 15:77898247-77898269 CCTGGAGGCCACCCTGGAGGAGG + Intergenic
1130273283 15:82463453-82463475 CCTGGAGGCCACCCTGGAGGAGG + Intergenic
1130465634 15:84190824-84190846 CCTGGAGGCCACCCTGGAGGAGG + Intergenic
1130487057 15:84403996-84404018 CCTGGAGGCCACCCTGGAGGAGG - Intergenic
1130498631 15:84482712-84482734 CCTGGAGGCCACCCTGGAGGAGG - Intergenic
1130587924 15:85195419-85195441 CCTGGAGGCCACCCTGGAGGAGG + Intergenic
1132048941 15:98591076-98591098 TCTGGCGGCCACAATGAATGAGG - Intergenic
1133722522 16:8508363-8508385 CATGCTGGCCACCCAGGATGTGG + Intergenic
1134494840 16:14724704-14724726 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134500223 16:14763824-14763846 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134526765 16:14950436-14950458 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134545641 16:15105912-15105934 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134580356 16:15365226-15365248 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134714342 16:16348913-16348935 GATGGGGGCCCCACTGGGTGGGG - Intergenic
1134722217 16:16392277-16392299 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134945210 16:18319592-18319614 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134952474 16:18359745-18359767 GATGGGGGCCCCACTGGGTGGGG + Intergenic
1136025064 16:27463741-27463763 CAGAGCGGCCACCCTGGAGGTGG + Intronic
1136510663 16:30736573-30736595 CCTGGAGGCCTCACTGGAGGAGG + Exonic
1138481783 16:57308008-57308030 TAAGGGGGCCACACAGGATGGGG - Intergenic
1139942205 16:70613385-70613407 CATGGCGGCCACACTGGATGGGG + Intronic
1139991942 16:70946592-70946614 CATGGCATCCAGACTGGATAGGG + Intronic
1141730028 16:85816075-85816097 CACGGTGGCCAAAGTGGATGAGG - Intergenic
1145125917 17:20300066-20300088 CATGGCAGCCACACATGATGTGG - Intronic
1145232420 17:21183737-21183759 CATGGACACCACAGTGGATGTGG + Exonic
1150277922 17:63911543-63911565 CATGGTGGCCAACCTGAATGCGG + Intronic
1152858419 17:82679946-82679968 CAAGGCAGCCACAGTGGCTGTGG + Intronic
1152905876 17:82970662-82970684 CATCACGGCCACGCTGGGTGCGG - Intronic
1153202049 18:2656386-2656408 CATGGCGGGCACACGGGAGAGGG - Intronic
1160388393 18:78512055-78512077 CATGGCGGCCCCACTGCCAGTGG - Intergenic
1161270619 19:3387576-3387598 GCTGGGGGCCACTCTGGATGGGG + Intronic
1161958526 19:7509512-7509534 AATGGTGGGGACACTGGATGTGG + Intronic
1162478502 19:10915010-10915032 CATGGCTGCTACCCTGGCTGGGG - Intronic
1163533309 19:17863102-17863124 CTTGGTGGCCCCACAGGATGGGG + Intronic
1163865289 19:19768754-19768776 CATGCTGGCCAAAGTGGATGAGG + Intergenic
1164560651 19:29289768-29289790 GATGGAGGAAACACTGGATGTGG + Intergenic
1166996155 19:46720562-46720584 CCTGGCCGCCACGCTGGCTGGGG - Exonic
1167145654 19:47679845-47679867 CACGGCGGCCACACTGGGCCTGG + Exonic
1167382482 19:49146551-49146573 CAAGGAGGACACACTGGCTGTGG + Intronic
925200049 2:1959808-1959830 CATGGCCTCCACACCGTATGTGG - Intronic
930801769 2:55450117-55450139 CATGGTGTCCACATTGCATGTGG + Intergenic
930802263 2:55455220-55455242 CATGGTGTCCACATTGCATGTGG + Intergenic
1171504413 20:25622178-25622200 TGTGGAGGACACACTGGATGTGG + Intronic
1172126160 20:32626544-32626566 CATGGTGGCAACACTGGACGGGG + Intergenic
1172128287 20:32638546-32638568 CTTGGTGGCCACCCTGGAAGAGG + Intergenic
1174294981 20:49539539-49539561 CATGGGGGCCCCAGTGGGTGGGG - Intronic
1174606239 20:51763778-51763800 GTGGGTGGCCACACTGGATGAGG - Intronic
1179799277 21:43803354-43803376 CTTGGCGCCCACACTGGACACGG + Intronic
1180821591 22:18832583-18832605 CAGGGAGGCCACACTGCAGGAGG + Intergenic
1181191387 22:21143462-21143484 CAGGGAGGCCACACTGCAGGAGG - Intergenic
1181207812 22:21267048-21267070 CAGGGAGGCCACACTGCAGGAGG + Intergenic
1183261583 22:36798960-36798982 CCTGGCTACCACCCTGGATGAGG + Intergenic
1183462793 22:37962513-37962535 TATGGCTGTCACACTGGGTGTGG - Intronic
1183496517 22:38148066-38148088 CATATCGGCAACACTTGATGTGG - Intronic
1183574152 22:38676382-38676404 CAGGGAGGCCACAGTAGATGAGG + Intergenic
1203219109 22_KI270731v1_random:28368-28390 CAGGGAGGCCACACTGCAGGAGG - Intergenic
1203271716 22_KI270734v1_random:58459-58481 CAGGGAGGCCACACTGCAGGAGG + Intergenic
950433898 3:12967449-12967471 CATGGCGGCCGCAGTGGGAGCGG + Exonic
952886872 3:38017565-38017587 CATGGAGGGCACATTGGAAGCGG - Intronic
954414369 3:50385753-50385775 CATGGAGGCCAGAGTGGAAGCGG + Intronic
954746616 3:52791028-52791050 CTTGGAGGCCACACTGGAGGTGG - Intronic
954800991 3:53186756-53186778 CATGGAGGGCAGACTGGAAGTGG - Intronic
955707399 3:61742658-61742680 CATGGTGGCCAAAGTGGGTGAGG - Intronic
955797452 3:62652589-62652611 GTTGGCTGCCACACTGGATCAGG + Intronic
955988016 3:64595297-64595319 CATGGTGGGAACACTGGATAAGG + Intronic
961380862 3:126495852-126495874 CATGGTGGCCACACTGGGAGGGG - Intronic
961561734 3:127734804-127734826 CATGGCAGGCACACGGGCTGAGG + Intronic
961824937 3:129594160-129594182 CATGGCTACCACACCGGCTGCGG + Intronic
963068004 3:141279198-141279220 CCTGGCTGCCATTCTGGATGGGG - Intronic
968504827 4:966918-966940 CATGCCGGCCAGACTCGGTGGGG - Intronic
969057674 4:4412332-4412354 ACTGGCGGCCACAATGGAAGGGG + Intronic
969058063 4:4414269-4414291 ACTGGCGGCCACAATGGAAGGGG + Intronic
970618749 4:17795209-17795231 CTTGGTAGCAACACTGGATGCGG - Intergenic
971104383 4:23506555-23506577 AATGATGGCCACTCTGGATGGGG + Intergenic
971382054 4:26108051-26108073 CTGGGCAGCCACACTGGATGAGG - Intergenic
972245616 4:37243728-37243750 CAGGGCGGCCACAGAGGACGCGG - Intergenic
979989242 4:127355018-127355040 CATGGCGGCCACCCTGGAATAGG + Intergenic
990940719 5:61200537-61200559 CAAGGAGGCCCCACTGGTTGAGG + Intergenic
991650425 5:68847117-68847139 CATGGTGGCCAGACTGGAAGGGG + Intergenic
993354076 5:86884431-86884453 CATGGTGGCCAAAGTGGATGAGG - Intergenic
998000422 5:138620740-138620762 CATGGTGGCCAAAGTTGATGAGG + Intronic
1001586649 5:172837345-172837367 TATGGCGGCCAAAATGGATGAGG - Intronic
1002832622 6:836627-836649 CATGGGGCCCACGCTGGGTGGGG + Intergenic
1004469341 6:15915510-15915532 CAGGGAGGCCACACTGAAGGCGG + Intergenic
1006183542 6:32167876-32167898 CATGGCAGACACAGTGGCTGTGG - Intronic
1006637397 6:35470297-35470319 CATGGTGGCCAAAGTGGATGAGG + Exonic
1007097093 6:39220101-39220123 CTTGTTGGCCACACTGGGTGGGG - Intronic
1008864677 6:56195109-56195131 CATGGAGGCCTCACCAGATGTGG + Intronic
1018902229 6:168057397-168057419 CACGGCAGCCACACTGCTTGTGG + Intronic
1019579325 7:1752277-1752299 CATGGTGGCCCCTCTGGGTGGGG - Intergenic
1028084283 7:86617247-86617269 CATCCTGGTCACACTGGATGTGG - Intergenic
1028522493 7:91747509-91747531 CATGGTGGCCCCATTGGTTGAGG - Intronic
1029474899 7:100777275-100777297 CAAGGCGGCCACATTGCCTGAGG - Intronic
1029525034 7:101088964-101088986 CAGGGCGGCCACGCTGCAAGGGG - Exonic
1030401650 7:109059174-109059196 CATGGGGGCCACTGTGGTTGGGG + Intergenic
1031071739 7:117169557-117169579 CACGGGTTCCACACTGGATGAGG - Intronic
1031963016 7:128006661-128006683 CCTGGTGACCACACTGGGTGTGG - Intronic
1039135979 8:34323195-34323217 CATGGTGGCCAAAGTGGACGAGG - Intergenic
1040411338 8:47157546-47157568 TATGGTGGCCAAAGTGGATGAGG + Intergenic
1040594503 8:48824372-48824394 CACGGAGGCCACACTGCAGGAGG + Intergenic
1042621123 8:70705574-70705596 CAAGGAGGCCATACTGGAAGTGG + Intronic
1042850612 8:73212428-73212450 CAAGGCTGCCACACAGGATGGGG - Intergenic
1048016978 8:130506469-130506491 CACAGCTCCCACACTGGATGTGG + Intergenic
1056818282 9:89817497-89817519 CATGGCAGGCACACAGGAGGTGG + Intergenic
1060754866 9:126205559-126205581 CATGCTGGCCACACTCGATGAGG - Intergenic
1185469999 X:376534-376556 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470015 X:376595-376617 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470031 X:376656-376678 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470047 X:376717-376739 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470091 X:376892-376914 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470107 X:376953-376975 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470123 X:377014-377036 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470139 X:377075-377097 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470169 X:377193-377215 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470199 X:377311-377333 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470229 X:377429-377451 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470259 X:377547-377569 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470274 X:377604-377626 CATGGCGGCCCCACTGTAGACGG - Intronic
1185470288 X:377665-377687 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470304 X:377726-377748 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470320 X:377787-377809 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470335 X:377848-377870 CACGGCGGACCCACTGGGTGTGG - Intronic
1185470351 X:377909-377931 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470366 X:377966-377988 CATGGCGGCCCCACTGTAGACGG - Intronic
1185550602 X:980602-980624 CATGGCAGCCCCAGTGGGTGAGG - Intergenic
1185550635 X:980706-980728 CATGGCAGCCCCAGTGGTTGAGG - Intergenic
1189047122 X:37605200-37605222 GATTGAGGCCACAGTGGATGTGG + Intronic
1190027544 X:46939115-46939137 CATGGAGGCCAGGCTGGGTGTGG - Intronic
1194377611 X:93154307-93154329 CATGGAGGCCACACTGCCAGTGG - Intergenic
1194765510 X:97843222-97843244 CAAGGCGGGTATACTGGATGAGG - Intergenic
1197980680 X:132216219-132216241 CTGGGTGGCCAAACTGGATGTGG - Intronic
1201975651 Y:19845975-19845997 CCTGGCAGTCACACTGGGTGTGG + Intergenic
1202369601 Y:24187903-24187925 CCTGGAGGCCACCCTGGAAGAGG - Intergenic
1202501184 Y:25482214-25482236 CCTGGAGGCCACCCTGGAAGAGG + Intergenic